regreso al inicio

Desahógate con tus mensajes

( click aquí para escribirlos )


Portal Cd. Juárez no es responsable de los textos que aparecen en esta página.
Portal Cd. Juárez se reserva el derecho de borrar cualquier mensaje.



FLOWER ( e-mail: )
Lunes 18.08.2014 / 05:17
PURO ZACATECAS HIJOS DE PUTA C.D.G PATRUYANDO LA Cd.


ROCHYXD23 ( e-mail: kemarulasss@hotmail.com )
Viernes 01.08.2014 / 01:46
"para que triunfe el mal, sólo es necesario que los buenos no hagan nada"

vein ek ( e-mail: )
Viernes 25.07.2014 / 05:05
Ekekekekekeke vein vein blue blue fure fure los mejores de san jon tilapa jajaja

( e-mail: )
Martes 10.06.2014 / 15:33
arriva el 5 siete chino

( e-mail: )
Domingo 08.06.2014 / 12:58
todos son culos

LA SIERRA ( e-mail: )
Lunes 02.06.2014 / 08:36
AQUI REPORTANDOSE PURA GENTE NUEVA DE LA LINIA PARA LAS PERRAS DE LOS AA YA LOS TENEMOS EN LA MIRA BOLA DE LIANDROS LOS BAMOS A TOPAR ABER SI ASI COMO PONEN SUS MAMADAS SON PERRAS DOBLADAS DE MIERDA LOS BOY APONER EN LA ENTRADA DE LA PUERTA DE JUAREZ SACANDO LA BASURA DE LETRAS AKI SE BAN ATOPAR CON LA SIERRA PERRAS ATTE LA ---- DE JUAREZ Y BILLAUMADA PUERCOS AKI MANDA LA SIERRA PUROS AZTECOTAX PURA ENFERMEDA BENIMOS LLEGANDO DE AGUAPRIETA PARA QUE SEPAN

DREECKSOTE ( e-mail: DREECK ME COCHA COL*INDEPENDENCIA )
Miércoles 21.05.2014 / 06:46
ajajaaja hahaha mecago de risa doblados de M... caigale al topon mierdas ATTE EL PADRE .R-8

doble a ( e-mail: )
Domingo 16.03.2014 / 13:31
Aquii el doble A Aun seguimos gente ya van saliendo los H... ones amaarrense marra nos de miierdaaa puro doble a rifandoo

no mamen ( e-mail: )
Jueves 31.10.2013 / 13:51
no mamen ase como tres años esta madre era d que barrio y barrio y k la V... aora o sorpresa ya todos sicarios no mames pinchis cholos cagados ya tdos narcotees hahahaha

puro meco aki ( e-mail: )
Jueves 31.10.2013 / 00:32
jajajaj neta que me cago de la risa puro pinche tonto aki puro meco que esta todo el dia en la computadora y escriben que son el chapo o gente del R8 de la linea jajajajajajaja mecos mejor pongase a picarse el C... o diganles asu mama que mejor les corte el internet jajajajajajajajajajajaj

DREECKSOTE ( e-mail: DREECK ME COCHA COL*INDEPENDENCIA )
Miércoles 02.10.2013 / 09:51
YA SABEN SINALOS DE MIERDAS MORDIERON LA MANO QUE LES DABA DE COMER PUTOS PERROS SIGIMOS DE FRENTE NO CORRAN PARA EL TOPON PUTOS O QUE TIENEN MIEDO =ESTE ES UN MENSAJE BIEN CLARO PARA TODA LA GENTE DE EL CHAPUTIN SE LO ESTA CARGANDO EL PAYASO DIS QUE SIGES EN CHIHUAHUA Y TU GENTE AYA EN SINALOA me das RISA JAJAJAJJA POBRES PENDEJOS I SIGEN CAYENDO COMO MARANOS QUE SON POR QUE EL QUE BUERDE LAMANO LA PAGA ONO PRE GUNTALE A TU CONPADRE EL MAYO SIGIMOS EN EL MOBIMIENTO MI GENTE AZTECAS CARTELOTE DE JUAREZ NO SE RAJA DESDE CHIHUAHUA ASTA TORRONTO CANADA ATTE* DREECK*V*B*T*13 SWK SIGAN MORDIENDO LA MANO QUE LESDIO DE COMER JUAQUIN Y ZANBADAS ATTTE GENTE DE EL 2

( e-mail: )
Martes 01.10.2013 / 11:28
PURO CARTEL DE SINALOA Y AKI SEGUIMOS EN JUAREZ PUTOS X K VAMOS A TERMINAR CON LAS PINCHES MECHUDAS Y KON LO PUTOS MARRANOS K SEGUN JUAREZ ES DE ELLOS Y NADIE LOS KIERE PUTOS X KITARLE A LA GENTE EL DINERO K ELLOS SE GANAN CON EL SUDOR D SU FRENTE PINCHES MARRANOS DE MIERDA Y TODAVIA SE METEN CON LA GENTE INOCENTE AWEVO PUTOS POS NO PUEDEN KON NOSOTROS PUTOS VAMOS X USTEDES X K YO SE TODOS SUS ESCONDITES Y LOS VAMOS A TORTURAR CULEROS

alfredo rios ( e-mail: alfredito_riiozz )
Miércoles 31.07.2013 / 22:43
un saludooo para toda la plebada qeee anda al millon y no bajan bandera parientees kuiensee atodo a qel qe anda mal suerteee aii de ratoo parientes

DWAYNE DEREK ( e-mail: DEREK )
Jueves 25.07.2013 / 14:52
DWAYNE DEREK

( e-mail: )
Sábado 15.06.2013 / 15:56
el rap es cabron

( e-mail: )
Viernes 31.05.2013 / 11:52
a a AY BIENE LA LIMPIA DE PARTE DE LA JENTE DE LOZ AZZTECAS------N C J------- AGARRENSE CORTOOSSZ ! andamooZZ al 100 y suviendo !!!!!!!! BAN A CAER VARIOS CORTOOS...... PURO CARTEL DE JUAREZZ !!!

( e-mail: )
Jueves 23.05.2013 / 09:51
K TRANSA GENTE AL TIRO CON LOS DOBLADOS DE MIERDA K BAN PARA EL OLLO UNO POR UNO PUTOS ATTE EL CROCH DE LOS LINIEROS PUTO TRANSITANDO POR JUARITOZ CHIHUAHUA MEXICO... SELA BAN A PELAR DOBLADOS AKI CON MIGO SE SIENTAN Y BOY ACER UN PANCHO PUTOS YA ESTOY AKI EN JUARITOS MI TIERRA NATAL ATTE LA PLAZA DE JUAREZ MUERTE A LOS 2AA ----

( e-mail: )
Jueves 23.05.2013 / 06:11
AL 100 CON EL JARUDOO OLD SCHOOL ! B J L POR SIEMPREE ! SE SIGA ACOPLANDO0 UNO O NO---- ALA CHIINGADA TODSS LOS BARRIOS DE ALRREDEDOR DE LA CUESTA .... PURO JARUDOO LOCOS AUNKE LES ARDA PINCHES MOCOSOS TIRA ROYO !!

( e-mail: adrigutierrezh@hotmail.com )
Miércoles 22.05.2013 / 05:08
Hola buen día, alguien que me pueda ayudar a hacer una manta con graffiti ... solo que diga Body Combat ... ¿Quien pudiera apoyarme? Gracias. Saludos.

Snof ( e-mail: )
Lunes 13.05.2013 / 11:22
KE TRANZA PUTOS MANDANDO SALUDOS A TODOS LOS JARUDO LOCOS AHY ANDAMOS 810CREW BJL RIFAN! EL SNOOF!

JARUDO ( e-mail: )
Lunes 13.05.2013 / 11:19
YA TODOS PONEN SUS MAMADAS DE NARCOS NO MAMEN PURO PINCHE CHOLO LOCO NADA DE MAMADAS DE SICARIOS NI CHAPOS VALE VERGAS PURO PINCHE JARUDOTE LOCOS ! DEFIENDANCE A PUTASOS NO A BALAZOS BOLA DE CHAVALAS , BARRIO JARUDOTE LOCOS

( e-mail: )
Miércoles 24.04.2013 / 13:19
De ratooo mis demonios 3 le BAA pasar la boladoraaa ya se akabo su paroo pinchis doblados kagadosss

XXXX ( e-mail: )
Lunes 15.04.2013 / 07:16
CAIGANLE A LA COLONIA DEL CARMEN JOTOS CHAUTOS PURA CARTEL DE JUAREZ

XXXXX ( e-mail: )
Lunes 15.04.2013 / 07:12
HOLA PUTOS DEL CHAPO VALEN VERGA AKI LA LINEA NO SE ACABA VAN AA EMPEZAR A CAR EN CALIENTE TODOS

( e-mail: )
Sábado 13.04.2013 / 04:18
PURO BARRIO AZTECA PINCHES CHAPOS DE MIERDA..... NO PUEDENN CON NOSOTROS CULONNESS AL MIL CON LOS CARRIILLO FUENTES NCJ Y AZTECAS PA TUMBAR CONTRAS Y DEFENDER NUESTRA PLAZA ... CHINGEN SU MADRE TODOS LOS DOBLETES PURO INDIO AZTECA----!

clavo ( e-mail: )
Domingo 07.04.2013 / 05:38
Aquino seguimos mi drekk al fiend con el chapo cds carteles unidos mexiclotes doblados y todos los pelones clan y carnales al fiend en Cd Juarez nosotros controlamos sin aserruido comemos sin ensusiarnos como nos an ensenado los maestros estamos al cien y creciendo y lo prometido es deuda se estan acabando. La's marranadas como Dijo el carnal quita puercos al fien y asta dentro la cosina es nuestra la cantina estate al cien y la borrachera sigue y aqui estamos todos los borrachos y los pelones y seguimos eborrachando como Dijon el general villa al cien la revolucion al cien miss borrachos y ask se Ase un Fancho para los caidos y la botella para los depiertos saludos a todas la's cantinas y saludos a toda la borrachera al cien y a gosarla que aora empieza lo bueno cds.

Dreeck ( e-mail: myspace.com/bryan.2001 )
Jueves 28.03.2013 / 04:41
EI HAIDE ONTAN LAS FOTOOS DE EL GRAFFITI PARA LA ENCUESTA MENTIROSILLA SALUDOS DE EL DREECK

Luis ( e-mail: twist1251@hotmail.com )
Lunes 18.03.2013 / 07:24
Que onda, alguna chava que le guste pasarla bien, no importa edad, yo chavo buena onda, atento y con buenas posibilides, dejen sus mensajes o envienme correo, bye

ROOOO ( e-mail: )
Lunes 04.03.2013 / 21:00
Aitamos los Pinshes Freeeskos lOKOTOTOTOTOEEES CON LA KAEESEEEEEEEEEEEEEE DONDE ROBAMOS ALOS RIKOS PA TIRAR PARTI EN EL KREWWW C

Haide ( e-mail: hakasi@hotmail.com )
Sábado 02.03.2013 / 04:16
Hola!! :) estoy aplicando una encuesta para mi tesis sobre graffiti en la ciudad de Chihuahua, me ayudarían a contestar una? gracias! :D http://www.surveymonkey.com/s/B8P5PDL

Genesis ( e-mail: No tengo )
Jueves 17.01.2013 / 10:11
Ser mama es lo mas hermoso q me paso en la vida,despues de todo lo malo q me paso estoy tranquila de estar con mi beba.

R8*GENTE DE EL 2 AL MILL ( e-mail: )
Sábado 22.12.2012 / 19:56
ESTE ES UN MENSAJE BIEN CLARO PARA TODA LA GENTE DE EL CHAPUTIN SE LO ESTA CARGANDO EL PAYASO DIS QUE SIGES EN CHIHUAHUA Y TU GENTE AYA EN SINALOA me das RISA JAJAJAJJA POBRES PENDEJOS I SIGEN CAYENDO COMO MARANOS QUE SON POR QUE EL QUE BUERDE LAMANO LA PAGA ONO PRE GUNTALE A TU CONPADRE EL MAYO SIGIMOS EN EL MOBIMIENTO MI GENTE AZTECAS CARTELOTE DE JUAREZ NO SE RAJA DESDE CHIHUAHUA ASTA TORRONTO CANADA ATTE* DREECK*V*B*T*13 SWK SIGAN MORDIENDO LA MANO QUE LESDIO DE COMER JUAQUIN Y ZANBADAS ATTTE GENTE DE EL 2

clavo ( e-mail: )
Domingo 09.12.2012 / 06:18
No mamen pinches linieros la's marranadas de secuestro cuatas son pinchis rollos sullos y de los aztecas pero agarresnse Puto's.arre carnales la Verde esta de todos lados Lla no los queremos de buelta pa.el chuck ban pa bajo Puto's arre carnales tras de estos puto's ban pa bajo lla es el momentous de cobrar a estos pinches vende pa patrias aqui nos estamos preparando. No bamos a dejar ni una pinche pluma ni una linea estos putos lla se estan pasando de mas y tenemos que. Defender el canton y la mejor manera es acostar a todos loa aztecas y linieros que nadamas andan cagandola no saben camellar arres putos chicanos puro Mexico putos

( e-mail: )
Sábado 08.12.2012 / 03:49
cartel de JUAREZ AL MILLON CON LOZ AZTECAS....... NO PUEDEN PINCHES MONTAPERROOS CULONEES NI CON EL APOYO DEL GOVIERNO PUTOS..............!!! CARTEL DE JUAREZ Y AZTECAS AL MANDO DE LA FRONTERA.....!que less quede claro y sin aser tanto ruido...!!

( e-mail: )
Lunes 03.12.2012 / 15:45
Una Niña le pregunto a su novio: ¿Me quieres? Y el le contesto que no. ¿Piensas que soy linda? y el contesto que no ¿Me tienes en tu corazón?y el contesto que no. ............¿Si me fuera, llorarías por mi? y también contesto que no....Ella triste se dio media vuelta para irse y el la agarro del brazo y le dijo: ... ... ... ... ... ... ... ... ........No te quiero, TE AMO, No pienso que sos linda, pienso que eres HERMOSA, No estas en mi corazón, ERES mi corazón. No lloraría por ti, MORIRIA por ti. Hoy a media noche tú amor se va a dar cuenta de que te ama. Algo bonito te va a pasar Mañana entre la 1 y las 4 de la tarde.. Da igual donde estés: en Internet, en el colegio, en el trabajo… si rompes esta cadena tendrás mala suerte en 10 relaciones durante 10 años… Así que pega esto en 4 paginas y luego presiona F9 Aparecerá la letra inicial del chico o chica que te ama

PARA JARUDO! ( e-mail: )
Domingo 02.12.2012 / 14:38
inf jarudo un atento aviso de que vamos por ivansitoo! EL NOMY a darle piso asi que ponte trucha ! anduviste cagando el palo ! JARUDITO! eres de los pocos que faltan ya se fueron varios tu eres de los vascas que andan por hai asi que altiro mi nomi que talves esta navidad no la pases mas que comiendo tierra!

( e-mail: )
Sábado 24.11.2012 / 03:47
CAIJANLE AL JARUDOO PINCHESS NIÑASS PA KE WUACHENN AVER SI NO AY JARUDOSSS Y BIEN LOCOOSS PUTOSSS B A R R I O. J A R U D O. L O C O S

( e-mail: )
Jueves 22.11.2012 / 12:23
los jarudos ya no existen y los que fueron algun dia eran lambehuevos° y envidia de ke? si nunca tuvieron nada° solo que me gusta humillarlos pinchis vatos chavalotas atropellados° siempre fueron de agua° tiro por viaje los haciamos de agua°

( e-mail: )
Sábado 17.11.2012 / 05:26
BARRIO JARUDOTE LOCOOS... DE LA VIEJA ESCUELA PUTOSS.... TODOS LOS BARRIOS DE ALREDEDOR DE LA CUESTA NOSS PELARON Y NOS PELAN LA VERGA..... PA QUE ANDAN ABLANDO KE NOSS ASIAN DE AGUA PUTOSS ARDIDOSS NO MASS ABLAN Y ABLANN PERO AL TOPON SE QUEDAN CALLADOSS CULOSS KE NO FUERAN NO MASS EN BOLITA LE SALENN I CON CUETE PINCHESS PUTASS JARUDO LOCOSS PINCHESS LOMEROS DEL SIETE Y LASS NIÑAS KE SE CRREEN MOVIDOSS UNIDASS 14 PINCHESS MUGROSOSS ASALTA TIENDITASSS BJL FOREVER PÈNDEJOSSS...!

( e-mail: )
Viernes 16.11.2012 / 09:50
NUEVO CARTEL DE JUARESZ ......... NO PUEDEN PINCHESS AA Y JENTE NUEVA DESDEE KE NOSS ANDANN ACAVANDOO PANOCHASSSS JEJEJE........... AKI ANDAMOSSSS EN RIVERASS DISSKE DONDE CONTROLAN TODO PINCHESS CULOOSSS M0NTAPERROSSS 'LA LINEA NO LA BOORRAN CULONESS

( e-mail: )
Viernes 16.11.2012 / 09:46
AZTECASS SIGEE FIRME CON LOS CARRILLO................. NCJ

clavo ( e-mail: )
Miércoles 14.11.2012 / 15:41
Metete a carrillo x el C... y a tus pinches tecatos del centro cuidalos x que memos acabado con todos puro Aa y nosotros si somos de Juarez pinched Chicano de misread as de sere un pinched azteca lambent guebos ben x una curate tecato

( e-mail: )
Lunes 29.10.2012 / 08:03
puro CARRILLO FUENTESS PUTOSS MONTAPERRROS,NOS LLAMAN MARRANOSSS...?? POS SI LOS MARRANOSS SON USTEDES PINCHES DOBLETES DE MIERDA... USTEDES AVIENTAN LA PIEDRA Y ESCONDEN LA MANO VALEN VERGA PINCHES CHAPUTOSSS... SEGUIMOSS Y SEGUIREMOSS DE PIEE ALSS ORDENES DE DON VICENTE CARRILLO FUENTES PURO PINCHE NUEVO CARTEL DE JUARESZ NOS PELAN LA VERGA LA GENTE NUEVA Y ESOS PINCHES MUGROSOSS LAMBE VERIJAS DE AA ARRIVA JUAREZ VILLA AHUMADA Y NAMIQUIPA21 UN SALUDO PA LOS CARNALESS DEL CENTRO DE JUAREZ !

El Chapo Guzman ( e-mail: )
Viernes 19.10.2012 / 17:29
Recurden Que Para cantar se ocupa ser gallo ai muchos pollitos que quieren volar como gallo yo los traigo a todos en los huevitos soi su mero padre y su peor pesadilla JOAQUIN GUZMAN LOERA EL CHAPO GUZMAN.............

TEKO ( e-mail: RALDRETEGONZALEZ@.YAHOO.COM.MX )
Viernes 19.10.2012 / 07:50
QUE TRANZ AQUI DESDE LA VIEJA COLONIA GALENA. CD JUAREZ

( e-mail: )
Jueves 18.10.2012 / 13:09
PINCHIS JARUDO MEJOR SIGAN EL EJEMPLO DE SUS ANCESTROS: ESCONDANSE HANTES KE LES DEN CRUZIJADA TAMBIEN° LOS JARUDOS DE ANTES SIEMPRE FUERON DE AGUA ACADARRATO ° LOS AGARRABAMOS DE PERILLAS BIEN GACHO POBRES VATOS POR ESO NO VALIERON VERGA°

( e-mail: )
Martes 16.10.2012 / 10:14
MIREN IJOS DE SU PUTA MADRE K YA PASARON POR MIS WEVOS AY PARA LOS K SABEN DE K ESTOY ABLANDO PENDEJOS

( e-mail: )
Martes 16.10.2012 / 05:40
k tranza aki desde la tj tijuana 664 nuestra area saludos a todos los cabrones k andan en el graffiti.... saken las latas y apegar un rayon en cada espacio .....

( e-mail: )
Lunes 15.10.2012 / 06:11
AKI SEGUIMOS EN PIE PUTOS PARA SAS CHABLAS K HABLAN AKI LOS JARUDO LOKOS I ANDAMOS COMO SI NADA AI NOMASSSS . AL CIEEEEEN

( e-mail: °°°°° )
Domingo 14.10.2012 / 12:26
KE PINCHIS UNIDILLOS NI QUE LA VERGA. TUMBESE ESE ROLLO ASI DE HUEVOS EN CALIENTE SE LO DIGO.!!! VOY A BUSCAR SU PINCHI IP PA SABER DE DONDE ESCRIBE CABRON° USTE NI NINGUN PINCHI BARRIO TIENEN AUTORIDAD HAGASE PA UN LADO ° NOSOTROS SOMOS LOS QUE MANDAMOS° O KE?

VIRREYES ( e-mail: fmC )
Martes 09.10.2012 / 12:31
LA FMC SIGUE DE PIE TODAVIA HACIENDO DE AGUA A LA GENTHE COMO SIMPRE BIEN BAÑADOTHES°

the fowy ctwt ( e-mail: )
Martes 09.10.2012 / 06:30
cartelon 23 los cocha putas !!! C T W T

mafia unida kriminal ( e-mail: )
Viernes 05.10.2012 / 19:45
llego su P... pesadilla marikass barrio unidos 14 rifando las kalles i no hay nadie kien nos pare los del JARUDO son rekulos 9,mm,3030,357,eskopetas no te metas somos peligrosos i aki andamos trusha las armas las karga el maldito barrio unido de k pueden hablar si andan en la kalle todo pinshes asustados embidiossos pinshes OSIKONES ala V... retirese ala VERGA asiendo limpia de LEVAS barrio unidos putos de MIERDA

skoRER 1 ( e-mail: JARUDOTE LOKO LRT CREW )
Jueves 27.09.2012 / 09:45
VAYANSE ALA VERGA EL JARUDO LOKO RIFA PUTAS LRT HACIENDOTA UNIVERSIDAD LOS KOCHA PERROSS

EL STHANFER ( e-mail: )
Domingo 16.09.2012 / 10:09
CHINGEN SU MADRE BOLA DECULITOS NO SA BEN NI QUE ESANDAR ES ESTOS ROLLOS DE BARRIO....ATTE MS DE LA 13

( e-mail: )
Viernes 14.09.2012 / 16:50
LOS JARUDOS SON UNA BOLA DE PENDEJOS PINCHIS VATOS NIÑAS . UN CHINGO DE VECES LOS HAMOS CUTIADO Y LES HEMOS TUMBADO GENHTE. ESOS WEYES NO VALEN VERGA PINCHIS CHOLOS MARICAS LAMBEHUEVOS. TANTOS QUE SON Y NOI VALEN MAS QUE PA PURA VERGA . PINCHI BOLA DE OSICONES. QUE PUTOS°!! EL DIABLO PINCHIS PUTOS ES EL PADRE DE DIOS°!! NOMAS POR VER CARAS ....

el grifo ( e-mail: )
Domingo 09.09.2012 / 14:15
arriba la marihuana .

el jl ( e-mail: )
Viernes 31.08.2012 / 13:59
parece que le dieron piso al R3 de la gente nueva, ahi por Parral, asi que el chapo controla Chihuahua...

( e-mail: )
Martes 28.08.2012 / 03:36
cuibo kien anday ....k royo jarudos como andan reportense. altiro pues karnales

( e-mail: )
Sábado 25.08.2012 / 21:49
Cleaning with all these people who are dedicated to disturb the humble people of Juarez,ubstedes que se dedicaron a amenazar, a matar sin saber si era el contra, a pedir cuota, vayan pidiendole perdón a dios por que fregaron a nuestra gente de Juarez, no saben cuantos niños huerfanos dejaron en Juarez o a cuantas familias sin deberla & temerla sacaron de Juarez... Let us think Juarez something more we do not want this for juarez. atte. Angel Black

( e-mail: )
Sábado 11.08.2012 / 19:52
bola de pinches terrosos matandose entre ustedes enserio que ni pena me dan y asi quieren ser grandes hasta P... son mejor vallanse a vender su C... en las esquinas

( e-mail: )
Viernes 03.08.2012 / 10:00
ANIMO DELICUENCIA AL 100 CON MI EKIPO CD JUAREZ MI CASA ATTE ---

( e-mail: )
Jueves 02.08.2012 / 03:19
yya acaben con la guerra si colaboran con contras entrree ustedes,,,,,, ya terminen esto vendan droga como antes que me hace falta un pase y un toque ya no se maten mejor echen a andar esta ciudad mucho mejor que antes

clavo ( e-mail: )
Miércoles 25.07.2012 / 00:22
Disculpas a Juarez x low actors de vilencia desmedida de algunos de nuestra jente tomaremos cartas en remediar estos across nosotros no estamos en contra de la ciudad ni de el gobierno seguimos en lo ablado y aunque se a doblegado alginos acuerdos x parts de loss interesados nltodos nositros seguimos en el acuerdo x el Vienna de Juarez

el monico ( e-mail: juarez )
Sábado 21.07.2012 / 05:17
seguimos limpiando plaza, nos cargamos un par de dobleAA, y la limpieza sigue.

( e-mail: )
Domingo 15.07.2012 / 07:50
un saludo a los cnck de morelos que rayan chido y traen buen roio saludos

gonza ( e-mail: juarez )
Sábado 14.07.2012 / 19:16
QUIEN ESTA GANANDO LA GUERRA POR JUAREZ,

( e-mail: )
Sábado 14.07.2012 / 13:39
jarudote lokos aunke les duelaaaa el kleensss.. sigue respirando mierdasssss..

DREECKSONE MATON ( e-mail: )
Miércoles 27.06.2012 / 16:12
ESTE ES UN MENSAJE BIEN CLARO PARA TODA LA GENTE DE EL CHAPUTIN SE LO ESTA CARGANDO EL PAYASO DIS QUE SIGES EN CHIHUAHUA Y TU GENTE AYA EN SINALOA me das RISA JAJAJAJJA POBRES PENDEJOS I SIGEN CAYENDO COMO MARANOS QUE SON POR QUE EL QUE BUERDE LAMANO LA PAGA ONO PRE GUNTALE A TU CONPADRE EL MAYO SIGIMOS EN EL MOBIMIENTO MI GENTE AZTECAS CARTELOTE DE JUAREZ NO SE RAJA DESDE CHIHUAHUA ASTA TORRONTO CANADA ATTE* DREECK*V*B*T*13 SWK

EL CHAPO ( e-mail: )
Viernes 22.06.2012 / 03:25
PARA LA CONTRA ESTOI EN LA SIERRE TARAHUMARA AKI LOS ESPERO LACRA ZZZZ CXDXSX gente nueva...

mr VERGAS ( e-mail: )
Miércoles 20.06.2012 / 07:01
BOLA DE PENDEJOS MEJOR ESTUDIEN Y B USQEUN TRABAJO

BARDAS 13 ( e-mail: )
Miércoles 20.06.2012 / 06:39
PINCHIS MIERDAS PENSE QUE ERA PARA ESCRIBIRLES A LOS ADMINISTRADORES DE ESTE FORO,, QUE CULOS ME BALCONEEE JAJAJAJAJAJAJ CULOSSSSSSSSS

BARDAS 13 ( e-mail: )
Miércoles 20.06.2012 / 06:35
PUESE EL CORREO DE UN WEY QEU ME CAE EN LA VERGA SI SALE A LA VISTA DE TODOS,, OJALA LO MATEN YO NO SOY DE ESE BARRIO PERO PUES DEJAN POSTEAR SIN CORREO QUE AL PEDO SE VA A PONER BUENO

M6F ( e-mail: )
Miércoles 20.06.2012 / 06:30
BOLA DE CULOS

BARDAS 13 ( e-mail: adriandiazv@yahoo.com )
Miércoles 20.06.2012 / 06:26
pinchis bolas de jotos los del chapo me pelan la V... att. bardas 13 de la generacion antigua no se confundan pendejos

( e-mail: )
Domingo 17.06.2012 / 17:25
en memoria del luiz kolocio ay andamos eres nuestro angel el k nos kuida de aya arribitaa por algo an pasado las kosas se salbaron dep PYTY

omar ( e-mail: )
Viernes 15.06.2012 / 00:41
mira pinche tecato tu y tus pinches carnales los aztecas nos pelan la V... son puros lambegubos de los linieros pero lla le cagaron la V... a los linieros x que traen puros peines y tecatos aora le fueron a pedir chichi a los z lla no la ben llegar ustedes son los que siguen callendo lo unico que les queda es el centro y ni alli los qyuieren lla llego la ora de cobrar y ni uno de los que quedan se la ban a acabar lla no bengan a desirnos que no querian pedo salgale y mueran como hombres sabian en lo que se metieron de rato y tiempo que es lo que lla no les queda.

M1DREECK ( e-mail: R8 )
Martes 12.06.2012 / 17:57
ESTE ES UN MENSAJE BIEN CLARO PARA TODA LA GENTE DE EL CHAPUTIN SE LO ESTA CARGANDO EL PAYASO DIS QUE SIGES EN CHIHUAHUA Y TU GENTE AYA EN SINALOA CAYENDO COMO MARANOS QUE SON POR QUE EL QUE BUERDE LAMANO LA PAGA ONO PRE GUNTALE A TU CONPADRE EL MAYO SIGIMOS EN EL MOBIMIENTO MI GENTE AZTECAS CARTELOTE DE JUAREZ NO SE RAJA DESDE CHIHUAHUA ASTA TORRONTO CANADA ATTE* DREECK*V*B*T*13 SWK

( e-mail: )
Lunes 28.05.2012 / 17:36
AVER AVER AVER PENDEJOS POS QUE ESTA PASANDO PAR DE MENSOS COMO KE EL CHAPO Y LA LINEA NO MAMES KE TIENE KAKA EN EL CEREBRO NOMAS CALIENTAN EL CUADRO PUTOS JENTE COMO USTEDES MANDO A LA VERGA POR TIRA ROYO Y ESE WEY KE TIRA BARRIO POSI LLA ME ACABE A TODOS LOS DEL JARUDO PENDEJO DESEGURP ERES DE LOS MENSOS KE KEDAN KE SE CREN MUCHO PONGASE VERGAS KE LOS VOY A INVESTIGAR TODOS ESOS PENDEJOS PARA DARLES UNA CALENTADA SOMOS LA NUEBA GENERACION PENDEJOS: ARTISTAS ASESINOS PAKE LES KEDE VIEN CLARO CULEROS

k putos ! ( e-mail: )
Lunes 28.05.2012 / 17:33
FFFFFFUUUUUUUUUUUAAAAAAAAAAAA !!!

( e-mail: )
Lunes 28.05.2012 / 11:50
jajajajajja pendejotess

PEñA MIENTEEEEEEEEEEEEEEEEE JA ( e-mail: JAJAJAJ )
Lunes 28.05.2012 / 11:37
que vayaa y CHHYIINGUUUEEEEE TTOOOODDDAAAA SU PUHTAAA CUHLEEERAAAA SARNOSAAA Y SIDOSA MADREE TODO EL QUE ME LEAA Y TAMBIEN EL QUE SE HAGA PEHENDEJOOOO JAJAAAAAAAAAAAAAAAAAA!!!!!!!!!!!!!!!!!

peña miente jaja ( e-mail: )
Lunes 28.05.2012 / 11:23
apoco si !! jajajaj me estaba cagando dela P... risa orita que vi esta pagina y la sarta de P... que ay en ella eso de que el chapo,o integrantes dela linea,, eten sentados enla computadora en el muro o en el facebook,, es la P... mas grande que eh visto jajajaja pinchy gentee babosaa netaa aysi aysi !! aqui soy narco !1 aya afuera soy un meco !! jajajajajaja bola de little chavalass cuando aya quebrada me meto aver que respoondieron babososs!! que H... ue su P... C... sidosa y sarnosa madree todo el que me leaa!!! y tambien el que se hagaa P... !! jajaja si soy apaa!! jajaay !!!

( e-mail: )
Lunes 28.05.2012 / 09:20
jkajkajkajkajkajkajkajka

( e-mail: )
Lunes 28.05.2012 / 08:57
puro pinchy tiraroyo!! cuando se ha sabido que un pinchy narco ande perdiendo el tiempo en la computadora nomamen o escribiendo asi como pinchyes emos que en lugar de ** que *** pongan ke o esas peendejadas nosean mamoness jkajkajkajkajkajka nomas les falta poner caritas :) jkajkajkajkajkajkajkajk nomameen pinchy gentee babosaa netha.. !! y el dreeck ese wey chance y si se aviente uno que otro jalesiyo pero tampoco que no mame... esmas ese wey antes era campaa creo weno si si es el que creo si le sale..uno aca pelonciyo que se juntaba con el fresh,,bueno de ayi en mas los otros wueyes han de ser puro pinchye vato sin que hacer se pasan de verguotas o han de ser de esos pendejiyos del silencio o delos mexicles que acaban de aprender a usar la compu y ya andan cagando el palo...

( e-mail: )
Martes 22.05.2012 / 09:49
Hola soy camilaaaaaaaaaaaaaaaaaaaaaa

( e-mail: )
Martes 15.05.2012 / 17:44
no se ke pelan pinchis tontos ponganse a travajar C... aviendo tanto trabajo cuando los maten dejen pal pantion de perdida ay andan sus familiares vendiendo la casa pa enterrarlos

pipi ( e-mail: )
Martes 15.05.2012 / 02:49
culos todos los del los de los burritos guille

EL CHAPOA ( e-mail: )
Lunes 14.05.2012 / 18:08
los mugrosoZ olos linieros sirven para 2 cosas para nada i nada salganle alas ranas o altopon del cds o carteles unidos los mugrosoZ linieros no son nada les arrannkare los wuebos cabrones iselos are ke selos tragen atte SUMERO PADRE EL CHAPO AKI SIGO EN JUAREZ BUSKENME

Te vale venga ( e-mail: )
Sábado 12.05.2012 / 11:27
Aki el ke era la venga en México y en Juárez era carrillo pinche chapo traisionero no vale pandita pura venga no le llega ni a los pies aki Juárez rifa x siempre los soldados van estructura firmes aunke los marranos tengan ambre

( e-mail: )
Domingo 06.05.2012 / 12:06
________________________________________________________________________________________________________________________________________________

( e-mail: )
Viernes 04.05.2012 / 07:07
poko a poko ban biendo el kolor del jarudo ai bamos por ustedes perros kuidesen

SR*DREECK ( e-mail: C*D*J AL MILLON )
Miércoles 02.05.2012 / 16:37
ESTE ES UN MENSAJE BIEN CLARO PARA TODA LA GENTE DE EL CHAPUTIN SE LO ESTA CARGANDO EL PAYASO DIS QUE SIGES EN CHIHUAHUA Y TU GENTE AYA EN SINALOA CAYENDO COMO MARANOS QUE SON POR QUE EL QUE BUERDE LAMANO LA PAGA ONO PRE GUNTALE A TU CONPADRE EL MAYO SIGIMOS EN EL MOBIMIENTO MIGENTE CARTELOTE DE JUAREZ NO SE RAJA DESDE CHIHUAHUA ASTA TORRONTO CANADA

smile ( e-mail: )
Domingo 22.04.2012 / 15:10
primero ninas y aora periodistas estos linieros lla no saben que aser para que los dejen camellar pero se les acabo el conflakes cabaron su tumba a ustedes politicos enconchados mugrosos enramflados y sombis que les siguen los politicos se les boltearion los aztecas los traicionaron y los sombis lla despertaron x todos lados an atraido maldicion juarez titeres mueran lla...........

( e-mail: )
Jueves 19.04.2012 / 05:23
PUES....SYYYYYYYYYYYYYYYY

skoR1 ( e-mail: )
Miércoles 18.04.2012 / 21:30
APOKO SYY!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!

. ( e-mail: )
Sábado 14.04.2012 / 20:44
sigo al mando morire de viejo bola de mantenidos lacras y wuebones si de mi dinero an comido perros montoneros chamakos cagados io les enseñare como pensar i hacer las cosas antes de realisarlas pronto veran el juguete nuevo que compre me costo muchos millones de dolares pero moriran todos los ratas de juares y tamaulipas. EL CHAPO.

( e-mail: )
Sábado 14.04.2012 / 08:45
ai compitaaa le apuesto q tiene como 12 o 13 años por q dise puras P... y le apuesto q usted ni tira ni barrioo toabaia juega cn carritos,,..!!! mejor no diga nada.. ATTE JARUDO LKS..!!!

( e-mail: )
Viernes 13.04.2012 / 19:19
todos los jarudos son jotos una bola de mamones lambehuevos. son muchos pero re culos cuando andan solitos se esconden en las faldas de sus mamis. nostros somos pocos pero locos. a la V... la muerte enseñales un pedaso de carne acabado de cortar y les da vomito y miedo pinchis vatos chavalotas.

( e-mail: )
Viernes 13.04.2012 / 14:24
el cartel sinalo es el cartel de las tracciones no respetan la tregua,,..!!!

( e-mail: )
Viernes 13.04.2012 / 13:51
si chapo sigue hablando me bas a kortar la berga pero a pura mordidas M... ojala k andes aki para darte ya kuello

( e-mail: )
Jueves 12.04.2012 / 15:02
http://youtu.be/WaS0rKERXkQ...

SI ( e-mail: )
Lunes 09.04.2012 / 09:34
PUES DE LETRAS ME COMO UNA OLLA COMO EL POSOLERO DE JURITOZ PUTOS

AKI SIGO EN JUAREZ ( e-mail: )
Domingo 08.04.2012 / 23:24
como les dije mugroso alos de zacatecas y austedes tambine mucho les falta para ser como yo yebo mas de 30 años al mando i aun seguire mugrosos limpia vidrios i mismo les boi a corta el pescueso acuerdense que miraran mi rostro i mis ojos antes de morires cabroones shamakos P... piojosos ATTE EL CHAPO GUZMAN

( e-mail: )
Sábado 07.04.2012 / 06:15
un saludo para mi carnale k estan tirando cana en el topo y cada bes k sale salen lokos . -----

( e-mail: )
Viernes 06.04.2012 / 22:28
De sinaloa hasta chihuahua JL ha controlado hay un grupo de sicarios por todos muy afamados ellos son el grupo linces que al JL andan cuidando La linea se esta extendiendo por toditos los estados de chihuahua a sinaloa han sido muy respetados ay le mando este corrido para estos gallos jugados mucho cuidado pariente no se vayan a metar la linea esta vigilando con armas de alto poder un saludo pal 14 valiente a mas no poder (y ay le va pariente y echele mi compa y arriba CD.juarez) En puros carros blindados la gente se anda meneando andan vigilando a todos a los que andan trabajando la linea ya no perdona a los que se andan pasando ya con esta me despido ya me voy pa la frontera un saludo pa los linces y tambien para el pariente cuiden bien al JL y estamos al 100 mi gente.

( e-mail: )
Viernes 06.04.2012 / 22:25
el chapo no durara mucho es humano se va acabar !

( e-mail: )
Jueves 05.04.2012 / 18:42
NO MAMES I EL CHAPO KIEN ES ES DE KARNE I HUESO COMO TODOS BA BENIR PERO NO SOLO I NOSOTROS ANDAMOS SOLOS AMARRANDOS UN HUEBO I AL SABER CUANDO NOS TOPAREMOS LA LIMPIA BA ASER CON USTEDES HIJOS DE CHAPITOO K ASTA EN SU TERRENITO MAS PROTEJIDO EMOS ANDADO LA LINIA Y ZETAS

la linea ( e-mail: )
Miércoles 04.04.2012 / 00:28
COMO QUIERAN PUTOS YA SABEN BARRIO JARUDO LOCOS

( e-mail: )
Martes 03.04.2012 / 13:58
ZONA KM. 14 A KM 18. AEROPUERTO PANAMERICANA

GENTE NUEVA ( e-mail: )
Domingo 01.04.2012 / 21:40
ESTES UN MENSAJE PARA TODOS LOS CIVILES ONRADOS MATENGANSE DESPOES DE LAS 9:00 PM EN SU CASA QUE ANDAREMOS PATRULLANDO LAS CALLES I BUSCANDO EL TOPON ALOS LINIEROS Y ZETAS ORASI BABER UN INFIERNO SE METIERON ASTA LA COSINA EN SINALOA LES VA TRONAR EL CULO ENPIESA LA LIMPIA YA ESTA EL CHAPO AKI EN CHIWUAS.

nopaleros ( e-mail: )
Domingo 01.04.2012 / 12:41
bola de ignorantes simios come vergas. chikali rifa culer0s come huevos la 13 de mexicali para todas los homies zarrapastrozos no chance a las levas indijenas como ustedes locos

PRM ( e-mail: BORRACHOS )
Viernes 30.03.2012 / 15:13
ANIMOOOO JARUDO. LEBANTANDO BANDERA MACHIN. ANIMOOOOOO.

LOS JARUDO VIVEN ( e-mail: )
Viernes 30.03.2012 / 09:40
EL JARUDO NO A MUERTO SOLO ESTAMOS PLANIANDO LO K BA SUCEDER LO K BAMOS A ASER SOMO YA POKOS LO ASEPTAMOS PERO LOS POKOS K SOMOS LOS BAMOS A DESTROSAR ALGUNOS MUEREN I OTROS VIVEN. NO SE ME CONFIEN MUCHO K ESTE PUTO BARRIO NUNCA BA MORIR I ESO SE LOS TENGO SEGURO ESTO BA PA LARGO K DIOS NOS PROTEJA I NOS LIBREE DE MAL K YA BASTA DE TANTAS MUERTES K EMO BISTO TANTAS LAGRIMAS K EMOS TENIDO I ESO KERIAN POES LO LOGRARON PERO YA BASTA KUIDESEN MUCHACHOS K BAN A KAER UNO POR UNO COMO BASURA K SOMOS KAPAZ DE TANTAS KOSAS K NO SE IMAJINAN I LO K TENEMOS EN LA SANGRE ES ODIO I RENKOR LOS JARUDO DE LA BJL

MYDREECK . ( e-mail: MYDREECK.COM )
Sábado 24.03.2012 / 01:42
YEGO EL GOBIERNO SIGIMOS POR USTEDES ATTE MR.SR.DREECK

zona km.14 ( e-mail: aeropuerto )
Jueves 22.03.2012 / 13:37
Naaa en pinchi VIRREYES no hay nada . Es un pueblo fantasma . ke H... ados vas a limpiar .... si no hay mugre. Ya barrieron con todo.

BRAZIL ( e-mail: MAFIA DE LA COSTA BAJA )
Miércoles 21.03.2012 / 08:40
Barrio Bules.... pinchis macuarros de juarez ojala pudieramos ensenarles como c asen las cosas parecen P... con tantas M... parecen ninas con pistolas.jajaja no tiren royo x k no valen veerga nadie estan unidos son grupos de 30 ninitas y c estan matando pobres P... tienen M... de cerebro

solitarote ( e-mail: bjl no more )
Miércoles 21.03.2012 / 04:10
pa los carnales del jarudo kiero saber a cuantos les an tumbado y k barrios estan entrados,kiero saber si andan x ai el oso,nomi,toto,duke,maiko,pancho,cuco,tata,gringo,kem,gordo,zona,keff saludos desde cali

sicario ( e-mail: )
Lunes 19.03.2012 / 20:34
atu puata madre tambien

( e-mail: )
Sábado 17.03.2012 / 21:14
DIOS BENDIGA A TODOS :D

GENTE NUEVA ( e-mail: )
Viernes 16.03.2012 / 05:46
nose me asusten enfermos que aki ai mucha enfermedad i el virus es contagioso i todo estamos infectados.ibien enfermos de la mente

Chapitos ( e-mail: )
Viernes 16.03.2012 / 05:37
chapos y mayos rondando por las ciudad de chiwuas andamos buscando el tope i calentando la plaza ya que los linieros no le quieren salir al tope porque nos tienen miedo CDS DOBLADOS GENTE NUEVA borrando linias y buskando azcagadas.ya tenemos barios puntos i sectores hubicado arre putos ailebas el topon...

MYDREECK . ( e-mail: MYDREECK.COM )
Jueves 15.03.2012 / 12:51
SIGIMOS AL 1000 RAZA ATTE CARTEL DE JUAREZ CDJ AZTECAS_______________________________________________________________RESPETA JUAQUIN LA MANO QUE TE DIO DE COMER ATTE CARTEL DE JUAREZ aztecas_______________________

iripan ( e-mail: diego_reddragon@hotmail.com )
Lunes 12.03.2012 / 13:51
me canso de mis amigos

ehh mija°!° ( e-mail: )
Viernes 09.03.2012 / 18:09
esa de la vagina mojada deje su numero pa darle unas buenas cochadas°!° y pa matarle el cochino°!°

( e-mail: )
Jueves 08.03.2012 / 13:16
Ya tengo a barios mokosos del 2aa nomas lo uniko k saben aser es robar celulares karros i asta un chikleeee se keman ai los tengo ubikados yaa señor usteddd nomas deme la orden

( e-mail: )
Miércoles 07.03.2012 / 08:11
un saludo para el jefe de la colonia del carmen de part de joselin

daniela ( e-mail: )
Lunes 05.03.2012 / 21:43
TRAIGO LA VAGINA MOJADA CHICOS :c

( e-mail: )
Lunes 05.03.2012 / 16:41
fuiste AZCACA ?? pues por eso eres asi de C... miedoso collon. por eso te saliste de ellos porque te diste cuenta que esos putos son culos. hiciste muy bien en alejarte de ellos.

( e-mail: )
Lunes 05.03.2012 / 08:17
leean la biblia brodiss hay un ser ke prometio estar kn nosotros todos los dias del mundo y nos ama km nadiee el rescata y cambia vidas creeanmelo yo era azteca y cuando mire qe mi familia esta priero me di cuenta qe en esta vida se paga todoo lo ke asemos tarde o tempranooo pro hay alguien ke nos perdonaa y el nunka se aleja de nostros DIOS ES AMOR!!!

( e-mail: )
Lunes 05.03.2012 / 04:53
hay nosvemos pues....

Swk ( e-mail: )
Lunes 05.03.2012 / 03:49
Por lo k veo puro chavo pendejero nadamas peliandose x un pinche pedasoo de terreno y una miseria de dolares k muy apenas les alcanza pa tragar sobrebibir y matar creen k eso bale su bida y al final de cuenta se ban a ir al infierno ponganse vergas chavos si enverdad les importa su vida no creo k chapo valla y los salbe ni los linieros los buenos son los k se estan inchando a costillas de ustedes jajajjajaja pa los k no isieron caso los veo en el infierno.

( e-mail: )
Domingo 04.03.2012 / 20:08
jajaj este chabo que jaja poniendo cansiones jaja nono andan mal echenle ganas pendego la linea firme llegamos estamso y estaremos atte la LINEA de el estado de chihuahua

cdsXxXXx ( e-mail: )
Domingo 04.03.2012 / 12:19
vestido de militar i al mando de mucha gente asi anda el chapo guzman por la sierre juarenze no lo an podido agarrar le temen mas que ala muerte nomas de oirlo mentar casi les pega diabetes es muy grande su poder esta mas que conprovado su gente que anda con el son civiles y soldados train aramas de alto poder que muy pocos an usado le temen mas que alucifer asi que tengan cuidados son muchos los que lo buscan son ma slo que los protegen la sierra de punta apunta son los terrenos del gefe ciudades pueblos i rutas tambien controla su gente si tienen una pregunta agansela al de los leentes no ai nada que discutir EL CHAPO sigue rifando su gente simpre anda el 1000 onde quiera trabajando el polvo i el canabis se sigue diario exportando los grengos no tienen fin siguen i siguen comprando es muy astuto el señor no cabe la menor duda se les fugo de prision oi disfruta su fortuna al diablo la extradiccion me pelan la dentadura le dijo afox y bush el señoron de la tuna son muchos los que los b

Sicario New People ( e-mail: )
Jueves 01.03.2012 / 04:31
que onda putos ya estan listo para ponerlos de buche i cortarles el pescueso recuereden que me gusta arrankarles el cuero de la cara putos y degollarles el cuello antes de matarlos les arranco los huevos yasaven como seles sale el aire por el cuello cuando los decapito sobre todo cortartele el hueso de la espina dorsal es lo que mas me gusta.CDS

PRM ( e-mail: BORRACHOS )
Miércoles 29.02.2012 / 17:21
PUES YO SOY D LA PRM Y YA PERDI LA CUENTA D CUANTOS LINIEROS Y AZCACAS ME ECHINGADO. SON D AGUA USTEDES NO DESQUITAN NI LA GASOLINA PA QUEMARLOS. PURO PRM BORRANDO LINEAS Y DESPLUMANDO AZCACAS.

CDJ ( e-mail: )
Miércoles 29.02.2012 / 16:18
JAJAJA PUES ESTOS NARANJEROS QUE CHINGADOS TRAIN ANIMO PENDEJOS ABLAN MUCHO Y NOMSA NO VEO AXION PUES AQUI SEGIMOS MAS FIRMES QUE NUCA. SOI LINEA.GRUPO LINCES COMANDADOS POR EL R19 AUNQUE LE DUELA A MUCHOS MI JENTE ES PURO VENENO SEGIMOS CON EL MADNO SI QUIEREN GERRA LLA SABEN DONDE ESTAMO ATTE LA LINEA. YO SOI EL 75 PA LO QUE GUSTEN AL SERBISIO DE CD JUAREZ

r12 ( e-mail: )
Miércoles 29.02.2012 / 12:55
neta ajala y se apodere de todo el chapo guzman y mas aora con la gente nuevaa

zonerone ( e-mail: santos-santos@hotmail.com )
Miércoles 29.02.2012 / 12:03
pinches marranos de la linea y aztecas ya se loesta yevando su pinche madre andan todos culiados no saven ni pordonde le caemoss i les yenamos la caveza de puro plomo puro prm revolutcionn

ZETA ( e-mail: )
Martes 28.02.2012 / 19:58
aller me culiaron otra vez

.l. ( e-mail: )
Martes 28.02.2012 / 02:51
apuesto ke todo lo ke disen aki devereas es lo q miran en la tele brodis mejor ponganse a jalar x gente km ustedes mi juaritos esta devastadoo .l.

MYDREECK . ( e-mail: MYDREECK.COM )
Martes 28.02.2012 / 02:48
sisi

XxXxCdS.Cdg.CpxXxX ( e-mail: )
Domingo 26.02.2012 / 19:46
Pora aqui i por china Cds oiganlo bien panochones asi quedemos todos regados en el piso melos llevo conmigo ipalos linieros y zetas b leyvas yano allan ni padonde correr los train arriados por todo mexico ni en sus casas los quieren yano caben en el infierno alla los volvere amatar putitos yake esta yeno el infierno de lineas y zetas.

( e-mail: )
Domingo 26.02.2012 / 17:43
NO CONOSEN AL CHAPO PINCHI PERROSS AKI NASII I AI K DEFENDERR JUAREZ I AI K BOLARRRR BRAZOS I CABEZASSS K PARAAA ESO SIRBENNN PARA MATARLOS COMO PERROSS

PRM ( e-mail: BORRACHOS )
Domingo 26.02.2012 / 10:05
SIMON HOMEBOY, PURO VATO MIADO D ESOS PUTOS LINIEROS. LA PRM PRECENTE Y LISTOS PARA PARTIR MADRES. PURO PRM.

chapos GN ( e-mail: )
Domingo 26.02.2012 / 08:43
puras P... dicen los linieros disque linieros chaketeros manguerones luego ai los hubicamos i andan llorando como nenas cuando les trosamos el cuello con la sierra la voladora anda bolando putos ise clava en la garganta.

PRM ( e-mail: CDG )
Domingo 26.02.2012 / 06:36
JAJAJAJAJJAJAJAJJA....PUTOS LES TIEMBLA EL CULOOOOO JAJAJAJAJAJJJA....

( e-mail: )
Domingo 26.02.2012 / 06:35
BAMOSSSS A DARLEEE PA LA LINIAAA JENTEEE

( e-mail: )
Domingo 26.02.2012 / 05:34
vayase la V... de juarez pinches chaputos solo vinieron a cabar cn la paz de juarez

( e-mail: MYDREECK.COM )
Sábado 25.02.2012 / 01:39
RESPETA JUAQUIN LA MANO QUE TE DIO DE COMER ATTE CARTEL DE JUAREZ aztecas_______________________

tsadsfsdf ( e-mail: )
Viernes 24.02.2012 / 21:03
Los radios en sus frecuencias Claves especializadas La raza se encuentra al 100 Y mas esa de chihuahua Esa gente de la lineaaaaaaaaaaaaaaaaaaa No se raja para nada Mas vale que esten bien puestos No les traten de brincaaaaaaaaaaaaaaaar PUTOS LA LINIA YEGO PARA KEDARSEE EL KOKE

ZETA ( e-mail: )
Viernes 24.02.2012 / 09:12
alle rme culiaron por primera vez me gusto sentir la yuka en el culo.

( e-mail: )
Jueves 23.02.2012 / 19:42
pinshee jentte ignoranttte nttta que tiene que andar con esas M... como el P... de abajoo nttta pontte aser algo de probechoo pendejoo

linieroZZ ( e-mail: )
Jueves 23.02.2012 / 19:15
creian que no nos dimos cuenta P... que el chapo yego el lunes ala plaza si para eso tenemos los alcones i alos aztecas aki LA LINEA monta perros baja de la sierra o te bajamos a bazukasos TRAICIONERO as puesto atus compdres pon al mayo zambada ole tienes miedo porkeno lo mataste el dio la orden en culiacan dematar a edgar guzman atu hijo todo mundo save que el macho prieto el ondeado i los antrax lo mataron don arturo le hablo al mayo i el mayo dio la orden.

PRM ( e-mail: BORRACHOS )
Jueves 23.02.2012 / 08:51
PRM listos.

( e-mail: )
Jueves 23.02.2012 / 07:59
doblee a

( e-mail: )
Jueves 23.02.2012 / 07:52
DOBLEE A VIVEE RAZZA -----A---A---C

PRM ( e-mail: BORRACHOS )
Jueves 23.02.2012 / 02:53
LA PRM LISTA PARA PARTIR MADRES,APOYANDO AL CARTEL,AA,GENTE NUEVA,BARREDORA Y TODOS LOS Q TRABAJAMOS PARA LIMPIAR EL PAIS D TODA ESA BASURA ALINIADA. LA PRM PRECENTE.

XxXxXxXxXXxXxXxXcds ( e-mail: )
Miércoles 22.02.2012 / 18:51
saludos pa los doblados AA i la prm ilos que esten apollando ala Gente nueva y alianza de sangre que andamos chambiando pa la CDS buscando la contra andamos sobre la ultima letra buscando el tope ya yego el chapo a chiwuas linieros ESCONDANSE TODOS

PRM ( e-mail: BORRACHOS )
Miércoles 22.02.2012 / 12:25
LA PRM PRECENTE Y APOYANDO AL CARTEL.

CDS xXxXx CPS ( e-mail: )
Miércoles 22.02.2012 / 11:34
un saludo para todo el cartel toda la compañia para la gente nueva los del comando x los de la barredora los antrax los 3 mandos i pa el patron de la tejana de lado y el chapito mas grande de la selula del CPS cartel de los pelones alos dela empresa que andan buscando el tope ala contra ya tenemos barios puntos ai en el sector awuas con la barredora cabrones

( e-mail: )
Domingo 19.02.2012 / 02:40
RESPETA JUAQUIN LA MANO QUE TE DIO DE COMER ATTE CARTEL DE JUAREZ

MYDREECK . ( e-mail: MYDREECK.COM )
Domingo 19.02.2012 / 02:16
SIMOOON MONTA PERROS

joaquin ( e-mail: )
Viernes 17.02.2012 / 09:24
chamakitos cagados siyo vengo de abajo muy abajo quien quiera tumbarme le cuesta la vida unos como vakas los mando levantar aqui estoi en juarez en mi plaza sigan corriendo yasaven ke aki estoi en la sierra de chiwuawua vengan abuscarme contras ala sierra tarahumaras aki estoi sembrando mis plantas y tomates regandolas y alludando al agente humilde no como los lacraZ ATTE EL CHAPO GUZMAN su peor miedo cabrones

( e-mail: )
Viernes 17.02.2012 / 02:08
ese dormillon, sleepy aqui esta tu gente del varrio chico trece, qvo homito pongase en contacto! aqui est el gato locote de los memorial park locotes!

MYDREECK .COM. ( e-mail: MYDREECK.COM )
Viernes 17.02.2012 / 01:38
MYDREECK.COM

( e-mail: )
Jueves 16.02.2012 / 05:59
HUUUYYYYY...QUE MIEDO... YA ESTOY TEMBLANDO.JAJAJAJAJAJAJAJA

UNIDAD ZETA ( e-mail: )
Jueves 16.02.2012 / 04:53
andamos buscando el tope en las ciudad de chiwuas ino le salen al tope esos chapos que los traemos con miedo. recibiran llamadas barios de aki contestenlas de lo contrario H... aron asu madre yo mismo les cortare la cabesa con la sierra. LOS ZETAS...

MYDREECK . ( e-mail: )
Miércoles 15.02.2012 / 23:18
MYDREECK.COM

( e-mail: )
Martes 14.02.2012 / 20:34
pura pinchi gentee puros carnale sputos somos INDIOS hijos de su perra madre el wero putos acabo de salir d ela torcida a vivir de neuvo la pinchi vida locos a tumbar pinchis chapetes a quien me ordenen C... traigo buena ranfla y el P... del dreck kiensabe kien evrgas sea junto con su pinchi marcos ke lo inicio no mame pinchi mocoso meco de la gente del samurai putos salidos desde el cherry templo azteca culeroos

( e-mail: )
Sábado 11.02.2012 / 14:38
jajaaaajajjajja AJAJJAAJAJJAJAJAJAJajajajajaj

PRM ( e-mail: BORRACHOS )
Viernes 10.02.2012 / 06:53
la PRM precente y ala orden para terminar con linieros y azcacas. puro PRM

Anonimus ( e-mail: )
Viernes 10.02.2012 / 03:42
DEA FBI cagense son vergassoi vera cheken el IP de joaquin i lada desde el merito badiraguato sinaloa itodabia miraran el satelite metan este numero en el foli 3 84357375 sin tan vergas caguense que el comentario de JOAQUIN es el mismisimo chapo guzman atte anonimus jack 6754./**

Anonimus Jacker ( e-mail: )
Viernes 10.02.2012 / 03:29
para enpesar para para todos vengo enpas linieros sinaloenses fbi i dea esta pagina tengo el (IP) de cada uno de el que escribe i veo que muchos son mangueras i otros son reales pero ai solo 2 que me iamaron mucho la atenccion qe me puse a investigar i son reales para JOAQUIN señor guzman estoi completamente seguro que es usted el que escribio esas palabras noce como dio a esta pagina o como supo de esto pero con todo el respeto usted es uno de mis idolos ino dire como supe todo de usted isupe que usted si era guzman loera pero espero que acave con esta gente llamdos Z i malandrines como los aztecas ate ANONIMUS DEA FBI saludos ni crean que noce que nos leen APOLLO AL CDS

la nueva clika ( e-mail: )
Jueves 09.02.2012 / 20:33
cual pinche barredora de sonora ke diske del cheko a ese P... ya lo mataron hace rato a y pa informar ke kedan doblados y panochos en los siguientes puntos info park aa-erendira aa-toronja roja y alrededores prm-horizontes aa-alrededores de c.u aa ay nomas pa ke se pongan trucha con estos P... ke no balen V... nomas ke para robar los putos aki seguimos fielez a los carnales mi gente

linea ( e-mail: )
Jueves 09.02.2012 / 19:56
ai muchachos nomas ablan por ablar jaja usted pendego del imperio callese la P... boca llo se como corre el agua en el juarez nuevo y en solidaridad. asi que usted sabe que nosotros isimo limpia ai jajaj todo los prm que andaban ai lla estan caidos jajajajja gracias al comando que usted lla sabe quen era el bueno jajaj y pues la verdad la linea tiene para todos asi que amarense los huebos y atorenle putos estasmo en el valle me ubico en guadalupe. la line esta en el mado jaja como les quedo el jale de sus pinchis municipales pendegos jajaj y aora bamos tras los de la policia unica los ministeriales sigen de nuestro lado como todo los soldado del sereso

moris ( e-mail: )
Jueves 09.02.2012 / 15:26
mira dreek tu eres un mil ranflas tu te ases para donde calientan gordas eso fue lo que dijo el erick que segun los guaraches que segun traes los compraste en unas segundas y tus plumas son de una gallima que desplumaron para el caldo del domingo entonses x lo siguiente agarra tus guraches tus plumas a y tu P... calendario tu quetzalcoath y todo lo que represente tu ranfla y metetelo x el C... pinche mocoso de M... pero eso es lo que dise el erick y el cholo de aqui de la ind 2 con copia para tu jente los sombis pinches tecatos de la altavista los ronosos del centro y a los piloteados que andan regados de parte del imperiote juarez nuevo el yonques

( e-mail: )
Jueves 09.02.2012 / 12:04
ese dreeck. pero si ya dijeron los aztecas que tu no eres nadie. que tu no reprecentas nada, que eres solo un pinche microbio. pues que pedo.

MYDREECK . ( e-mail: A QUI MANDAMOS NOSOTROS MONTA PERROS )
Jueves 09.02.2012 / 01:07
DREECKSOTE AL 10000 JUAQUIN CUANDO QUIERAS NOS DAMOS UN TOPON DONDE QUIERAS CHAPITO ABER ATTE MYDREECK DE LA COL.INDEPENDENCIA 1*2

( e-mail: )
Miércoles 08.02.2012 / 17:40
Y UN SALUDO PARA.....TU RRRRREPUTA ....MADREEEEEE...

galoyde ( e-mail: )
Miércoles 08.02.2012 / 16:07
un saludo para la wendy que no se vaña ni su aguelita norma de la colonia del carmen que es la ija de la lili y el banby

( e-mail: )
Miércoles 08.02.2012 / 16:03
un saludo para la peroda q se yama wendy

( e-mail: )
Miércoles 08.02.2012 / 16:00
un saludo para la rocio,joselyn,wendy de parte de el michel de la colonia del carmen

el melarosa ( e-mail: fco_pcho96@hotmail.com )
Miércoles 08.02.2012 / 00:52
vrgs

PRM ( e-mail: BORRACHOS )
Martes 07.02.2012 / 13:34
JAJAJAJAJAJAJAJAJJAJAJA....YA TODOS SAVEN Q LOS PUTOS AZCACAS Y LINIEROS NO VALEN MADREEEE JAJAJAJAJAJAJA. LES DIGO Q ESOS LINIEROS Y AZCACAS SON LA MUGRE D JUARITOZ. POBRES PENDEJOS ANDRAJOSOS.JAJAJAJAJAJAJAJAJAJA...Y....MAS....JAJAJAJAJAJA. Y LO DICE UN PRM.

LEYZAOLAAC ( e-mail: )
Martes 07.02.2012 / 08:41
LOS DE LA LINEA QUE? VIVEN EN PINCHES COLONIAS QUE NI AGUA TIENEN Y ADEMAS CAGAN EN POZOS Y SE LIMPIAN CON LAS MANOS JAJAJA... PINCHE BOLA DE PIOJOSOS. NUEVO CARTEL DE PIOJOSOS DEBERIAN LLAMARLES ATTE LEYZAOLAAC

joaquin ( e-mail: )
Lunes 06.02.2012 / 21:39
a chamakitos cagados entiendanlo bien plebes primero tumbo ala linea yo solo a aque me quiten mi bello sinaloa cuantos son tomen nota lineas zetas beltran leyva y aun asi los traigo arriados i selos dire i selos digo ami me pelan la V... no ocupo gafes ni linea ni lacras ni al gobierno aganme frente aki estoi en juarez chamakitos cagados ATTE CHAPO GUZMAN su pesadilla pollos.

la linea ( e-mail: )
Lunes 06.02.2012 / 18:22
aki la linea al millon putos ya saven kuleros ke con nosotros no pueden pinches pànochos y dobladas H... uen a su P... V... bomaba madre la linea sigue al mil ya cayo el flako el marrufo y ahora andan tras el chapo mejor metanse un plomaso ustedes mismos porke donde los agarremos los vamos a empinar putos aki pura ___________ kuleritos gente d delicias FIELES A LA DE LOS SEÑORES

CDG ( e-mail: PRM BORRACHOS )
Lunes 06.02.2012 / 17:01
ANIMO RAZAAAAAAAA, AQUI LA PRM APOYANDO AL GOLFO AL 100%.PURO PRM.

FLAMAS ( e-mail: )
Lunes 06.02.2012 / 15:35
HIJOS DE SU PERRA MADRE PINCHES PILICIAS CULONES SELOS BA A CARGAR LA VERGA POR PASARSE DE BERGA LOKOS SOMOS _____________________________________-

mydreeck.CdJ ( e-mail: para ESE PUTO )
Lunes 06.02.2012 / 15:19
CUANDO QUIERAS ´PU SI NO SABE COMO CORE EL AGUA CAIGALE DONDE YO ESTOY SI SACAS AL IVAN DIGALE DONDE SOY Y NOS DAMOS UNOS PLOMASOSPUTO DE MIERDA DISQUE DE LA LINIA EL QUE ME INISIO LE DISEN EL MARCOS YA SABRAS QUIEN SOY PUTO QUE YO NO ME ANDO CON CHINGADERAS ATTE DREECK JR.R8

PM ( e-mail: )
Lunes 06.02.2012 / 04:38
PURA POLICIA MUNICIPAL PINCHES AZTEKAS DE MIERDA LLORONES NOMAS LOS ATORAMOS Y QUIEREN ENTREGAR HASTA SU PUTA MADRE JAJA LLORONES CULEROS

( e-mail: )
Domingo 05.02.2012 / 20:36
miren hijos de su perra madre ya estuvo beuno que esten cagando la verga..la linea sigue bien firme todo estados unidos es de nosotros hasta ahi vamos bien mir apinchi dreck P... qu ete dices ser linea no estes poniendo P... por que despues les damos suelo y andan llorando las familias soy indio putoss aztecota a morir ndo enranfladote y si fueras azteca pinchi dreck deberias saber ke no se puede andar diciendo si eres indio stas pendjeo y pones otra P... sureños y aztecas controlando no mames pinchi mocoso los sureños no son gente esos weyes se entraron hace poco si no sabe no hable no est ecagando la verg apinchi mocoso pendejo

LINEA ( e-mail: )
Domingo 05.02.2012 / 18:42
jaja lla callense pinchis niños abladore.los prm no balen para pura made ok.y juares sige firme y todo es gracias a nostros la LINEA.jente de respeto pinchis rancheros como frigoles ban a la baga cunado quieran aqui los espero en el valle.y usted ni sinaloa a de conoser y lla anda defendiendo un tereno que ni de ustes ed jaja pinchis muertos de ambre la linea segimos en el jale visente carrillo fuentes

PRM ( e-mail: BORRACHOS )
Domingo 05.02.2012 / 05:13
Q PUES AZCACAS, SOLO ESTAN HAY ??? EN ESA COLONIA. JAJAJAJAJAJJAJAJAJA LES DIGO Q SON MUY CULOS. LA PRM ESTA EN TODOS LADOS D CHIHUAHUA, MEXICO, GTO, MICHOACAN, SINALOA, DURANGO, QRO. ETC ,ETC. Y CENTROAMERICA. COMO VEN PENDEJOS ???? NO SOLO EN UNA COLONIA O CALLE. EN TODO EL PAIS ESTA LA PRM. PURO BORRACHOOOOOO. Y X Q NO ??? CLARO Q TAMBIEN LOS ESPERAMOS....JAJAJAJAJJAJAJA

Kaerrez creew 2006 Pachuca! ( e-mail: )
Sábado 04.02.2012 / 18:10
mejor rifeen vanda en lugar d pelear tsss...!!.q viva el graaf.. Mexicano!"awev..

MYDREECK .CNJ ( e-mail: A QUI MANDAMOS NOSOTROS MONTA PERROS )
Sábado 04.02.2012 / 17:43
ESOS PUTOS DE LOS PRM SE LES ESTA CALLENDO SU GALE COMO BEN PERROS QUE CHINGEN SU BONBA MADRE Y CUANDO QUIERAN ESTAMOS EN LA COL iNDEPENDENCIA 1 Y 2 O AVE.DE LOS AZTECAS AL MILLON CON C.N.J. - C,D,J,*V*B*T*13-AZTECAS-___________________________________________________________

CDG ( e-mail: PRM )
Sábado 04.02.2012 / 16:03
MEJOR APOYA A TU.....REPUTA ...MADREEEEE....JAJAJAJAJAJAJAJAJAJAJAJAJA PURO GOLFO PRM

( e-mail: )
Sábado 04.02.2012 / 15:36
LA NETA NO TRABAJO PARA NADIEN PERO SI KIEREN APOYO PARA LA LINIA SOY DE AKI I DEFIENDO MI JUAREZZ NO TENGO PORKE DEFENDER AL CULON DEL CHAPO NI LO CONOSEN I NI EL SABE K TRABAJA PARA EL HAHA PENDEJOS NOMAS LE DAN UN CUERNO I NI SABEN USARLOS IDIOTASS JUARITOZ RIFA SOY PANDILLERO DE JUAREZZ DESDE NIÑO I NO LE TIEMBLO A NADIEN I SE LA POEDO CONTAR AL DERECHO I ARREBES MI HISTORIA DE JUAREZZ APOYANDO ALA LINIA

mydreeck.CNJ ( e-mail: A QUI MANDAMOS NOSOTROS MONTA PERROS )
Viernes 03.02.2012 / 18:58
ATENCION PEROS CUANDO QUIERAN GENTE DE EL CHAPUTO Y DE EL MAYAS MORDIERON LA MANO QUE LES DABA DE COMER Y LES ESTA COSTANDO BAMOS CON TODO ASTA SINALOA SALUDOS ALA SINALOKA DE SU BIEJO EL DREECK COCHON ESOS PRM NADIE LOS PELA ALOS PENDEJOS Y CUANDO QUIERAN LOS ESPERAMOS DONDE QUIERAN ESPEREN EL SARPASO ATTE .DREECK - MARCOS- 8JR-

LINEA ( e-mail: )
Viernes 03.02.2012 / 14:36
JAJAJAJAJAJAJA aqui estamos el 17 atte la linea

CDS X x X x X ( e-mail: )
Viernes 03.02.2012 / 00:13
gente nueva ya resivimos la alerta del señor guzman la orden se cumplira nomas para decirles alos LINIEROS que son culos i venimos desde sonora i mexicali arreforsar la plaza poes aka tambien corre biento putos zetas i lineas lacras muertos de hambres muy pronto les iegamos alos H... asos atte el barredora de sonora i el compa checo 6 de mexicali agarrense putos....

la linea ( e-mail: )
Jueves 02.02.2012 / 20:55
segimos en el mando chapulines ban a la baja atte la line de el pueblo de cd juarez jente del17 y 25z

CDG ( e-mail: PRM )
Jueves 02.02.2012 / 06:57
NO Q NO PUTOS......JAJAJAJAJAJAJAJAJAJAJA, YA VEN PUTOS. ESTAN D ALASTIMAS COMO SIEMPRE JAJAJAJAJAJAJAJAJA. PURO PRM

linea ( e-mail: )
Miércoles 01.02.2012 / 21:03
usted mijo no se preocupe por eso. llo le aseguro que todo regresara a la normalidad por eso estamos luchando y los bende narangas ban a la baja.y esta cd sera la misma y patas cortas. cuidense que segimos trabajando. atte la linea

el pitudo ( e-mail: )
Miércoles 01.02.2012 / 20:31
aqui en juarez todo estaba muy bien hasta que llegaron los pinches enanos C... del chapo aqui en la ciudad habia dinero para todos sin secuestros extorciones ni carjakers pero por querer quedarse con todo el pastel todos andamos pa la berga gracias pinche gente nueva digo gente muerta por venir a cagar el palo a la ciudad todo estaba bien cuando rifaba la linea no digo que este a favor pero quiero que juarez sea el de antes

( e-mail: )
Martes 31.01.2012 / 17:24
enderesando jente! atte la liena recta en cd juarez! NUEVO CARTEL JUAREZ CHIHUAHUA

PRM ( e-mail: BORRACHOS CDG )
Martes 31.01.2012 / 09:46
HUYYYYYY..... Q MIEDOOOOOO. USTEDES MUY CUMPLIDORES COMO SIEMPRE.JAJAJAJAJAJAJAJAJA. PINCHES RATAS D BASURERO. LA PRM BORRANDO LINIAS Y DESPLIMANDO AZCACAS.JAJAJAJAJJAJAJAJA

linea ( e-mail: )
Lunes 30.01.2012 / 19:06
animo los de abajo pues ustedes puro blablabla- aqui los esperasmos atte. la linea---------------------------------------------------------------------------

PRM ( e-mail: CDG )
Lunes 30.01.2012 / 17:18
ASI ES CARNAL, ESTA GENTE YA C SALIO D LO PACTADO Y ESO D ANDARSE SALTANDO BARDAS NO ES LO MAS RECOMENDABLE Y AHORA ESTAN SUFRIENDO LAS CONSECUENCIAS. LOS PINCHES AZCACAS SON TRAICIONEROS Y LACRAS ESA GENTE VALE MADRE X ESO LOS TRAEMOS AL PEDO EN EL SISTEMA. SALUDOS CARNAL Y RESPETOS PARA TODO PRM Q SE ENCUENTREN CON USTED. CON RESPETO Y CORA PURO PRM Y EL GOLFO CAMELLANDO MACHIN.....

clavo ( e-mail: )
Lunes 30.01.2012 / 14:30
saludos y respetos carnaleste P... se cre blindado pero guache carnal a estos putos si no los matamos nosotros se matan entre ellos lla estos putos se apendejaron y le soltaron las llaves a las trensudas y los isieron de agua aora las trensudas andan asiendo segun ellos el nuevo cartel de juarez pero es lo que queda de estos putos que lla se torcieron se los dije a los putos linieros los putos aztecas nadamas los iban a usar de gancho para meterse a juarez con una bandera de aqui para aser P... a la jente con esa bandera pero todos sabemos que los aztecas son puros gabachos , chicanos, y uno que otro vende patrias que les sigue el rollo pero esta istoria es vieja primero estan matando linieros para comerles el pastel a pero gracias x el jale nos aorran andar tirando basura pero todos sabemos que despues se ban andar matando entre ellos mire las M... con las que quieren enconchar a juarez matando policias pero aora si se la ban a pelar x porque nuevo o viejo cartel de juarez nos p

PRM ( e-mail: CDG )
Lunes 30.01.2012 / 08:10
MIRE PUTO LINIERO D MIERDA, USTEDES LO UNICO Q CORREN ES EL OSICO. USTEDES Y LOS AZCACAS SOLO SIRVEN PARA LIMPIARME EL CULO. COMPROBADO ESTA Y SEGUIRA ESTANDO Q LA PRM BORRACHOS ES MUY SUPERIOR A TODOS USTEDES. O QUIEREN MAS PRUEBAS ??????? PURO PRM.

linea ( e-mail: )
Domingo 29.01.2012 / 21:18
mire mijo el que se debe de bajar de su nuve es usted.como cres que bas acabar con mi jente lla jaja yo soi linea y estoi directote. tu as de ser un asalariado. usted y su jente deben de saber que la linea no se acabara. nuca oquei. y eso que estamos aciendo con los municipales es por que se rompieron, y leisaola se tiene que ir y asta que el no se retire su jente segira callendo, y pues si ustedes dicen que no dañana a la jente sivil. porfabor ai les encargo que dejen de secuestrar.extorcionar,y andar de carrsjakins. y pues sabemos que leisaola no es nu de aqui ni de alla.pero eso si siga agarando de mi jente y si jente ba a segir callendo asi mismo contrarios andense con cuidado que lla ai unos sectores que tenemos ubicados. que se ba a trabajar en esos puntos. lo unico que les puedo adelantar es que se cuiden esos de villa colonial y la linea estamos firmes. y al serbiso de la jente. lealtad al CDJ CHIHUAHUA.

clavo ( e-mail: )
Domingo 29.01.2012 / 16:33
SIEMPRE CON SUS PINCHES MAMADAS MI DRECK LLA AGARRA EL ROLLO TU VIAJE Y EL DE TU JENTE LLA SE ACABO NOSOTROS ESTAMOS RECLUTANDO A LO QUE QUEDA DE TU JENTE LA GUERRA LLA ACABO ESTOS JALES DE MATAR POLICIAS ES LAS ULTIMAS PATADAS DE AOGADO QUE LE QUE DA A LA POCA JENTE QUE LES ANDA SIGUIENDO EL ROLLO PERO ESTAN MAL ESTO ES NO SABER CAMELLAR Y LLA SE LES UNDIO EL BARCO Y LEALTAD AL CARTEL DE SINALOA LEALTAD AL PRM Y LEALTAD A CD JUSREZ NOSOTROS PELEAMOS POR ASER UNA MADRE PERO CAMELLAMOS CON EL CEREBRO Y MANTENEMOS EL CONTRL SOBRE TODO X QUE CAMELLAMOS X LA LEY DE GANAR Y GANAR Y SEGUIMOS SIENDRO PROACTIVOS SIEMPRE BUSCANDO NUESTRO BIENESTAR PERO SIEMPRE RESPETANDO EL BIENESTAR DE TODOS Y ACUERDATE DRECK EN LA GRERRA HAY LEYES Y USTEDES LAS ESTAN VIOLANDO TODAS EL HONOR LOS ES TODO X QUE AUNQUE SEAMOS MARRANOS NUNCA HAY QUE SER TROMPUDOS ATTE :PRM EL AGUILA ME RESPALDA

mydreeck.CNJ ( e-mail: A QUI MANDAMOS NOSOTROS MONTA PERROS )
Viernes 27.01.2012 / 20:56
Leyzaola. Si sigues apoyando a EL CHAPO Y los montaperros y agarrando pura gente de nosotros te vamos a estar tumbando un elemento diario para q sepa toda la ciudadanía lo corrupto que eres. Leyzaola=Delincuente con placas. ATTE. NCJ

( e-mail: )
Jueves 26.01.2012 / 13:14
EL PANICKO T LOKOTES HJK 37 RIFA

josemaria ( e-mail: jmcalcha@hotmail.com )
Domingo 22.01.2012 / 02:12
VENIAMOS TAN BIENNNNNNN ¿Peroooo por que mierdaaa tuvieron que surgir Esta Mugree De lOS WACHInosecuatoooo????? Queee lo parioooooo....

PRM ( e-mail: CDG )
Sábado 21.01.2012 / 17:37
PUES YO SOLO C Q LA PRM ES PURO CORAZON,PURO RESPETO, LEALTAD, HONOR Y PRM ES...... LO MEJOR. LOS DEMAS SON POQUITEROS,LAMBISCONES,LUMBRISIENTOS,PENDEJOS Y IDIOTAS.

( e-mail: )
Viernes 20.01.2012 / 02:21
No mames pinche lambe guevos lo de la's cuotas todos sabemos que es Rollo de los aztecas siempre an traido ese pinched jape papa Gerhard de tumbar a low paaisas x esoteric low laquearon en el chuck low laqueqron low paisas p"rm 'y low de la.linea puss son chapetes tienen que agarrar a estos tecatos para usarlos como Carney de canon peri de todos no se baseness 1 cada 1 del pemmican vale x 10 de ustedes x esoteric les quitamos la mitad del cereso adora la.mitad de Juarez y pronto todo x sue putas marranadas s e respite la historia

( e-mail: )
Jueves 19.01.2012 / 12:47
linea!! mijo echele muchas ganas. poues tu as de ser el que anda cobrando cuotas de a tosoton. y jalesitos de 20. jajaa andas mal morro pendego. io no ando aciendo jalesito yo tengo jente que trabaja para mi. yo no ando con H... aderas.digame cual es su ubicasion no sea culo. io me encuentro en el valle y sausal. y mi dreck. echele putasos a los contras de mirda que me dan verguensa. aora toca que caiga su jefe m1oo. aqui segimso.cartel cd,juarez ccd. la linea..

PRM ( e-mail: CDG )
Miércoles 18.01.2012 / 07:20
PENDJOS, USTEDES NO SALEN D JUAREZ X PURO PINCHE MIEDO,NO CONOCEN OTRO LUGAR YA Q NI PAL PASAJE TIENEN.COBRANDO CUOTAS D 100 PESOS Y TRABAJITOS D 50 PESOS ES LO UNICO Q PUEDEN HACER. LA PRM Y CDG CONTROLANDO PLAZA. PURO PRM PUTOS.

Dreeck de la col.Independencia ( e-mail: Al millón con LA GENTE AZTECAS )
Miércoles 18.01.2012 / 06:52
Así SEA ESE PENDEJO DE LOS PRM MOCOSO PENDEJO NI LO PELEN ANDA ARDIDON POR SU GENTE DE MIERDA SIGIMOS PARADELANTE LA GENTE NUNCA SE ACABARA AZTECAS SOMOS Y ASÍ MORIREMOS V-b-t-13 LOS CONTRAS NI SABEN QUE TANTA GENTE SOMOS Y QUE BARRIOS Y COLONIAS OSMOS UNIDOS POBRES PEROS DISQUE SON LAGENTE DE EL CHAPUTO POBRE PENDEJO SI SUPIERA QUIEN PUSO AL FLACKO Y A OTROS LA MISMA GENTE DE LOS DOBLADOS NOS AN PUESTO A MEXICLES Y SU PROPIA GENTE ESTORCIONADORA Y CARSLAKER YA PA QUE TANTA PALABRERÍAS SALUDOS A TODA MI GENTE QUE ANDA LINPIANDO JUARITOZZ ANDAMOS EN EL MOVIMIETO DREECK Y R8 :...... SALUDOS ALA NUEVA GENTE SUREÑA QUE BA LLEGANDO DE EL OTRO LADO YA SABEN PERROS A QUI SE TOPAN .SOY EL DREECK .VBT13

linea ( e-mail: )
Martes 17.01.2012 / 22:28
mire mijo se lo boi a degar bien claro. porfabor ia no este ablando por ablar por que dise puras penegadas. la linea es recta i mui larga asi que no me benga con sus H... aderas. que aqui en juares ustedes bien sane que nuca an sido nada ni nca lo seran.siempre an sido la basura de juarez(skoria) aqui en juares quienes an mantenido tod somo nostros.linea.linces.aztecas. asi que no mebengas con tus mamadas. mejor lla bette con tu patron a ordeñar bacas que es lo unico que saben aser. atte. la LINEA.catrel de JUAREZ. mi r8..lo apollo en lo en todo ando en el valle trabajando.para lo que se ofresca...a y por fabor ya no maten inocentes..

PRM CDG ( e-mail: BORRACHOS )
Martes 17.01.2012 / 09:41
TENGO MUCHO Q HACER, Y LA DIFERENCIA ENTRE UN AZCACA Y UN PRM ES LO MEXICANOOOOO, EL VALOR, LEALTAD, Y CAPACITACION EN LO Q HACEMOS. HAY PUEDES VER LOS RESULTADOS.....EL TERRENO ES D NOSOTROS, LA MERCA D NOSOTROS, LAS TROCAS D NOSOTROS Y HASTA USTEDES SON D NOSOTROS.JAJAJAJAJAJAJAJJA PURO CDG Y PRM.

( e-mail: )
Martes 17.01.2012 / 02:54
JAA ESE DE LA PRM NETHA WEY KE NUMAS ABLAS POR KE NO TIENES NADA KE ASER EN TU PUTA VIDA WEY HAS DE SER UN IJO DE MAMI K MIRA MUCHO EL BLOG DEL NARCO jajajaj SOMOS DE JUAREZ Y NS KEDAMS EN JUAREZ OINCHE TEKATO DE FUCK PURO PINCHE AZTECAS DE JUARITOS Y EL PASO .l. cometelo weyy

PRM ( e-mail: BORRACHOS )
Lunes 16.01.2012 / 17:52
Q LES PASA NIÑAS ??? TRANQUILAS Q USTEDES NO PEINAN UN CHANGO A NALGADAS..... USTEDES SOLO DAN LASTIMA A USTEDES JUNTO A SUS PUTOS PATRONES ME LOS PASO X EL ARCO D LA CALZADA.....JAJAJAJAJAJA. PENDEJOS POQUITEROS. PURO MEXICANO PURO PRM.

( e-mail: )
Lunes 16.01.2012 / 10:56
I SELE RESPETA MI CAMARADA EL DREECK SALUDOS MI R8 DE SU CAMARADA EL JUANILLO DE LA DIVI SUR

( e-mail: )
Lunes 16.01.2012 / 07:20
ASIES MI DREECK SELE A POLLA R8

SOY MY DREECK EL MISMO ( e-mail: AZTECAS LINPIANDO LA PLAZA DE SINALOS Y DOBLADOS.C )
Lunes 16.01.2012 / 07:13
AJAJJAJAJ ASTA ME ASEN REIR PUTA GENTE DE LA DE ABAJAO LO QUE ESCRIBEN SON PURAS PENDEJADAS SOMOS DE LA COL. INDEPENDENCIA # 1 Y 2 CUANDO QUIERAN ANDAMOS AL MILLON CARTELOTE DE JUARITOZZ V*B*T*13 SUR 13 Y AZTECAS CONTROLANDO EL CERESO LA SE LA SABEN ESTO NO SE ACABA PARRAS SIGIRAN CALLENDO ATTE MY DREECK AL SERVISIO DE EL CARTEL MAS CHINGON CARTEL DE JUAREZ SALGALE NINITAS DE APEZO

( e-mail: )
Domingo 15.01.2012 / 07:47
8 PANOCHUDOS MENOS, JAJAJAJAJAJJA 8 AZCACAS MENOS YA ENCERRADOS X PENDEJOS. SI D X SI SON POCOS Y LOS Q HAY ESTAN BIEN PENDEJOS. POBRES WEYESSSSSS.JAJAJAJAJAJAJAJAJAAJAJA.

PRM ( e-mail: BORRACHOS )
Sábado 14.01.2012 / 12:59
Q pues homeboy, gusto en saludarte y saver q estas bien. yo corro PRM y estoy asus ordenes.

( e-mail: )
Viernes 13.01.2012 / 14:41
Saludos al shismosito

QUINTERO ( e-mail: moshhito_666@hotmail.com )
Jueves 12.01.2012 / 19:41
Hey un saludo para todos los borachos estuve en Beaumont Tx. alla no habia raza, puros cincos. y la corrian los ochos. solo estaba un carnal q le dicen el Bulis... conocido alli como Borracho. yo me juntaba con el por q les agarre cora. su padrino de el creo es Acuña no estoy bn seguro lo levanto en Huntsville. yo pase por huntville cuando iba d salida pero solo estuve la tarde alli. en la noche me aventaron pa migracion. ya en las paredes me tope con mas raza. El cocho de alli de austin, el michoacano y otros 2. alli me dejaron unas directas. a mi me dicen el chilango. ahorita estoy en el df. Ahorita estoy al tanto de el Bulis q ya esta en Huntsville. Yo soy d alla de Austin. Y traigo cora. ya me quiero aventar para atras haber si la armo. Un saludo con todo respeto.

JARUDO LOKOS ( e-mail: )
Jueves 12.01.2012 / 04:48
PERROS DE MIERDA SEGUIMOS RESPIRANDO JARUDO LOKOSS OYGAN BIEEEN AI ANDAMOS SOBRES DE RATO BOLBEMOSS AAA DAR GUERRAA HAHA KUIDESEN MIS NIÑOS K AN REGREASADO LA BJL

LA LRT ( e-mail: GRAFFITEROSS )
Miércoles 11.01.2012 / 02:55
LA LRT LEVANTADA POR TODO JUARITOS I LOVE GRAFFITY THE SKOR ONE!!

scop ( e-mail: )
Martes 10.01.2012 / 21:35
no mamen uno sale del cereso y de lo que se entera que jarudo y pelones se unen acg-msf ya no estan unidos con los hea que los msh andan solos y que acaban de salir unos pinches barrios cagados que son los fl-trl-bae pinchis bola de fresas fracasados y los 5ta no valen V... igual que los swk de la melchor bola de P... puro aa putos

( e-mail: )
Martes 10.01.2012 / 17:25
Simon. Àl 100 con el chapo

( e-mail: )
Martes 10.01.2012 / 15:09
jajaja q bueno rolyo train 2a estan bien cagados! sigan en su rollo de extorcionadores. carjacken.y secuestradores..siga le labiendole los pies al los patas cortas! jajaja sigen callendo changos. la linea esta fimre y recta atte 17 en el valle caiganele

( e-mail: )
Martes 10.01.2012 / 09:20
JAJAJAJAJAJAJAJJAJAJAJA D ACUERDO CONTIGO, ESE VATO NO VALE MADREEE. PINCHE LINIERO MIADO.JAJAJAJAJAJAJAJAJA....

( e-mail: )
Lunes 09.01.2012 / 15:28
No mames pinche maquilero seme Ase que eres un punetero que no sabes ni que pedo al unico que as matado es al maricon que ves en el espejo ya maton . Sal del closet tu si eres de Juarez mi juanga y arriba juarez

( e-mail: )
Domingo 08.01.2012 / 13:49
k se pudran la jente del chapo yo nasi aki en juarez i aki muero trabajo para la linia i kada bes k mato uno de esos muertos de hambre me da tanto gusto akabar con eyoos dygamen donde esta esa jente ya no se esconda mas ay bamos la linia remgando jente del gato ai andamosss chidota bjl

000000000000000000 ( e-mail: )
Domingo 08.01.2012 / 13:34
---------------los cochados---------

( e-mail: #1 )
Domingo 08.01.2012 / 04:27
________________________________________________

PRM ( e-mail: CDG )
Viernes 06.01.2012 / 15:50
PURO PRM Y Q VIVA EL MEXCAL......¡¡¡¡¡¡¡¡!!!!!! LA PRM PRECENTE Y CONTROLANDO EL TERRENO BORRANDO LINEAS Y DESPLUMANDO APACHES JAJAJAJAJAJA Q NO CARNALES.

colega ( e-mail: )
Viernes 06.01.2012 / 12:48
H... uen a su madre los de la line y los chicanos y tu broda mejor busca pajinas de dios no que lla te reabilitaste P... arrepentido a y a tu puma metetelo x el C... jajaj

para el PRM ( e-mail: )
Viernes 06.01.2012 / 03:47
mira dikse ke tu mucha prm ike aka traes puro bla bla bla mejor sierra el osiko por ke aki en juarez M... como tu es la ke esta acavando kn la imagen de mi ciudad los ke nacimos aki seamos chiknos mexicanos ati ke te valga madre somos de JUARITOS CITY y io camelle pa el chuma de villa ahumada y grasias a dios me sali y conoci A JUESUCRISTO Y EL ME ESTA SALVANDO DE TODO y ya major no sigan ablando y aserkense a la iglesia es lo mejors tss no kise desir groserias

linea ( e-mail: )
Jueves 05.01.2012 / 18:13
ustedes puro bla bla bla. sin palabras aqui los esperamos atte la LINEA.

PRM ( e-mail: REVOLUCIONARIOS. )
Jueves 05.01.2012 / 15:22
Claro q no eres sicario, para eso t falta......muuuuchoooo. eres un simple P... extorcionador q solo gana pa medio tragar al igual q toda tu gente.cobrando ala gente humilde quitandoles lo poco q ganan en ves d darles pa q c alibianen c los quitan ustedes x eso siempre an sido y seran unas pinches mierdas mendigos poquiteros. ya no H... uen ala gente... mejor alibianenla.

lineros ( e-mail: )
Martes 03.01.2012 / 18:23
linea yo no soi sikario pero cuando ai que trabajar trabajamos. io muebo el negocio creo que me entiendes. tengo jente q trabaja en eso de matar mierdas enanos y usted compa pues dise que fue trabajador. entonces trabajabas para la linea. y si quiere jalar ai estoi io para dale jale. ando io en la area de el valle. soi jente de alto rango. el L17 sigo chambiadno

( e-mail: )
Martes 03.01.2012 / 10:23
netha weyes me pongo a leer todas su P... y me dan risa NETHA SON UNOS IJOS DE MAMY KE NO SALEN DE SU CASA POR ESTAR EN LA COMPUTADORA JAJAJAJAJAJAJA mejor ablen de pandiyas lokos los AA pa empesar es una pandiya estupida ke el chaputo les da feria pa ke kebran aztekas y diske les va a dar la plaza de juarez los aztekas pues tabn es una pandiya ke la mando ala gavesh la linea por ke no supo controlas la plaza OSEA WEYES LA LABIA KE USTEDES TIRAN AKI ES LA KE SALE EN LA TELE O EN EL BLOG DE LA NARCO UN VERDADERO SIKARIO NI TIEMPO TIENE PA ENTRAR A ESTAR MERMAS NETHA NO digo ke io sea pro era encargado de un punto ase 3 aaños y eos si eran tiempos buenos todos trabajabamos :) ya chavos ballan aver si ya cago el chapo o el r8 JAJAJAJAJAJA

PRM ( e-mail: BORRACHOS )
Martes 03.01.2012 / 07:29
UN SALUDO PA TODOS LOS Q JALAN PAREJO CON LA PRM. Y LOS Q NO.....PUES Q CHINGUEN SU MADRE BOLA D JOTOS SACATONES.

( e-mail: )
Martes 03.01.2012 / 06:35
___________________________________________

bower ( e-mail: )
Martes 03.01.2012 / 05:57
ke kabrones ke asiendo hijos de mami mejor ponganse a rajar kabrones arrez putoz

tibu ( e-mail: )
Lunes 02.01.2012 / 12:57
k tranza hijos de perra aka nadamos bien resio esto es un aviso para todos los de la LINEA se los va cargar la V... putos ya se la saven k los DOBLE A son los k van a controlar la plaza jajaja cuidense todos putos chavalas

manuel alfredo ( e-mail: adrianass )
Lunes 02.01.2012 / 07:35
bayansen alaberga pinchis narkiyos culos nomas tiran su flou putos ino balen berga putos

bebe ( e-mail: )
Lunes 02.01.2012 / 07:25
H... en a toda su P... madre de M... kuleros toda la bola de pendejos

( e-mail: )
Sábado 31.12.2011 / 14:45
a pero como son abladore BLA BLA BLA aqui estamos en el valle.los esperamos con gusto.y sigan con su mil amores. jaj ec batito no era nadie jaja aqui rifa el gatto.y los escajeda atte la linea.fuentes

virus ( e-mail: )
Viernes 30.12.2011 / 19:10
MIERDA PARA TODOS

barredora CXDXS ( e-mail: )
Jueves 29.12.2011 / 17:37
un saludo atodo los chavalones que andan chambiando ino basilando yasela saven cabrones que con el CDS asta la muerte asi quedemos todos en el piso agonisando i para los linieros que no le sale al toro ni alos topes que andan buscando auien secuestrar o chikotiados de un lado a otro yatenemos barias casa de seguridad hubicadas poes somos gente nueva ino malandrines muertos de hambre ATTE LA BARREDORA DE SONORA

PRM BORRACHO ( e-mail: REVOLUCIONARIO )
Jueves 29.12.2011 / 13:54
ASI ES CARNAL,LA PRM APOYA A TODO AQUEL Q LO NECESITA Y ESTA GENTE D LINIEROS Y AZCACAS YA NO TIENEN NI DONDE ESCONDERSE. ANIMOOOOOOO Q ESTO ESTA MUY BUENO,YA LA TENEMOS GANADA. CON RESPETO Y CHINGO D CORA UN TIGRE CONSAGRADO. PRM.....

clavo ( e-mail: )
Jueves 29.12.2011 / 13:07
miren la jente de zaragoza lla nos enteramos que los de la linea y los aztecas les estan cobrando cuotas y les estan quemando los cantones pero es importante que se pan que esta jente los aztecas y la linea trae la verde x parte de todos los clanes lla van de caida no se dejen y presenten pelea estos son puros chicanos drogadisctos que se quieren aprobechar de la jente de cd juarez pero acuerdsense lo que dijo el general zapata es mejor morir de pie que vivir una vida arodillados y dijo mi jeneral villa matelonlos despues investigamos pero el respeto se gana y los clanes tambien nesesitan ver que ustedes le ban a salir x lo suyo pero aora estamos para apollarlos y estamos con ustedes atte prm y los clanes

clavo ( e-mail: )
Jueves 29.12.2011 / 04:35
saludos a los carnales los borrachos seguimmos al 100 gracias a los chavos que empinaron al mil amores 4 menos lla estos batos estan mas torcidos que nada lla son las perillas de juarez si no les pegan x un lado les dan x otro aqui andamos en juaritos y en chihuas y ando de lo mas feliz x esos chicanos de M... que se la pasan H... ando a la jente de juaritos con sus pinches cuatas no saben camellar x eso tumban a los comerciantes pero lla se les callo el circo y lla nadie los apoolla ponganse las pilas carnales aleonen y caminen derecho para seguir representando al mescal como debe de ser jale es jale pero las cochinadas no son buenas a camellr atte:prm

( e-mail: )
Martes 27.12.2011 / 11:40
mire morro esa clave de radio no existe. usted megor que nadie sabe.pero gracias lle me dieron el informe y ustedes no son ni de aqui ni de alla .andan solos y esos welles son chapulines y son los primeros que se ban.a no est de ablador aqui andamos pedaso demierda. pinchis 35.muertos de ambre. lla se les cargo la V... con la jentte del 17. leales al gato. atte la linea.

( e-mail: )
Martes 27.12.2011 / 06:52
PUES AHI T DEJARON EL NUMERO D RADIO PA Q HABLES PINCHE LINIERO,AVER SI MUY PICUDO, PIENSO Y CREEO Q ERES CULO AL IGUAL Q TODA TU PUTA GENTE.SOLO TIENEN OSICO PARA MAMAR . Q PUTAS ANDAS PREGUNTANDO???? HABLALE AL VATO Y DILE LO Q SIENTES EN SU CARA....ERES CULO PUTO T SUDA EL CULOOOOOOOOOOOOOOOO.

( e-mail: )
Lunes 26.12.2011 / 19:46
asi que andan trabajado de roba carros orale chavos gracias x la informacion. llegaremo a rebentar esos puntos.o ablen antes de que sea tarde para quien jalan? aqui jent del 17,la linea

el sleepy vct ( e-mail: 13 )
Lunes 26.12.2011 / 18:22
esos putos de la hueco st son culos aki stamos n corto salganle chavalas puro memorial parke locos vchico 3sote .vct los ace M... norteños de caca

DE SU PATRON ( e-mail: mensaje dirigido a la fmc )
Lunes 26.12.2011 / 13:39
KABRONES TIENEN 24 HORAS PARA REPORTARSE CON EL 20% DEL JALE DE LA CHEYENNE.SABEMOS QUIEN FUE. LLAMAR AL NEXTEL 5*435456*4 O SI NO DE LO CONTRARIO VAMOS A ENTRAR A VIRREYES A TRONARLES LAS VISERAS A BALASOS POR ESE ROLLO DE CARJACKERS. YA ESTUVO BUENO MIJOS! QUEDAN ADVERTIDOS!

( e-mail: )
Domingo 25.12.2011 / 17:25
estos welles q train jajaj sigan de aBLADORES purobla bla bla. aqui los esperamis la LINEA sin comentarios. CDCJ.CHIHUAHUA

( e-mail: )
Domingo 25.12.2011 / 07:30
fama one putos de hps xv cd juaritos killer

( e-mail: )
Domingo 25.12.2011 / 07:26
ke transa P... aki el teers y el fama de la ept

DUKE MACRISTIS WUERO ( e-mail: )
Sábado 24.12.2011 / 17:51
ASIMON ESE AKI EL DUKE CON SU HOMMIE L WUERO BIEN DOBLADOS ATERRISANDO AVION EN LA ESKINA DEL BARRIO POES SOMOS UNA GANGA MATONA DE MARIWUANOS KE SI TE WUACHAMOS TE TUMBAMOS EN EL BARRIO AKI CON AK47 PUTITO ALCONIANDO ALOS CONTRAS ESPERANDO LUZ VERDE DE ARRIVA AL TOPON NO AIREVERSA SON DE AGUA CHAPETES PINCHI LEVASS NOSOTROS SILE SALIMOS AL TORO I ESTAMOS ALA ORDEN DEL CDS CDG ATTE MACRISTIS INDEPENDENCCIA MCK EL WUERO Y EL DUKE BIEN TUMBADOS EN LA ESKINA FUMANDO WEET SIN LIMA BIEN ONDIADOS CON EL CUETE EN LA CINTURA. REPRESENTO MEXICALI B.C

WUERO TIRANDO VERGASOS ( e-mail: )
Sábado 24.12.2011 / 17:46
KE TRANZA HIJOS DE SU PUTA MADRE AKI EL WUERO DE LA MCK MACRISTIS DESME MEXICALI B.C AKA TAMBIEN CORREO VIENTO PUTOS CHAPETES TRAEMOS APAN Y VERGA ALOS LINIEROS ATTE PANDILLA MCK MACRISTIS CHOLOS MARIWUANOS MAFIOSOS REPRESENTO LA CORPORACCION CDG

( e-mail: )
Viernes 23.12.2011 / 07:23
llat dige estoi en guadalupe.con los esajeda. cuando quieren llegar aqui los esperamos bola de pendebos abladores.muertos de ambre.la linea .gobierno es nuestro. ganado el combate no bagan sus cuernos todos bien atentos por si ai qgalarle los uniformados escuchan disparos megor no se enredan saben que la plaza sige cutodiadapor LOS LINSES

clavo ( e-mail: )
Viernes 23.12.2011 / 04:50
AMI Y AL PRM SU COMANDANTE GATO SU PINCHE LINEA TORCIDA Y SUS PINCHES COCHADOS LOS AZTECAS NOS PELAN TODA LA VERGA PINCHES CULONES NO NO ESPERE A QUE EMPIESE EL ANO AQUI ANDAMOS EN JUARITOS NADAMAS SAQUE EL RAVO DEL ABUJERO EN QUE SE ESCONDE PA MANDARLO A LA VERGA PINCHE COCHADO Y ESTO ES PARA TODOS LOS COCHADOS DE LOS DEL CARTEL QUE SE ASEN LLAMAR DE JUAREZ ALA VERGA PICNCHES CHICANOS NOS LA PELAN PURO PRM PUTOS

( e-mail: )
Jueves 22.12.2011 / 14:50
aqui segimos chambiando con gusto.llegen al valle aora esa area es mi sucursal.para q se ubiken estoi en guadalupe.el L10.con el 17.GENTE D RESPETO chihuahua.CD.JUARES .LA LINEEAA.AZTEKAS.LOS F.UNION LOS Z´BELTRANES LEIVA.AI NOS ANDAMOS EN EL JALE__________

PRM ( e-mail: BORRACHOS )
Jueves 22.12.2011 / 02:51
ANIMO RAZA, ESOS PUTOS LINIEROS DAN LASTIMA PINCHES POQUITEROS D SE VENDEN X 100 PESOS, ES LO Q GANAN ESOS WEYES Y DICEN Q TRAEN CARRO.... SI TRAEN CARRO PERO D ELOTES JAJAJAJAJAJAJAJAJAJJA, NO PUTOS USTEDES NO LE LIBRAN YA PERDIERON TERRENO Y GENTE NO VALEN MADREEE. PURO PRM,AA,BLINDADOS Y TODOS LOS Q SI SAVEN CAMELLAR.

linces ( e-mail: )
Miércoles 21.12.2011 / 21:26
soi soldado lince andamos en el grangero trabajando. yoy mi comando les trabajamos en el arria de las torres.tumbando esclabos.chaparros.soi jent del 17.si biera comome encanta ver correr al enemigo.alcansarlo y matarrlo con mi 9 bereta o con micuerrnito.al pantion ai que mandarlos.sigan apollando al gn.y asi mismo segiran callendo atte,CDCJ.CHIHUAHUA.un saludito al comandante gatto..gobierrno chambiando guntos---------------------------------------------------------------------------------------------------

boxer ( e-mail: )
Miércoles 21.12.2011 / 19:46
mire pinche mocoso cholo no ande con sus M... yo soy de chihuahua capital P... ya te tengo ubicado a ti y a tus compas si quieres jalar ya no pongas tus M... aqui wey yo te buscare entrando el año

roger ( e-mail: )
Miércoles 21.12.2011 / 15:41
mira piche liniero de M... usted y sus pinches linces no controlan ni V... ustedes no sirven nadamas que para fertilizar tierra y si mucho mama a al culon de amado carrillo al rato lo mandamos a alla con el mejor no ande de osicon P... y amarrense los guevos y no anden con tanta M... de mantas x que lla se pasaron de peines pinche bola de culones y aqui andamos en todo nuetro juaritos x que nosotros de aui somos pinches chicanos de M... puro mexiclotes pinche cochado y saludos a todos los clanes aa bb prm blindados gn hay que seguirle poniedo la muetra a estos putitos pa que se les quite lo chavalonas a qui andamos patrullando la galeana

PRM ( e-mail: MEXICLES )
Miércoles 21.12.2011 / 06:14
PRM REVOLUCIONARIOS PRECENTES EN TODO EL PAIS MEXICANO,SENTROAMERICA Y ESTADOS UNIDOS. NOSOTROS FILES A MEXICO NO A PENDEJOS. PURO PRM.

( e-mail: )
Lunes 19.12.2011 / 17:28
la linea segimos en el mando.la linea esta recta.linces.comando armado protejidos por el gobierno.y por nuestro pawer.ban a la baja los enanos.bola d pendegos.y si no kieren crer chequen el mapa.estado de chihuahua.fiel a el SR.AMADO CARRILLO FUENTES.la linea________________________________________________________________________________________________________ nuca terminara

draw ( e-mail: MSF CUESTA LOKOS RIFA )
Lunes 19.12.2011 / 14:38
jaja calmate ´pinche boxer k me la pelas se mas k tu pelada wey pelada de todolo ktu quieras wey i si quiero jale para ganar una M... como tu P... q trabajas en maquilon pura V... jarocho estaras epndejo wey soi del paso tx wey coza k nunca seras tu de aya puedo movermerca de aqui dejaurez al paso tx cuando yo quiera tengo mas huevoz k tu wey pelada asi te lo digo P... quiero jale ya sea en laliea o donde sea neta dejense cai ala cuesta

PRM ( e-mail: BORRACHOS )
Lunes 19.12.2011 / 09:34
LA PRM SIGUE GANANDO TERRENO, BORRANDO LINEAS Y DESPLUMANDO APACHES.PURO PRM MEXICANOS 100%.EL GOLFO Y LA PRM PRECENTES.

lineros ( e-mail: )
Domingo 18.12.2011 / 18:57
la linea esta bien marcada asi ke no la traten de brincar jaja los prm lla murieros .mas bien nuca exisitieros pobres loncheros mediocres.segimos mobiendonos en nustras lineas quieren jale ai estamos jente del 17 en el granjero

BORRACHO CDG ( e-mail: )
Viernes 16.12.2011 / 16:40
PURO CARTEL DEL GOLFO Y PRM CONTROLANDO Y BORRANDO LINEAS. ANIMO GENTE Q EL TERRENO ESTA LIMPIO Y ES NUESTRO. PURO PRM Y CDG.

linerotes ( e-mail: )
Viernes 16.12.2011 / 15:58
pues la linea aqui segimos mas firmes que nuca carrtel de cd juares la linea, jent del jl y de los escajeda en el valle segimos rifando la linea

el perro ( e-mail: )
Jueves 15.12.2011 / 19:55
mira pinche draw cagado vas y H... as a tu madre culerito hijo de la V... eres un pinche mocoso cagado no vales V... si quieres jalar metete al maquilon que eso te queda muy bien pinche jarocho porque pa sicario te falta mucho cuando ves a la munucipal te surras que sera si te disparan otros cabrones soy el boxer de la_____

carla ( e-mail: carlaguerrero@yahoo.com.mx )
Miércoles 14.12.2011 / 13:27
te amo raul de parte de carla

PRM Y CDG ( e-mail: )
Lunes 12.12.2011 / 03:45
Q PUES CARNALES,EL GOLFO Y LA PRM PRECENTE TRABAJANDO Y LIMPIANDO PLAZAS. PURO PRM Y CDG.........

( e-mail: )
Sábado 10.12.2011 / 09:38
K CHINGADOS TRAEN PINCHESS UNIDOS PENDEJOOS MUERTOS DE AMBRE,SE CREEN BIEN FREGONES POR KK TIENEN UNA 22 DE UN TIRO Y ANDAN FUMANDO GUARUMOO JEJEJE CUANDO BIEN LESS BA PINCHESS CELESTINOOSS...JEJEJEJE SEGUN USTEDES MUI SAKALE PUNTA POR KK ANDAN DE GRAFITEROSSS JEJEJEJE ESO NO ES SER CHINGOON MOKOSOS LO CHINGONN SE DEMUESTRA CON ECHOOSS NO CON PENDEJADASS,...PINCHESS MOKOSOS PENDEJOSSS... SIN TANTO ROYO,... EL JARUDOOTE LOCOSS CONTROLA TODA LA PINCHE CUESSTA Y SUSS ALRREDEDORESS CHAVALASSS... PUROO JARUDOTE ASTA LA MUERTE PINCHE LAMBE GUEVOOOSS...!!! B J L ...

shagyOneR ( e-mail: )
Viernes 09.12.2011 / 15:29
k transa k transdas mis chavos barrio doble u efe uno de tierra nueva cocha jajajajajaja b*wf1

( e-mail: )
Jueves 08.12.2011 / 13:30
theeeDoooBleee A viiiveee

netzarel ( e-mail: marto@hotmail.com )
Martes 06.12.2011 / 13:19
la federacion manda matar o morir

kyfesillo0 ( e-mail: becede )
Lunes 05.12.2011 / 07:42
pinche bola de P... los jarudo y los de el 7 son re culos puro pinche msh bcd culeroos pinche bola de muertos de ambre no saven ni madre de la kalle y ya se kreen bn vergass P... puro meeseehere lokos diiecisiiete

EL DRAW DE LA MSF ( e-mail: )
Sábado 03.12.2011 / 10:37
quien sea pero quiero jale carnal vivo aqui atras del smar la cuesta mi roguer bajando la bajadita de atras del smar la cuesta enfrente de la papeleria en la cuadra k esta enfrente de la papeleria aii me junto o en el parque k esta enseguida del super six diganme si o no para jalar con alguien mas no me importa si me kebran o no simpre me la e rifado awevo

( e-mail: )
Viernes 02.12.2011 / 08:27
ESTOY D ACUERDO CON ROGER, ASI ES EL NEGOSIO. ANIMOOOOOOOOOO.

roger ( e-mail: )
Jueves 01.12.2011 / 14:54
mira llo te recomiendo el cartel se sinaloa rllos pagan bien y te ensenan todo sobre el negocio desde lo basico asta logistica los de la line estan contratando mucha jente pero es porque se las matan muy rapido unete al que tu quieras nadamas amrrate los guevos y acuerdate de la ley del oro si quieres llegar lejos en ete negocio a y de pasada que H... uen a su madre los linieros que quedan y sus lambe guevoz las trensudas ay les mandamos mas guaraches apestosos x que a los indios que los traian los pusimos a comer cal

sdfghj ( e-mail: )
Jueves 01.12.2011 / 10:37
tragen V... putitas )

LRT !!CREWS ( e-mail: )
Jueves 01.12.2011 / 07:22
LA LINEARTE CREWS GRARRFFIETROS :)

SALGADO ( e-mail: ALEXANDRO122@HOTMAIL.COM )
Miércoles 30.11.2011 / 12:39
K PASO ATODOS MIS ANGELITOS SALUDOS A TODOS HAY PORFAVOR DE REPORTARSE CON SU FIEN AMIGO AHI LES AMNDO MI CORREO OK...... SALUSITAAAAA,,,,,, Y SIGAN LA PARRANDA .

EL DRAW DE LA MSF ( e-mail: )
Miércoles 30.11.2011 / 11:38
si tuvieras power neta wey ya uvieras caido si quiseras mas jente netha pero creo k es puro rolo el tuyo

estiben ( e-mail: )
Miércoles 30.11.2011 / 11:31
si eres un entrado amarrate por q aii refuego con migo si bienes por la paz o se arma ese jale arres vamonoz pa arriva k este al 100 simon

estiben ( e-mail: )
Miércoles 30.11.2011 / 11:25
solo vengan voi andar con una zudadera de cuadros asi grande con una gorra y un goorro de la sudadera preguntale ala bola q ande aii por el draw o el estiben diganle k no es nada grave solo para k den informacion nunca e trabajado para nadien i aora solo quiero levantarme salir del ollo en el k me encuentro

( e-mail: )
Miércoles 30.11.2011 / 08:05
si c puede, todo es posible. pero como c llama la pandilla o el grupo q t respalda?? a q cartel conoces???

estiben ( e-mail: )
Lunes 28.11.2011 / 07:18
vivo aki atraz del smart la cuesta aii unos condominios pero vabajan la bajadita pasan los segundos edificios de los condominios acavandose aii una papeleria enfrente de eza papeleria me junto haora nadare aiii no tengo dinero para llamarles o ir con ustedes pero soy mui efectivo creci en el barrio desde los 6 años i sigo en el con mucha jente alado mio respaldandome y ya quiero empezar si se puede desde hoy como ven

( e-mail: )
Lunes 28.11.2011 / 06:34
si hay jale y feria tambien. dime d donde eres y si has andado en pandillas. y cuando quieres empesar. yo t mandare una direccion y numero d telefono.

estiben ( e-mail: )
Domingo 27.11.2011 / 12:05
alguien k me pueda dar jale en la mafia o donde sea en cualquier parte k sea quiero irme riquis no les fachare para ni madre neta contestenme si tienen neta

( e-mail: )
Sábado 26.11.2011 / 13:50
banda los escuby

SEROK ( e-mail: )
Viernes 25.11.2011 / 19:56
B NSK LOCOTES DE NORTE A NORTE LA RIFAN SERO WERO ONES DE LA GALEANOTA

xl feat big ben ( e-mail: )
Viernes 25.11.2011 / 19:40
KE ONDA PARSEROS DE COLOMBIA INFILTRADOS EN EL MOVIMIENTO ALTERADO JUAREZ NO TIENE NADA YA NO AY RESPETO NI POR LAS PARSES NI POR LAS BAINAS PINCHES CHINOS VALE VERGA ESTAN DE PASO LO UNICO PA LO KE SON VUENOS PARA CONSUMIR NUESTRA FIBRA TE Y LECHE EN POLVO AJAJAJA ARRIBA MAL VERDE Y EL DIVINO NIÑO KE NOS SIGUE ACIE NDO EL PARO AJAJAJA A SE ME OLVIDABA CONECTAME MAS CON LOS TRIAGOS KE SON LOS KE ENVERDAD MUEVEN EL PEDO AHY SALUDOS PA LOS MAÑOSOS DE LA COMPAÑIA DE COBRANZA DE PARTE DEL TEAM DE LA MANO CON OJOS ARRIBA DURANGO SINALOA JALISCO TAMAULIPAS TIJUANA GUATEMALA Y TODO CALIFAS DE PARTE DEL GENERAL XL Y EL TENIENTE BIG BEN

virrey ( e-mail: )
Miércoles 23.11.2011 / 15:14
fmc. el calset. uno

( e-mail: )
Viernes 18.11.2011 / 15:57
el barrio wfzotez controla by nefek monki kere y vallanse a la V... los entrados y si no le gusta H... e toda su P... madre

( e-mail: )
Jueves 17.11.2011 / 08:05
CUAL PUTOS AZCACAS???? ESOS SON CULOS. SON VERIJAASSS. JAJAJAJAJAJJA YA ME E SENTADO A MAS D 10 Y SON CULOS.

dormilon ,el sleepy ( e-mail: )
Miércoles 16.11.2011 / 21:25
sur up ese lokotes del chico trece del paso.tambien a todos los aztecas dandole al cien en juaritos ......

dormilon ( e-mail: )
Miércoles 16.11.2011 / 21:19
la V... putos northsiders lame wevos me lan pelado since god knows when puro varrio chico 13 memorial parke locotes .norte18 no traen nada son chapetes puñales del cereso todos savemos eso.ha ha

ivan ( e-mail: )
Lunes 14.11.2011 / 15:51
te amo kititos x siempre puro amor mamita .

( e-mail: )
Miércoles 09.11.2011 / 17:17
FMC

EL DEADER ( e-mail: el deader locochon )
Sábado 05.11.2011 / 08:02
K TRANSA AKI NOMAS DEJANDOLES Y RECORDANDOLES K TA NO ME MUERO PUTOS BY EL DEAD D LOS MSH LOCOTES PUTOS

fmc ( e-mail: CAMP. VIRREYES )
Lunes 24.10.2011 / 13:52
FMC TODAVIA SIGUE DE PIE. IN MEMORY OF CALSET.

tHe pinshe geNT ( e-mail: )
Viernes 21.10.2011 / 18:15
NO VALEN VERGA JARUDO LA NETHA PAQE LE ASEN AL VERGAS PINSHES SAHAVALAS CULEROS MAFIA UNIDA KATORCE MUKA!!! MADAFAKAS SF

( e-mail: )
Viernes 21.10.2011 / 06:53
el imperiote diez desde juarez nuevo 656 putos pa que aprendan y no anden de chavalas

( e-mail: )
Jueves 20.10.2011 / 08:41
LOS DEL SIETE HUELEN A MOJON

( e-mail: )
Jueves 20.10.2011 / 08:37
jarudo locos :D ALGO MAS QuE BARRIO

( e-mail: )
Jueves 20.10.2011 / 04:53
barrio imperio 10 rifa putos desde juarez nuevo

BJL ( e-mail: )
Lunes 17.10.2011 / 21:15
BJL jarudo lokotee LA B DE BARRIO LA J REPRESENTA EL VECINDARIO LA L D LO...LO..LOKOTES A DIARIO JARUDO TIENE LO NECESARIOO BARRIIOOO JARUDOOOTEE LOKOOO PUTOOOS

juaritoz ( e-mail: )
Martes 11.10.2011 / 08:42
y tu das lastima de ver la poca educasion q tienes,lavate el osico con clorox para q t quede limpio.demuestra lo que pareces no lo que realmente eres UN PERFECTO IDIOTA. vive y deja vivir a los demas, todos tenemos derecho a vivir como nos plasca NO COMO A TI TE GUSTE. el muro es libre y para todos. A ESTE STUPIDO NO LE HAGAN CASO ESTA FALTO D CARIÑO, COMO NADIE LO TOMA EN CUENTA. animooooooo gente a scribir,,,,,,.

te cocha ( e-mail: )
Lunes 10.10.2011 / 18:27
H... en a su P... madre C... tiran de amadre M... P... si muy sicarios no andubieran escribiendo M... y media muy aztecas,mexicle,aa vayanse ala V... mierdas y dise muro del grafity no del sicario bola de P... y el hijo de su P... madre k dise k jarudo me cayo en la punta de la V... el M... aber si cuando nos topemos ba a segir tirando tanto rollo y ba pa todos los diske sicario nacos pinches P... dan risa jajaja casi me meo de la risa leyendo sus pendejadas

jarudote ( e-mail: jarudote )
Sábado 01.10.2011 / 12:19
tambien recordando a los grandes ,el pancho,el toto,el gordo lokotes del jarudo

CDG ( e-mail: REVOLUCIONARIOS )
Viernes 30.09.2011 / 11:51
PURO CARTEL DEL GOLFO Y REVOLUCIONERIOS. VIVA EL MEXCAL.

2aa ( e-mail: 2aa )
Viernes 30.09.2011 / 05:51
cuerno y pechera para cuidarme y destrosar cumplo la orden del jefe torturo y mato 2aa

clavo ( e-mail: )
Martes 27.09.2011 / 13:41
mira pinche liandro este es un estado mexicle y tu y lo que queda de tu P... organizacion nos pelan la V... aora ya esta frontera pertenese a la nueva linea osea al cartel de sinaloa y no digas que los sinaloas te la pelan dile eso al perro de tu jefe vicente el chapo controla y controlara x siempre marrana hay esta tu respueta alos muertos de sinaloa mira quienes estan callendo siganle jugando al V... y sigan poniendose de apechito puro prm P... y puro juaritos lla ballan a esconderse al chuco de donde salieron pinche chicano de M... y aqui estamos y estaremos x simpre prm aa blindados jente nueva dorados bb paisas y todos los clanes 100 x siempre mexicanos

( e-mail: )
Jueves 22.09.2011 / 14:47
YEGO EL DREECK SOTE JAJAJJAJAAJ SALUDOS CANA A LA GENTE ANDAMOS AL MILLONSILLO YANO AY CONTRAS A ORA LES TOCA ALOS SINALOS DE MIERDA AYA EN SU PUTO RACHO CHAPUTOS BAMOS CON TODO DOBLADAS Y SUGENTE DISQUE NUEVA VALEN PARA PUTA BERGA ACUERDATE DE MI SO EL DREECK DE EL CDJ.AZTECAS V*B*T*13 SIENPRE FIRMES

ivan ( e-mail: )
Miércoles 21.09.2011 / 09:16
te amo kititos

omar ( e-mail: )
Martes 20.09.2011 / 13:25
PURO BUFONES RIP SOLDADOS CAIDOS EN BATALLA POR SIEMPRE SALVAKAR,ZARAGOZA EL VALLE DE JUAREZ Y LA SAN ANTONIO

( e-mail: )
Martes 20.09.2011 / 07:11
B.JARUDO.LOCOSS POR SIEMPRE PUTTOSS.... EL BARRIO MAS CHINGOON DE TODA LA CUESSTA.. DESCANZAZEN EN PAZ SOLDADOSS SLIKK,WWORT,PANCHOO..PRESENTESS ESTAN AKI EN EL BARRIO.. B J L

PRM ( e-mail: BORRACHOS )
Lunes 19.09.2011 / 03:57
UN SALUDO A TODOS LOS PRM REVOLUCIONARIOS Q ESTAN EN TODO MEXICO Y EU Y CHINGUEN A SU REPUTA MADREEEEEEE LOS AZCACAS Y QUIEN SE JUNTE CON ELLOS. Y SOY PRM PUTOOOOOOOOOOSSSSS....

sleepie ( e-mail: )
Domingo 18.09.2011 / 21:41
saludos a la gente azzteca. del varrio chico trece del chuco vct q-vo

( e-mail: )
Viernes 16.09.2011 / 07:58
fMC es uno de las clicas que hizcieron historia en juarez.

virrreyes´CAMPESTRE ( e-mail: fMC )
Jueves 15.09.2011 / 19:41
IN MEMORY OF CALSET´´´´ DEZCANSE EN PAZ HERMANILLO.

BORRACHO ( e-mail: PRM )
Jueves 15.09.2011 / 19:15
VIVAAAAAAA.... MEXICOOOOO.... Y VIVAAAAA... LA PRM.....

CAMPESTRE VIRREYES ( e-mail: FMc )
Miércoles 14.09.2011 / 13:41
EL FUSE: FMC:APAGADOTES.EN MEMORIA DE TODOS LOS QUE AN CAIDO.

( e-mail: )
Miércoles 14.09.2011 / 08:27
HUUUYYYY, Q MIEDOOOOO... SON MUY MALOS USTEDES. YA ME TRAUME D MIEDOOOOOO....JAJAJAJAJAJAJAJAJAJA

( e-mail: )
Lunes 12.09.2011 / 15:11
atorrenle perros atte LA LINEA DE JUAREZ AZTECAS A-A-A-A-A-A-A-+A+PURO MUERTITO AJAJAJAJAAJA SOY EL DREECK M

braulio ( e-mail: fanekerone@hotmail.com )
Lunes 12.09.2011 / 04:22
el fanekerone kiere un juarez en paz

bmx juarez ( e-mail: )
Jueves 08.09.2011 / 10:44
jovenes baikiando por calles

losny and trane ( e-mail: )
Jueves 08.09.2011 / 10:40
el losny y el trane kontrolando putos jajajajaja

by shagy ( e-mail: doble u efe uno )
Sábado 03.09.2011 / 05:55
k trampa k tampa mis chavos barrio wf1 detierra new cocha

juarez ( e-mail: )
Jueves 01.09.2011 / 15:26
putos que viva la vida loca

( e-mail: )
Jueves 01.09.2011 / 12:12
DRECK LOS COCHA AL MILLON CANA SOMOS DE LA CIL.INDEPENDENCIA

xhelazz ( e-mail: )
Jueves 01.09.2011 / 06:43
ia pinshez paiasos paresen viejas de mercado pongans a jalar pinshes traga deokis

jarudo lokos ( e-mail: bjl )
Martes 30.08.2011 / 11:27
jajaj sieteros abaladores !puro bla bla bala pues cuadno kieran aqii stamos firmes con el pawer de seimpre atte, jarudo lokotes

( e-mail: )
Lunes 29.08.2011 / 14:35
aja monica de donde soy el DREECK AL MILLON TRAS LOS LACRAS DE LOS DOBLADAS JIJIJIJII AZTECAS

monica ( e-mail: )
Jueves 25.08.2011 / 16:06
que onda chicos q transa con ustedes ailesva un saludito iun ve3sito para todos

barrio 7 ( e-mail: )
Jueves 25.08.2011 / 03:24
mire pinche jarudillo P... ustedes son los osikones todo mundo sabe q los pinches jarudos son bien abladores nomas ladran pero asta ahy no les da verguensa P... nosotros si les demostramos con echos ya no saben otra pinches P... JA JA JARUDO YA SE ACABO se cren intocables weyes pero se los estan H... ando ya se la saben abladores BARRIO 7 SE LAS COCHA sigan ladrando P...

( e-mail: )
Miércoles 24.08.2011 / 15:26
SALUDOS AL GATO DE EL DREECK AL MILLON V*B*T*13 AZTECAS AL MILLON

JARUDO ( e-mail: LOKOS )
Martes 23.08.2011 / 10:27
OITE 7TERO OSIKON NO MMES WE LLLA NI LA CHINGAN PENDEGOOS BIEN SABEN Q LOS Q LA RIFFAN EN LA CUESTA SON LOS JARUDO PARA Q SE ASEN PENDEGOS SI JARDUO SIFA PARA DONDE SE ASOMEN LSO 7 SON UNA BLOA DE PENDEGOS ROBA BISIS ..PINCHIS BOLA DE MUERTOS DE AMBRE NI PARA COMER TIENEN BIEN SABEN Q LOS JARUDO LOKOS SE LOS COCHAN Y SIEMPRE SRAS ASI JARUDOO LLA SE POSTULA PARWA PRESIDENTES BIEN SABE BJL SE LSO COCHA

nanei tu xikito stone ( e-mail: tu_xicome@hotmail.com )
Lunes 22.08.2011 / 17:10
el unicoo naenie l dripil

EL CHAPO ( e-mail: )
Sábado 20.08.2011 / 11:03
falta poco chamakitos para gobernar el mundo entero ia veran pollitos quien es mero padre.

crislaine ( e-mail: la_traviesa_0.23@hotmail.com )
Viernes 19.08.2011 / 10:16
mira mi face book es crislaine pausicles enviamelo hay ok mi mensaje es ( No preguntes por los caminos de la vida si no sabes caminar, ya que aunque te los muestren siempre estarás perdido.)

( e-mail: )
Jueves 18.08.2011 / 06:59
puro barrio 7 como les quedo el ojo pinches jarudos con el desmadre de anoche como siempre nos pelan la ver......ga ustedes ya no exsisten pues esstan callendo como moscas y nonca asen nada Pd.SEGUIMOS ESPERANDO SU VENGANSA PENDEJOS AVER CUANDO LES TUMBAMOS OTRO PINCHE CHAVALILLO NOS LA PÉLAN ATTE: BARRIO 7 SUS PADRES

( e-mail: )
Sábado 13.08.2011 / 11:05
SALUDOS A MI CAMARADA EL DREECK QUE ANDA AL MILLON DE ACA DE SU GENTE DE CHIHUAS CARTELOTE DE JUARITOS ESE SUREÑOS 13 Y AZTECAS DESMADRANDO DOBLADOS Y DAS AJAJAJJAJAAJAJ PERICKO

carlos mundo ( e-mail: juarez_style@hotmail.com )
Jueves 11.08.2011 / 09:10
H... ueen asu P... madree puñetas hijos de perraa pura pinchee lenguaaa idiotas

( e-mail: )
Lunes 08.08.2011 / 13:57
JAJJAJAA ME ASES REIR CON TUS COMENTARIOS PENDEJO PERRO TRAISIONERO ATTE CARTEL DE JUAREZ BIENE ALGO BUENO SINALOS Y GENTE DE EL CHAPUTO

EL CHAPO ( e-mail: )
Lunes 08.08.2011 / 01:57
calmados polluelos que de aca riva los sigo viendo.ustedes asu jale chavalones por un mexico mejor.

( e-mail: )
Sábado 06.08.2011 / 12:52
JAAJAAJAJA AL MILLON AZTECAS SALUDOS AL DREECK Y SU GENTE DE JUAREZ BUENGALE SE ABENTARON EN LA JUAN PABLO

( e-mail: )
Sábado 06.08.2011 / 06:30
ajjaja eres policholooo o q

PFP ( e-mail: )
Viernes 05.08.2011 / 17:05
PARA QUE SE ASEN MIS CHAVOS AL DIEGO LO PUISO SU MISMA GENTE X ESO DE LA ROPTURA ENTRE AZTECAS Y LINEA PREGUNTENLE A LOS DOS SICARIOS DE LOS AZTECAS QUE DETUVIMOS ASE ALGUNAS SEMANAS DE QUE NO ABLARON MEJOR NI JUEGUEN A LOS VANDIDOS Y ECARRILENSE X QUE LOS TENEMOS MAS INFILTRADOS Y EL PROBLEMA ES QUE NO SE GUARDAN NADA LLA NADAMAS LOS AGARRA UNO Y SE SUELTAN LLORANDO

( e-mail: )
Viernes 05.08.2011 / 12:31
mi compaa usted no mas abla por q tiene osicoo poes x esoo tenian comprados al director i alos custodios yo se q alos q mataron estvan el nuevo ingresoo no se P... compa.. io no abro por ablar

( e-mail: )
Jueves 04.08.2011 / 19:39
como se ban a matar los del mismo grupo si estaban en diferenrte seccion? no seas P... compa,no que muy sicarios,pues entrele a los putasos pues. el tal diego esta con la cola en las verijas temblando de miedo frente ala PFP pues noque muy sicario? y ahora sale con esa M... que nadie le cree.que los muertos eran del vando contrario.que no sea mamon y sacaton.yo por eso trabajo onrado y no ando con M... de esas.

( e-mail: )
Jueves 04.08.2011 / 12:58
jajaja poes mira el diario weii a sorry no saves leer... pero si tienes alguin q te lo lea mira el diario de ayer..jajajja

( e-mail: )
Miércoles 03.08.2011 / 16:18
SI DI?? Y QUIEN TE CREE ESA PENDEJADA??? FUERON PUTOS AZTECAS. RECONOCELO Y YA NO ENCEÑEN LO PENDEJO QUE SON.

( e-mail: )
Miércoles 03.08.2011 / 14:24
la riña del penal municipal que dejó 17 muertos fue entre propios integrantes de la organización que encabeza Joaquín “El Chapo” Guzmán jajajaja pobres P... se andan matando entre ellos....

MY * DREECK* V*B*T * 13 ( e-mail: BYG AZTECAS # 1 AZTLAN. )
Miércoles 03.08.2011 / 13:57
JAJAJAJAJA ME ASEN REIR TUS CONMENTARIOS PENMDEJOS OILO BIEN PERRO ESOS GUELLES NI CUENTA NI SON GENTE PERO BAN ATENER SU MERESIDO ACUERDATE DE MY DREECK CDJ

GENTE VIEN ( e-mail: )
Miércoles 03.08.2011 / 11:58
Haver mis sicarios, cuanto valoras tu vida y las de los demas, ustedes se estan matando por una plaza, y cuando la ganen que va a pasar, seguiran siendo unos gatos para sus patrones? o les van a repartir los millones que ellos ganan gracias a ustedes, en esta vida nomas se vive una vez, no la desperdicien de esa manera no sean titeres de los carteles, para ellos tu eres basura te matan o te encierran y hay mas gente jodida igual que tu que te remplazara, pero en fin, ponte a pensar tu futuro 1 ano mas, igual de pobre, muerto o en la carcel. hay siguele

PRM ( e-mail: )
Miércoles 03.08.2011 / 08:07
Tiene usted mucha razon,mis mas grandes respetos para usted.tristemente las cosas son como usted las dice espero que muchos de nosotros las entendamos y vivir ya sin tanto desmadre.

GENTE DE JUAREZ ( e-mail: )
Miércoles 03.08.2011 / 05:31
Haber bola de pendejetes, ni uno de los 2 carteles sirve para nada, ustedes se estan matando para darle la plaza a su patron que nunca en su pinche vida vana a conover "chapo" o "vicente", les pagan una miseria y cuando los matan ni quie se acuerde de ustedes o a caso sus patrones van a su funeral, para ellos todos ustedes son carne de canon, hante la sociedad dan lastima, hantes un narco ganaba miles de dolares trabajando solo, ahora ya nunca van a salir de jodidos con la miseria que les pagan, ni si quiera pueden ir a una barra y pistear a gusto y festejar un jale, les doy 2 anos de vida a cada uno de ustedes al seguir con cualquier pinche cartel, pero hay siganle desmadrando juarez y hay los veo todos los dias en el PM cuando acaben muertos y sus pobres hijos y esposas pidiendo limosna por que ya se les fue el Papa al infierno y no se diga de sus padres, consiguiendo dinero para poder enterrarlos, en esta vida se vive una sola vez y realmente vivez FeliZ, es la vida que siempre sona

PRM ( e-mail: REVOLUCIONARIOS )
Martes 02.08.2011 / 16:42
JIJIJIJIJI,CLARO Q ESTAMOS RESANDO.DESDE EL MARTES ESTAMOS RESANDO X EL NOVENARIO D LOS 17 MUERTITOS JIJIJIJIJIJIJIJI Q ?? USTEDES NO LES RESAN???? X Q??? FURON SUS CAMARADAS.ASI ES Q TODOS A RESAR JAJAJAJAJAJA JIJIJIJIJIJIJI JOJOJOJOJO JUJUJUJUJUJU.

MY * DREECK* V*B*T * 13 ( e-mail: BYG AZTECAS # 1 AZTLAN. )
Martes 02.08.2011 / 16:21
JAJJAAJ BIENE ALGO MAS NUEVO PONGANSE A RESAR JAJAJAJJAJAJ DRECKSOTE LOS COCHA SOMOS DE EL CARTEL DE JUARITOZZ AL 100000MIL

( e-mail: )
Martes 02.08.2011 / 10:04
BIEN VENIDOS JARUDOS,ME DA GUSTO SAVER Q ESTAN AL 100% USTEDES SON MUCHA PIEZA PARA ESOS PUTOS. REPRECENTEN MACHIN Y DEFIENDAN SU BARRIO. EN UNA SOLA NOCHE CALLERON 17 PANOCHUDOS, NO TRAEN NADA ESOS WEYES.

PRM ( e-mail: BORRACHOS )
Martes 02.08.2011 / 09:48
como vieron la fiesta en el penal??? estubo chida y para mala suerte ya agarraron al papa d los linieros y azcacas JAJAJAJAJAJAJA ahora si... QUIEN PODRA ALLUDARMEEE???? JAJAJAJAJAJAJA facil y con la izquierda les pusimos en su madre, solo las plumas q daron JAJAJAJAJAJAJA para q vean quien es LA PRM.

JARUDOLOKOS ( e-mail: )
Martes 02.08.2011 / 09:36
AI NOMAS DEJANDOLES SABER QUE ESTAMOS REGRESANDO TODA LA BOLA DE ANTES POR SI QUIEREN IRNOS A VISITAR PUTOS APOCO PENSABAN QUE POR QUE NOS TUMBARONA VARIOS CARNALES NOS ACABARIAN NOS HICIERON AGARRARNOS MAS DE HUEVOS AI ESTAMOS JARUDO LOKOS

( e-mail: )
Martes 02.08.2011 / 05:48
pues gracias y el que se debe de cuidar es usted ya que los osicones no duran mucho.y tenga cuidado con las trocas sospechosas y trucha con su familia porque despues de este mensj sierto o falso se lo va a cargar su P... madre.

el fovia ( e-mail: )
Lunes 01.08.2011 / 17:19
mns para el drekk de los azt guache drek aora hoy un royo que los aa y los mx los estan esperando pero les ban a poner una trampa les ban a poner mucha jente para que maten pero son carnada x que lo que hoy fue que ubo una junta con el gobierno para acabarlos de una ves pero segun esto todo lo estan planiando los del gob para exterminarlos pues ya todo esta preparado segun escuche y el bato este dise que les ban a aser el 123 al tiro disculpe que se lo diga x este medio pero no alle otr manera cuidense y adios

juaritoz ( e-mail: )
Lunes 01.08.2011 / 16:35
JAJAJAJAJAJAJA SI VERDAD.... QUE CULOS SON.TANTO QUE DEJAN A SU GENTE SOLA PARA QUE LES PARTAN SU MADRE Y COMO ESTAN DE LASTIMAS ANDAN DE GATOS GANANDO 100 DOLARES COLGANDO MANTAS.JAJAJAJAJAJAJAJA QUE CULOS SON.JIJIJIJIJIJIJIJIJI.....

pericko ( e-mail: WWW.ASIENDO GENTE.COM )
Lunes 01.08.2011 / 11:57
ISI JAJAJJAJA SON CULONES LOS PRM Y AA

MR HUKLA ( e-mail: 45 KING )
Domingo 31.07.2011 / 13:35
SON CULONES LOS PRM

PRM ( e-mail: REVOLUCIONARIOS )
Domingo 31.07.2011 / 06:51
PUES NO Q NO CULOS??ENTONCES D QUIEN SON LOS MUERTITOS??JAJAJAJAJA LES DIGO Q USTEDES SON TAN JOTOLONES Q A SU MISMA GENTE LA HACEN MENOS,X ESO TIENEN Q ANDAR D GATOS D LOS LINIEROS X Q DEJAN MORIR A SU MISMA GENTE.X ESO Y MUCHO MAS DAN LASTIMA Y HASTA X 100 DOLARES SE VENDEN.ESO ES NO VALER MADRE. VIVA MEXICOOOOO Y VIVA LA PRM PRM Y PRM ( CDS )

FRUTERO ( e-mail: juaritoz )
Sábado 30.07.2011 / 12:28
a caray,pues si que andan recio.y si se quedan sin trabajo yo ya les avia dicho,yo les doy trabajo vendiendo fruta y ya dejence de P... y hagamos algo por juarez.se los dice un humilde frutero que vive muy feliz con respeto se los digo.

PRM ( e-mail: MEXICLES )
Sábado 30.07.2011 / 11:14
pues cual plaza?? si ya la plaza es d CDS PRM, y eso solo es una pequeña muestra.VIVA MEXICOOOOOO.... VIVA LA PRM..............¡¡¡!!!

EL JUARENSE ( e-mail: )
Sábado 30.07.2011 / 09:03
IIIIIIIIIIII CONFIRMADOTE Q LOS MUERTITOS ERAN AZTEKS, PONGANSE LAS PILAS KBRONES XQ LOS BAN A DEJAR SIN PLAZA.

( e-mail: )
Viernes 29.07.2011 / 19:32
jajja a ver ese de los AA dond stan los dms segun el paus y el fhat q era de jarudo... a orasi q salga para toparnos ... culosssss

( e-mail: )
Viernes 29.07.2011 / 19:21
poes iia no ai o esta descuartizados i los mataron como el carlos elm joto del jarudoo por ayaudar al fhat o alos de aa jajajajajajjaaj

( e-mail: )
Viernes 29.07.2011 / 18:28
dond stan los AA andaban buscando soin de jarudoo

( e-mail: )
Viernes 29.07.2011 / 18:02
jajaja wei si wei poes si aa andan abrigando alos jotos q atrabajen para ellos como estara el pedoo ajjaaja q le paso al q mataorn en jardo asie pcoo jaja

MR HUKLA ( e-mail: 45 KING )
Viernes 29.07.2011 / 16:09
SON CULOS LOS AA Y LOS MEXICLES Y CDS BAN PERDIENDO CHCHCHCHCHC GACHO KE NO PRMS MEXIDE JUARITOZ 45

juaritoz ( e-mail: )
Viernes 29.07.2011 / 15:36
pues yo tengo entendido que los muertos fueron de los aztecas y de la tal linea. y un prm o mexicles yo tengo un primo en el penal y me conto el rrollo. ahi con respeto sin ofender a nadie.

( e-mail: )
Viernes 29.07.2011 / 13:44
EE YA DEJENSE DE MAMADAS Y DIGAN DE CUAL GRUPO FUERON LOS MUERTOS DEL CERESO, XQ PARECEN NIÑAS CON Q SON MIOS NO QE MIOS YA DIGAN LA NETA.

PRM ( e-mail: MEXICLES )
Viernes 29.07.2011 / 10:57
eso es todoooooo... la plaza es nuestra y un saludo con mucho respeto a los AA. puro PRM y no ganamos 100 dolares.jajajajajajaja

2AA ( e-mail: 2AA )
Viernes 29.07.2011 / 07:29
2AA CONTROLANDO Y GANANDO PLASA

PRM ( e-mail: BORRACHOS )
Viernes 29.07.2011 / 07:12
Ya leyeron el menj d abajo stupidos?? haganle caso a ese mensj y no c metan con CDS PRM,x q les volvemos a partir su P... madreeee... puro PRM y AA CDS. o quieren mas desplumados?? jajajajajajaja.

amigo ( e-mail: )
Jueves 28.07.2011 / 19:03
miren chavos esto yo se que en estos momentos estan llenos de odio pero lo que asen es destruir juarez y austedes mismos x que ayer fueron de un bando los muertos aora de otro pero esto ya esta muy bisto recapasitren que es en bano es el diablo el que los manipula para caer en estos juegos pero detras de todo es el quien muebe los ylos detras de cualquier nascara sea el cartel o la pandilla ojala despierten antes de que sea muy tarde mejor si quieren pelear que sea x sacar a nuestra ciudad adelante ojala y puedan areglar sus diferiencias y ayga los lideres con sufisientes y poder para areglar esto llo se que lla a abido muertos pero es mejor enterrar a los muertos y no seguir peliando x acabarnos

( e-mail: )
Jueves 28.07.2011 / 16:27
pues ya c esta biendo.no seas pendejo,bueno eso ya es d nacimiento PAREJITA D a 100.JAJAJAJAJAJAJA PURO CDL PRM. SOLO LAS PLUMAS QUEDARON JAJAJAJAJAJAJA

( e-mail: )
Jueves 28.07.2011 / 14:59
tiene toda la razon parejita pero este chaputo culoo solo abla por ablar al rato veremos qien es qien

MR HUKLA ( e-mail: 45 KING )
Jueves 28.07.2011 / 14:15
JAJAJJAAJAJ PUES QUE LE ESTA PASANDO AL CARTEL DE SINALOA EN SU PROPIO TERRENO LES ESTAN DANDO EN LA MADRE JAJAJAJA

( e-mail: )
Jueves 28.07.2011 / 14:05
JAJAJAJAJA PINCHE STUPIDO NO SAVES NI QUE PEDO SOLO SAVES DECIR PENDEJADAS SOLO DECES IDIOTECES,SOLO LADRAS PORQUE TIENES OSICO. Y NO ACEPTAS LA VERDAD,LES PARTIMOS SU PUTA MADRE Y NO GANAMOS 100 DOLARES JAJAJAJAJAJAJA

( e-mail: )
Jueves 28.07.2011 / 12:57
jajajaja piche chavo pondejo neta no saves lo q dises no saves lo q dises solo ablas por q tienes boca y eso [por q lo ves en las noticias pero no saves ni q pedoo mi compaa.. neta

PRM ( e-mail: REVOLUCIONARIOS )
Miércoles 27.07.2011 / 17:59
AJAJAJA,BOLA D PENDEJOS.17 MENOS SOLO Q DO EL PURO PLUMAJE,17 GUAJOLOTAS Y GALLINAS FUERON DESPLUMADAS.MUY BUEN JALE CARNELES LOS FELICITO,COMO SIEMPRE HICIERON BUEN JALE.PURO PRM Y AA. Y NO GANAMOS 100 DOLARES.JAJAJAJAJAJAJAJA..... Y YA SAVEN PURO CARTEL CDS.

( e-mail: )
Miércoles 27.07.2011 / 15:42
un saludo para el spooki y smyle q estan en el cherri de parte de la gente del barrio q esten pasando tiempo chido i echenle ganas el michel

pericko ( e-mail: BYG AZTECAS # 1 )
Miércoles 27.07.2011 / 14:03
JAJAJAJAJ PAR DE PENDEJOS QURE ENSELA JAJAJA PARA QUE GUACHEN PUTOS SOMOS LOS AZTECAS CONTROLANDO EL CERE PERICOTE PAYASO DREECKSOTE GASELA CHINO BORRE JAJAJA SIGANLE PONIENDO SUS MENSAJITOS PENDEJO PERROS MUERTOS DE AMRE AY ESTAN LOS DOBLADOS AJAJJAAJAJ 17 MENOS ESTA CONPROBADO CHIDO MI RISAS SEDEJO CAER LAGREYA SALUDOS DE SU CARNALEL PERICKOTE ANDAMOS AL 10000 NO AGAN CASO ALAS NIÑAS EN ESTE PUTO MURO SON PURAS NIÑAS GENTE SIGAMOS ACABANDO CON LOS PUTOS NIÑOS DE LOS AA Y GENTE DEL CHAPUTO JUAREZ ES NUESTRO AZTECAS SOMOS DEL EL CARTEL DE JUAREZ

PRM ( e-mail: MEXICLES )
Miércoles 27.07.2011 / 09:56
Q les parecio la fiesta en el penal???? pinches panochudos,ustedes son panochas d a 100 JAJAJAJAJAJAJA NI PAL ARRANQUE NOS SIRVIERON JAJAJAJA. PURO PRM... PRM Y AA SOMOS LOS MAS CHINGONESSSSSSSSSSS... ahha. y no ganamos 100 dolares JAJAJAJAJAJAJA....

PRM ( e-mail: REVOLUCIONARIOS )
Lunes 25.07.2011 / 17:00
Huuuuyyyyyy,jajajajajaja,huuuuuuyyyyyyy jajajajajajaajajajaja.mejor yo t pago los 100 dolares, yo t los pago para Q BALLAS A CHINGAR A TU PUTA MADREEEEEEEEEEEE..........JAJAJAJAJAJAJAJAJAJAJA

pericko ( e-mail: DE LA COL.SANTA MARIA )
Lunes 25.07.2011 / 16:00
Biendicho carnal par de putos si asison parteputos aaa es que se cren sicarios de la gente de el chaputo Traisionero par de mayates mejor cudense culones salgale al tope

PRM ( e-mail: AA )
Domingo 24.07.2011 / 18:03
BIEN DICHO CARNAL,Y TODO MACHIN A SEGUIR CAMELLANDO.ME SALUDA A TODOS LOS HOMEBOYS.

clavo ( e-mail: )
Domingo 24.07.2011 / 17:34
mire mi dreck le recomiendo que mire la pelicula el principio del fin x que es lo que su organizacion representa y me recuerdan a un serio de este tiempo hay te miro sapo y acurdate a qui con clavo y el prm te sientas x que no sotros no somos una pinche linea somos una cadena puro prm y blindados aa y a todo el clan

PRM ( e-mail: BORRACHOS )
Domingo 24.07.2011 / 16:36
ESTOS SON PUROS JOTOLONES CARNAL YO LOS ESTUBE ESPERANDO EN EL VAQUERO Y NUNCA LLEGARON.BUS COMO?? SI SON BIEN CULOS.Q NO LES PAGAN 100? PENDEJO ESO LES PAGAN X PONER MANTAS PINCHES MENDIGOS PORDIOSEROS,Y LUEGO CHILLANDOLE A CALDERON PARA Q YA NO LE ALLUDE ALA GENTE DEL CHAPO.PUTOS VERIJONES LINIEROS CON LA PRM SE SIENTAN WEYES-

clavo ( e-mail: )
Domingo 24.07.2011 / 16:14
jajajaja que les paso u tus carnales en paral hay me saludas al morado jajajajaja y si agarra bandera de juarez pero tus hilos bienen de las pinches trensudas del chucko me das risa marrano y tu jente tambien los esta bendiendo por que crees que se les estan callendo todos los jales y callendo los de ariiba y cmo dise mi carnal pidan chichi con quien quieran que a nosotros tambien nos respaldan los de ariba y puro mexico sombis

MY * DREECK* V*B*T * 13 ( e-mail: BYG AZTECAS # 1 AZTLAN. )
Domingo 24.07.2011 / 14:52
{{{{{{{{ AJAJAJAJAJAJAJAAJAJAAJAJA JAJAJ A ME ASERN REIR PEDASOS DE MIERDAS SIGAN ABLANDO PINCHES TRAISIONEROS DE MIERDAS MORDIERON LA MANO QUE LES A DADO DE COMER ASUS PADRES Y A SUS FAMILIAS PINCHES MOCOSOS DE MIERDAS TRAISIONEROS TRAISIONAR AL °°°°°°CARTEL DE JUAREZ °°°°°° LESBA A SALIR CARO PERROS CHAPUTOS Y NO BENIMOS A INBADIR NIMADRE PINCHE CLAVO DE MIERDA SOMOS NATIVOS DE CD .JUAREZ Y RESPALDAMOS ALAGENTE DE A QUI NO SOMOS TRAISIONEROS COMO USTEDES Y SE DEJAN ENGALLAR DE POR LA GENTE DE EL CHAPUTO ABER CUANDO ACABEMOS CON USTEDES Y LOS TENGAMOS BIEN ENPINADOS RENUNSIAN JAJAJAJAJCOMO LLA SABEN EMOS ACABADO CON SU GENTESILLA PONGANSE AL TIRO Y ABRAN LOS HOJOS POR QUE LOS BAMOS A TUNBAR COMO AN BISTO EL FLACO LLA ANDA CON NOSOTROS Y ANDA SOLTANDO LA SOPITA NO SON NADA PARA NOSOTROS A Y NO NOS PAGAN 100 PENDEJON JAAJAJAJAJ SIGE DE ABLADOR PERRO YA SABES QUIEN SOI BUSCAME SI ERES TAN CHINGON ANDO POR CARLOS AMAYA Y LAS TORRES A Y TU GENTE DE EL CERESO SELOS ESTAN COJIENDO MI G

PRM ( e-mail: BORRACHOS )
Domingo 24.07.2011 / 11:49
AHUEVOOOOO...CARNAL,LA PRM SIGUE DEPLUMANDO AZCACAS Y BORRANDO LINEAS Y NOSOTROS NO PAGAMOS 100 DOLARES JAJAJAJAJAJAJA PURO PRM Y CARTEL CAMELLANDO MACHIN.LOS OTROS SON OJETES.

clavo ( e-mail: )
Domingo 24.07.2011 / 10:23
mire mi drekk nos pelaron la V... al principio y nos ban a pelar la V... x siempre sigan agarrados de la V... de los linieros x que aber si de los dos se ase uno mi jente sigue al 100 y casando marranos lla lajente se esta dando cuenta de lo basura que son y cada dia mas jente despierta a la revolucion y acabaremos con tu pinche jente que a benido a invadir mexico telo prometo marrano yo y mi jente estamos al 1000 con el prm x que soy de juarez y mi jente es de juarez y yo si camello como se debe camellar x que mi jente si sabe como se debe correr el jale x eso seguimos presentes saludos y respetos paro todos los borrachos y sus cantineros y a camellar que esto es asta acabar contodos los marranos

( e-mail: )
Domingo 24.07.2011 / 09:02
ooo entoces los prm son chaputos o q

( e-mail: )
Sábado 23.07.2011 / 18:50
y con quien anda jalando gamaliel?? para cual grupo trabaja??

( e-mail: )
Sábado 23.07.2011 / 17:40
gamaliel hernandez vive en 730 san enrrique colonia santa magdalena tiene un carro probe negro y uno todo despintado rojo con gris contactalo en facebook como gamaliel hernandes, y avisale de esto! gacias

( e-mail: )
Sábado 23.07.2011 / 17:21
jaime gamaliel hernandes es amigo del extorcionador apodado el jarocho de los que acaban de torcer , y tanbien tienee que ber con crimen organizado! encuentralo en facebook como gamaliel hernandez su foto es el logo de heroes del silencio

pericko ( e-mail: Aztecas de la col.santa maria 13 )
Miércoles 20.07.2011 / 17:19
siges de tira royo P... dime donde nos bemos pinche marica tu y tugente no son nada jajjajaja ya sabes quien te cochala___________________

PRM ( e-mail: BORRACHOS )
Miércoles 20.07.2011 / 16:15
HUUUYYYY Q MIEDOOOOO...MEJOR BALLANCE A JUGAR MAQUINITAS O YA C SIENTEN NARCOS MAFIOSOS?? CUNTO LES PAGAN 20 DOLARES???JAJAJAJAJAJAJAJAJAJAJA PURO PRM Y NO GANAMOS 100 DOLARES !!!!!!!!!!! JAJAJAJAJAJAJAJA

pericko ( e-mail: Aztecas de la col.santa maria 13 )
Miércoles 20.07.2011 / 15:15
pinches revulusionarios ni se oye de ustedes puro pinche rollo pinches mocosos pongase aser otra cosa de estar todo el dia en el pinche internet nosotros apollamos al CARTEL DE JUAREZ para que sepan cuando quieran caigale al BARRIO PARA PARTIRNOS LA MADRE HPS 3 COL.SANTA MARIA SOY EL GASELA PUTOS Y ANDO CON LOS DE LA LINEA AL MILLON ACABADO CON LOS PINCHES MOCOSOS DE LOS MEXICLES DE MIERDAS -_____________________________AL MILLON MI DREECK

PRM ( e-mail: BORRACHOS )
Martes 19.07.2011 / 16:55
Quien pregunta y para q?????

( e-mail: )
Martes 19.07.2011 / 11:17
eiiii q es prm

PRM ( e-mail: REVOLUCIONARIOS )
Lunes 18.07.2011 / 14:06
Huuuyyyy q miedoooo. mejor deme jale aun q me pagues 100 dolares o le suplico a calderon para q me allude con la gente del chapo???JAJAJAJAJAJAJAJAJA mejor aceptale el jale al tal frutero. y yo soy EL PIRATA MORGAN Y DEL PUENTE ROTO.JAJAJAJAJJAJAJA.... puro PRM y nosotros no pagamos 100 dolares. pinches mendigoooosss jajajajajajajaja LA PRM CHAMBENDO MACHIN.

PRM ( e-mail: REVOLUCIONARIOS )
Lunes 18.07.2011 / 14:02
Huuuyyyy q miedoooo. mejor deme jale aun q me pagues 100 dolares o le suplico a calderon para q me allude con la gente del chapo???JAJAJAJAJAJAJAJAJA mejor aceptale el jale al tal frutero. y yo soy EL PIRATA MORGAN Y DEL PUENTE ROTO.JAJAJAJAJJAJAJA.... puro PRM y nosotros no pagamos 100 dolares. pinches mendigoooosss jajajajajajajaja

PRM ( e-mail: REVOLUCIONARIOS )
Lunes 18.07.2011 / 14:02
Huuuyyyy q miedoooo. mejor deme jale aun q me pagues 100 dolares o le suplico a calderon para q me allude con la gente del chapo???JAJAJAJAJAJAJAJAJA mejor aceptale el jale al tal frutero. y yo soy EL PIRATA MORGAN Y DEL PUENTE ROTO.JAJAJAJAJJAJAJA.... puro PRM y nosotros no pagamos 100 dolares. pinches mendigoooosss jajajajajajajaja

PIRATA DE EL PUENTE NEGRO ( e-mail: DE LA COL.SANTA MARIA )
Lunes 18.07.2011 / 12:46
jajaajjaajaj PINCHE MARANOS SIGAN ESTORSIONADO ALA GENTE COMO ATUS PINCHES MOCOSOS DE MIERDAS MEXICLAS DE MIERDAS SELOS BA ACARGAR LA BERGA PINCHES REVULUSIONARIOS PENDEJOS NI SABEN COMO CORE EL AGUA A QUI EN JUARITOS SALUDOS A TODOS LOS R

( e-mail: )
Lunes 18.07.2011 / 08:02
wawawaawa,sr.calderon ya no podemos con la gente del chapo porfavor alludenos sr.precidente necesitamos que hable con la gente del chapo para que nos deje trabajar porque nos estamos muriendo de ambre porfavor sr.precidente calderon mire ya estamos llorando WAWAWAWAWAWAWAWAWAAAAAAAA !!!!!!!!!!!!!!!!!!!!

EL FRUTERO ( e-mail: JUARITOZ )
Domingo 17.07.2011 / 16:12
yo lo adopto y le doy trabajo para que lla no ande de bago causando lastimas y pasando ambre.

PRM ( e-mail: REVOLUCIONARIO )
Domingo 17.07.2011 / 15:41
si,un mendigo que se vende por pinches cien dolares jajajajajajajaja ya ni para tragar tienen. mejor dile al tal frutero que te de jale ajajajajajajaja saves quien soy?? soy PRM quien se cojio a tu madre porque soy tu PADREEEEEEEEEEEEEE. JAJAJAJAJAJAJAJAJA.

MY * DREECK* V*B*T * 13 ( e-mail: BYG AZTECAS # 1 AZTLAN. )
Domingo 17.07.2011 / 14:29
AJAJJAJAJAJJAAJ ME ASES REIR PEDASO DE MIERDA YA SABES QUIEN SOY PERRO TU MATON EL QUE SE ESTUBO COJIENDO A TU CARNALA LA NOCHE QUE MATAMOS ATU GENTESILLA JAJJAJAJAAJ ATTE EL CARTEL DE JUJAREZ ________________________--AZTECAS Y ULTIMA LETRA.. ESTAMOS TRAS TUS PASOS PUTOS MEXICLAS DE MIERDA YA SABES QUEN SOY AJJAJAJAJAJJAJA EN BESTIGA BIEN CON TU FAMILIA DREECKSOTE AZTECAS #1

PRM ( e-mail: BORRACHO )
Domingo 17.07.2011 / 11:41
QUE PUES CARNAL CLAVO,TODO MACHIN Y SALUDEME A TODO BORRACHO MEXCALERO Y MIS ADMIRACIONES PARA TODOS USTEDES QUE ANDAN CHAMBEANDO RECIO.Y HAY ME MANTIENE INFORMADO SOBRE LAS SQUINAS Y DIGALES QUE LA FERIA Y LAS TROCAS SE GOSAN PERO CUESTAN Y LA BOTELLA MAS.YO ANDO EN GUANAJUATO PERO TODO BIEN SALUDOS CARNAL.CON RESPETO PRM TIGRE CONSAGRADO.

clavo ( e-mail: )
Domingo 17.07.2011 / 08:05
saludos y respetos carnal de parte de los carnales que transa carnalito que a pasado en juaritos benimos bajando de parral los carnales isieron unos acomodos alla y andabamos dando esquina pero aqui estamos al 100 aqui sigue cresiendo la famili aunque ay otros cabesones que andan de bacaciones x la famili pero estan al 100 aqui bamos a calar a los esquinas que ba a ber que aser barios jales pendientes x que hay mucho jale que aser

BORRACHO ( e-mail: PRM )
Sábado 16.07.2011 / 04:12
REVOLUCIONARIO 713,que pues carnal? a q se refiere con su comentario????? con respeto Tigre Consagrado.

Revolucionista 713 ( e-mail: )
Viernes 15.07.2011 / 20:10
Nombre les digo aqui estoy wachando todo este rollo.... tantos reglas que se han quiebrado con tantas faltas de respeto lo que paso paso yo estuve entre el desmadre en varias prisiones ya que muera hay!!! Para todos los borrachos aqui? portasen bien carnales no estamos para entretener el publico nos nuestra onda

JARUDOLOKOOSS..!! ( e-mail: JARUDOTEE..!! )
Viernes 15.07.2011 / 06:38
NO CARNAL ESA MORRA NO ES JARUDO ES UNA MOCOSA DE 13 AÑOS,, SON MORRAS QUE NOMAS HABLAN..! EN EL JARUDO NO TENEMOS MORRAS AQUI PURO VATO QUE LE SALTA Y QUE DA LA VIDA POR EL BARRIO UNA MORRA NO DA NI MADRES POR EL BARRIO AY ESTAMOS GENTE

EL FRUTERO ( e-mail: JUARITOZ )
Jueves 14.07.2011 / 17:34
jarudos hay con respeto la morra rocio sigue con ustedes? yo coloreo a algunos jarudos y son chidos y tambien coloreo ala rocio pero no se si aun es jarudo.

MY * DREECK* V*B*T * 13 ( e-mail: WWW.ASIENDO GENTE.COM )
Jueves 14.07.2011 / 13:38
EL DRECK DE LA COL, INDEPENDENCIA SALUDOS A TODA LA GENTE QUE LE SALE POR JUARITOS ATTTE EL DREECK DE ACA DE EL CERE YE GO LA BAREDORA CHIDO DERATIÑO LOS GUACHO BAMOS A TIRAR CRUSIN POR LA COL.SANTA MARIA Y SAN ANTONIO

JARUDOTES..!! ( e-mail: JARUDOLOKOOSSS..!! )
Jueves 14.07.2011 / 09:53
JAJAJA NO MAME CANA EL DE ABAJO LOS DEMONIOS NO BALEN VERGAA SON PINCHIS MOKOSOS ROÑOSOS QUE NO LE SALTAN , Y LOS AA TAMBIEN SON CULOS..!! ESE ERA UN PINCHI BARRIO NORMAL SOLO QUE LO COMPRARON NOSOTROS LOS HACEMOS DE AGUA A NOSOTROS NOS HAN QUERIDO COMPRAR PERO ESOS ROLLO NO VALEN VERGAA,,LOS AA SON CULOS Y LOS DEMONIOS TAMBIEN JARUDOTELOKOS UN SALUDO A LOS HOMIES DEL CERESO QUE SON DE LOS MAS CABRONES AHY ADENTRO ARRE CANAS BJL

FRUTERO ( e-mail: JUARITOZ )
Jueves 14.07.2011 / 09:08
YO LES PAGO 150 DOLARES SI ME ALLUDAN A VENDER FRUTA Y YA DEJEN DE DAR LASTIMA.JAJAJAJAJAJAJAJAJA

MY * DREECK* ( e-mail: BYG AZTECAS # 1 )
Miércoles 13.07.2011 / 14:15
''''''''''''ATENSION SIGAN DE CHAPULINES PIRATAS JAJAJAJAJAJA COMO LES FUE PRM AA CON SU GENTESILLA JAJAJAJAJ SIGIMOS DEESMADRANDOLOS YA SABEN QUIEN SOY COTROLO LOS CERESOS SOY EL DREECK COCHON JAJAJAJ SIGAN ESTORSIONANDO PERROS QUE LES BAMOS A MOCHAR LOS HUEVOS MARANOS ATTE.__________________________________________________________________- Y LA ULTIMA LETRA CARTEL DE JUAREZ SOMOS LOS DUEÑOS SIGALE Y NOSOTROS EJECUTANDO DREECK V*B*T*13

( e-mail: )
Miércoles 13.07.2011 / 10:00
que mendigos y muertos de ambre estan estos narquillos de los aztacas trabajan y son achichincles de la linea y por 100 pinches dolares son gatos de estos weyes linieros.yo vendo fruta y gano 150 dolares y no ando con M... que soy narco y menos que soy gato de alguien.yo trabajo solo.estos weyes solo dan lastima y risa.

( e-mail: )
Miércoles 13.07.2011 / 06:51
pero los AA son compañeros de los PRM.y esos tambien son gachos.

( e-mail: )
Martes 12.07.2011 / 17:10
LOS DEMONIOS Y LOS AA ME PELAN LA VERGAA... SON UNA BOLA DE MARRANOS Q ANDA SECUTRANDOO Y MATANDO AGENTE INOCENTEE ELLOS FUERON LOS Q ALOS CHAVOS DE NUKOL PAOS FAHT

( e-mail: )
Martes 12.07.2011 / 16:52
culoss

NO ALA VIOLENCIA ( e-mail: )
Martes 12.07.2011 / 11:44
si hay que terminar con estas lacras que solo ensucian cd juarez y todo mexico.juntos la policia y el pueblo bamos a terminar con estas bacterias de aztecas linias y todas esas pandillas mediocres que solo dan lastima y felicidades por esos 240 años.cd juarez necesita vivir en paz.

JUARITOZ ( e-mail: LIBRE )
Martes 12.07.2011 / 10:03
240 AÑOS D PRICION LES DIERON A LOS COBARDES DE LA PANDILLA MUGROSA DE LOS AZTECAS POR MATAR GENTE INOCENTE. AVER CUANDO SALEN ESOS MUGROSOS DELINCUENTES JAJAJAJAJJA NO QUE MUY VALIENTES ESTABAN CASI LLORANDO POR SU CONDENA.LA LINIA Y LOS AZTECAS SON COBARDES,LADRONES Y SIN VALOR.YO EVISTO GRUPOS CRIMINALES QUE AUNQUE HACEN SUS TONTERIAS NO SE PONEN A LLORAR Y ESTOS COBARDES SI. NO SON TAN VALIENTES JAJAJAJAJAJA YA MERO SALEN POBRESITOS SOLO SON 240 AÑOS.POR UN CD.JUAREZ SIN VIOLENCIA.

MIDRECK ME COCHA ( e-mail: SOY TU BERDUGON )
Lunes 11.07.2011 / 12:07
SIGES DE A FERADO PIRATA TE BEO DONDFE QUIERAS PARA PARTIRNOS LA MADRE COMO BES EN EL RICHI ATTE TU MATON EL DREECK COCHON AZTECAS SURENOS 13

BORRACHOS ( e-mail: PRM MEXICLES )
Viernes 08.07.2011 / 12:46
que casualidad.nosotros solo eramos 5,2 en la puerta,1 en las mesas,1 en el estacionamiento y yo en la barra. que casualidad que no nosvieron.jajajajajaja.dejen de hacerle al wey. son culos y comprobado esta. bueno ya no tengo tiempo de tirar rollo con perdedores como ustedes.me boy hacer villetes hay los dejo por un rato.puro PRM .....

sami ( e-mail: MENSAJE PARA MIS CAMARADAS LOS AZTECAS )
Viernes 08.07.2011 / 11:52
que rollo con los prm puro royo de esos putos yo fui y no abia nadie de tu gente mocosa puro royo de esos putos que se cren narcos pinches locos somos del V*B*T*13

BORRACHOS ( e-mail: PRM MEXICLES )
Viernes 08.07.2011 / 06:02
Ora jotolones.pues los estuve esperando anoche y nada que llegaron, te digo que tienes miedoooo.ya lo e comprobado muchas veces y esta fue una mas. PARA TODOS LOS QUE LEEN EL MURO UNA VES MAS LES INFORMO QUE LINIEROS Y AZCACAS SOLO TIENEN OSICO Y NO ATORAN SAVEN QUE CON LA PRM NO PUEDEN NI PODRAN. ME QUEDASTE MAL LINIERO PERO YO ENTINDO TU ERES GATO, UN ACHICHINCLE QUE RECIBE ORDENES Y CLARO ESTA QUE NO TE DEJARON IR. orale pues hay se ven COYONESSS... puro PRM

PRM ( e-mail: MEXICLES )
Jueves 07.07.2011 / 08:36
que pues rajones?? no que muy entrones?? les digo que ustedes puro osicooo... lo unico que corren es la lengua.jajajajajaja ven una troca y se mean de miedooooo. hay se ven coyones me boy hacer feria hoy boy a estar en el VAQUERO yo personalmente estare hai hasta las 11 de la noche.aver si llegan.jajajajjaja puro PRM PURO MEXICANO borrando lineas y desplumando azcacas. hoy jueves hasta las 11.

PRM ( e-mail: BORRACHO )
Jueves 07.07.2011 / 06:04
a quien??? aun achichincle,pela gatos mugroso como tu?? nombreee.soy PRM y una raya mas al tigre.cuando tienes tiempo.

MR*PERICKOTE ( e-mail: http://www.mundonarco.com/2011/05/video-en-donde-l )
Miércoles 06.07.2011 / 15:58
ajajjajaja le sacas prms de mierdas estoi en la jilo P... caile

PRM ( e-mail: MEXICLES )
Miércoles 06.07.2011 / 12:15
Ustedes an de ser inmorteles weyes ya perdi la cuenta de los que yo personalmente me e H... ado.los dos ultimos que me ejecute solo aguantaron 1 balaso en la cabeza. o sea que no son muy intocables putos. yo empese a desplumar azcacas des la pricion no soy gato como tu. puro PRM P... y que sigan los muertitos jajajajajajja.

MR*PERICKOTE ( e-mail: http://www.mundonarco.com/2011/05/video-en-donde-l )
Miércoles 06.07.2011 / 11:49
EN TONSES DONDE NOS BEMOS PRM DE MIERDAS PARA DARNOS EN LA MADRE PARA BER DE QUE CUERO SALEN MAS CORREAS O QUIEREN MAS MUERTITOS JAJAJAJAJAJ ATTE TU MATON R8

( e-mail: )
Martes 05.07.2011 / 12:25
un saludo para todos los del barrio papalote en la colonia del carmen de parte de parte de michel

shagyOneR ( e-mail: doble u efe uno )
Sábado 02.07.2011 / 15:49
k roio muro ps aki mandado saludos desde tierra new ok ya c la saben by shagyoner wfones mis chavos ok jejeje world five lokos

PRM ( e-mail: REVOLUSIONARIOS )
Sábado 02.07.2011 / 14:23
Que tan serca puedes estar pendejo. todos los dias dices lo mismo y sigo desplumando azcacas y borrando lineas.mientras ustedes corren el osico y se esconden de miedo nosotros hacemos billetes y ganamos mas plazaaaa.puro PRM PURO MEXICANO y no solo en juarez EN TODO EL PAIS bola de jotos puñales.jajajajajajjaja PRM

MR * DREECK COHON ( e-mail: SOMOS DEL V*B*T* COCHONES .AZTECOTAS )
Sábado 02.07.2011 / 10:04
REVOLUSIONARIOS DE QUE PUTAS DE SU PINCHE CASA TE BOI A RODILLAR PERRO ESTAMOS SERCA DE TI.

sami ( e-mail: http://www.mundonarco.com/2011/05/video-en-donde-l )
Sábado 02.07.2011 / 07:37
asi es pareja son CULONES ustedes PRM y lagente del CHAPUTO no se quieren dar un tope con los de la LA LINEA por que les parten en su MADRE berda prm de mierdas salgale al toorroo sinnalos jjjajajjajaja apoyamos a los de la ciudad CDJpara que te quede CLARO O CUAL ES TU MIEDO?????????????

PRM ( e-mail: REVOLUCIONARIOS )
Sábado 02.07.2011 / 06:23
sigues de idiota liniero yo tambien ya te dije que eres un triste microbio, una lagartija del desierto. puro PRM PRM COMPAAAAAA....

MR*PERICKOTE ( e-mail: )
Viernes 01.07.2011 / 23:46
SIGES DE AFERADO PUTO YA SABES DONDE QUIERANN CHAPULINES SON BIEN NIÑITAS NO LE SALEN

PRM ( e-mail: BORRACHOS )
Viernes 01.07.2011 / 16:45
son culos los linieros y azcacas y su cartel de lastimas.que pinches miedosos son ustedes.puro CDS Y puro PRM.

MR*PERICKOTE ( e-mail: www.lalineadejuarez.com )
Viernes 01.07.2011 / 14:48
SON CULOS LOS PRM Y SU CARTEL DE CHAPUTOS SALGALE PARA DARNOS UN ENTRE PARA BER QUIEN TIENE MAS HUEVOS ARE O QUE CHAVALAS DONDE QUIERAN SOMOS DE CDJ

PRM ( e-mail: BORRACHOS )
Viernes 01.07.2011 / 12:38
esos idiotas linieros y azcacas son coyones no le entran ala PRM en apollo amis carnales BORRACHOS Y CARTEL DE SINALOAAA. CD JUAREZ ES DE NOSOTROSSS.... puro PRM.

EL PELON ( e-mail: www.lalineadejuarez.com )
Viernes 01.07.2011 / 11:13
esos putos de los prm lla le sacaron al tope SON CULONES EN APOÑO AL DREECK ya los traemos de el C...

PRM ( e-mail: MEXICLES )
Jueves 30.06.2011 / 16:05
YA SE BABOSO SE PERFECTAMENTE LO QUE HACE MI GENTE. Y ESO DE SALVACAR FUE UN JALE A LO STUPIDO COMO TODOS LOS QUE USTEDES HACEN.TE DIGO QUE ESTAN BIEN IDIOTAS NI ESOS JALES CHAFAS SABEN HACER SOLO HISIERON EL RIDICULO COMO SIEMPRE.HAY TE VES IMBECIL YA ME EMPACHASTE.PARA JALES BUENOS Y MACHINES ESTA LA PRM Y PURO PRM PRM PRM....PENDEJOSSSSSS.

MY DREECK .V* B*T*13 AZTECAS ( e-mail: www.lalineadejuarez.com )
Jueves 30.06.2011 / 13:27
PINCHE PENDEJON NI SABES QUE ROLLO ESE Y ANDAS AJUDICANDOTE ALGO QUE NI ISIERON PENDEJON LODE VILLAS FUIMOS NOSOTROS QUE IVAMOS POR UN DOBLADO EN TONSES DONDE NOS BEMOS PARA PARTIRNOS LA MADRE YO Y TU PEDASO DE MIERDA ARRE PRM SI SE LA DAN DE MUI BERGAS ESTAMOS LISTOS PARA DSRNOS EN LA MADRE UBICAME PUES SI NOS IENEN BIEN UBICADOS PUTOS MEXCLAS DE MIERDAS SOY EL DREECK PARA QUE TE QUEDE CLARO R8________________________________________

PRM ( e-mail: MEXICLES )
Jueves 30.06.2011 / 12:06
esas M... ni tu te las cres.todos los dias dices lo mismo y yo no veo nadaaaa.y lo que menos hacemos es quedarnos en casa pues andamos por todos lados y ustedes ni nos ven.fijate lo P... que son ustedes ni siquiera se dan color donde andamos.y nosotros los tenemos bien ubicaditos(FE Y VIDA,VILLAS DE SALVACAR).ya mejor cambiale de rrollo porque la neta ya fastidiaste a todos los del muro.hay se ven JOTOLONESSS. puro PRM PRM PRM COMPAAAAAA.....

MR*PERICKOTE ( e-mail: www.lalineadejuarez.com )
Jueves 30.06.2011 / 11:20
ME ASEN REIR LOS CULONES SON USTEDES QUE NO DAN LA CARA CHAPUTAS SALGALE DE SU MADRIGERA PARA PARA DARNOS UN TOPON PARA QUE BEAN QUE LES PASO AYER ASU GENTE JAJAJAJA PARA DARNOS UN SINALOS DE MIERDA MORDIERON LA MANO QUE LES DIO DE COMER A SUS PADRES ATTE EL CARTELCDJ

PRM ( e-mail: REVOLUCIONARIOS )
Jueves 30.06.2011 / 06:26
estodo BORRACHOSSS. y que putos?? ahora ustedes son los mudos??? jajajajajaja...juarez es nuestro puro CHAPO GUZMAN puro PRM.

PRM ( e-mail: MEXICLES )
Jueves 30.06.2011 / 05:44
ustedes 2 P... lo unico qoe corren es el osico.ya cd juarez es de nosotros PRM presente en cd juarez y todo mexico. y ustedes no salen de su mismo lugar por culos y miedosos.ya valieron madre sin terreno ni gente ni feriaaaa.pobres P... ahora dan mas lastima que antes.puro cartel de SINALOAAAAA PURO PRM PRM PRM PUTOSSSSS...

EL PELON ( e-mail: www.lalineadejuarez.com )
Miércoles 29.06.2011 / 15:05
se quedo mudo pareja saludos a toda mi gente de la linea de parte de el pelonsote ya se la saben con esos peros se ban a caer solo mas esos prm de mierdas estamos listos mi dreck controlando cdj los chihuahua zona de EL CARTEL DE JUAREZ.

MY DREECK .V* B*T*13 AZTECAS ( e-mail: http://www.mundonarco.com/2011/05/video-en-donde-l )
Miércoles 29.06.2011 / 12:51
PARA ESO ME GUSTABAS JAJAJJAJAJJAJJA CULONES SALGALE AL TOPE MARICONES SOMOS DEL CARTEL DE JUAREZ Y LOS DE LA ULTIMA LETRA AZTECAS

PRM ( e-mail: BORRACHOS )
Martes 28.06.2011 / 03:58
TU SI ESTAS STUPIDOOOO...ERES SOLO TU O TADA TU GENTE?? PUES MI NOMBRE ES "PRM" Y HUYYYY CUCUYYYY QUE MIEDOOOOOOO..... ALGUIEN QUE ME ALLUDEEE. PURO PRM COMPAAAAA.....

MY DREECK .V* B*T*13 AZTECAS ( e-mail: jajajajajajJAJAJAJAJAJAJ NO ME AGAS REEEIR MIRDA )
Lunes 27.06.2011 / 13:33
NO MAS DIME DONDE NOS BEMOS PARA DARNOS UN TOPON PARA DE MOSTRRTE QUE NOSOTROS ESTAMOS EN JUAREZ CONTROLANDOLOS JAJAJJAJ EY YA BISTE LO QUE LES PASO ALOS TRANSITO DIME ALGO APOCO NO EYOS LES ASIAN EL PARO SINO DIME DONDE NOS BEMOS Y DE PERDIS PON TU NOMBRE QUE PARA ESO SI ERES CUULLOOONNN JAJAJJAJAJJAJAAJ ATTE .CRTEL DE JUAREZ Y LOS DE LA ULTIMA LETRA SIGALE

PRM ( e-mail: REVOLUCIONARIO )
Lunes 27.06.2011 / 13:14
No pues ustedes tambien se abientan unos chistes buenos y nosotros y muchos mas tabien nos reimos jajajajajajajaja...y que lentos son ustedes tienes 3 meces ubicandome y luego que ya me ubicaste y luego que me sigue buscando.pues ya decidete. todo parece que me tienes miedo. bueno todos ustedes son bien jotolones comprobado esta.dime cuanto tiempo te sigo esperando?? o necesito apañar a no de ustedes ppara que vengas mas rapido?menos vienen ya me H... ue a 2 y nunca vinieron por ellos.puro PRM COMPAAAA.

EL PELON ( e-mail: SANTA MARIA 13 )
Lunes 27.06.2011 / 11:30
ME ASES REIR JAJJAJAJAJJAJ YA BES A TU GENTE LO QUE SIGE ERES TU MENTADO BORACHO TE ESTAMOS UBICANDO MOCOSO DE DE MIERDA BAMOS POR TU FAMILIA SIGE CON TUS MENSAJITOS PENDEJOS______________________

PRM ( e-mail: MEXICLES )
Lunes 27.06.2011 / 04:42
PUES QUE TRAEN BILLETES Y TROCAS Y USTEDES DE MENDIGOS QUE NI CELULAR TRAEN.USTEDES NO PASAN DE UN MISMO LUGAR. Y LA "PRM" EN TODOS LOS ESTADOS Y EN EU TAMBIEN.ESO ES LO QUE PASAAAAA...TENEMOS GENTE,TERRENO Y DINERO.COMO VES???QUIEN CORRE EL JALE EN CD JUAREZ??? PUES LA PRM COMPAAAAA...

MR * DREECK COHON ( e-mail: http://www.mundonarco.com/2011/05/video-en-donde-l )
Domingo 26.06.2011 / 14:47
ey y que les a pasado a tu gente que llani los beo sigeRECLUTANDO MOROS JAJAJAJAJJAJA YA BES LOS QUE LESPASO ????????

PRM ( e-mail: BORRACHOS )
Domingo 26.06.2011 / 07:47
PUES HASTA AHORITA NO E VISTO NADA. MI GENTE SIGUE FELIZ Y CONTENTA HACIENDO BILLETES Y TRABAJANDO EN NUESTRA BONITA PLAZA DE CD JUAREZ. NOS PASEAMOS TRANQUILOS BORRANDO RALLAS Y DESPLUMANDO AZCACAS. TE ALUCINAS CON TANTAS ESTUPIDECES QUE SOLO EXISTEN EN TU MENTE.YA CHECASTE EL PENAL EN LA FEDERAL????NO? PORQUE SI YA TE LO AVIA DICHO...

MY DREECK .V* B*T*13 AZTECAS ( e-mail: www.mundonarco.com/2011/05/video-en-donde-l )
Domingo 26.06.2011 / 03:15
JAJJAJAJAJAJAJAJAJAJJJJJAJJAJAJJAJAJA NPARA QUE SIGAN CAGANDO EL PALO YA BIERON CHAVALAS ???????? SIGAN TIRANDO SU ROLLO PRM SE LES BA A ACABAR SU TRIATRO

rip klens ( e-mail: )
Sábado 25.06.2011 / 20:47
dezcansa enpass mi kleens siempre te llebaremos en nustro corazones fuistes uan bergaa k nadie puro parar te agarraron descuidado i sin kuete solo los marikas agarran por atra pero dezcansa estas mejor aya en el cielo biejo RIP KLEENS JARUDO LOKOS

mard ( e-mail: )
Sábado 25.06.2011 / 20:25
esot es para todos akellos ke cren peliar por algo ke les pertenese sin tener consiencia ke no es asi yo fui pandillero por mas de 8 años empese a los 13 años y ase dos deje eso por ke vi cosas ke muchos chavos ven solo por ensima ahora tengo 24 años y no digo ke no experimenten pero algun dia todos nos arrepentimos de aser cosas sin un sentido chavos piensen las cosas mejor y piensen no solo en ustedes en sus familias hermanas hermanos padres tios sobrinos incluso hijos ke muchos ya tienen ke dios los bendiga a todos y este con ustedes en esos momentos bye

PRM ( e-mail: MEXICLES )
Sábado 25.06.2011 / 07:42
PRM. familia con honor,lealtad,valor,principios y soberania. eso es lo que es LA PRM.UNA FAMILIA CON HECHOS. "ORGULLO PRM. ORGULLO REVOLICIONARIO"PURO PRM.

ALFA ( e-mail: gn@hotmail.com )
Sábado 25.06.2011 / 05:40
PUROS CHAPITOS Y M ZAMBADA Y GENTE NUEVA DEL SR MARRUFO EN JUARITOS, ATTE: CARTEL DE SINALOA.

" IN MEMORY OF MI CALSET " ( e-mail: "C. CAMPESTRE VIRREYES" )
Viernes 24.06.2011 / 16:17
SIENTO ADMIRASION, MIS RESPETOS:!COMO USTED LO QUERIA VIEJON. EN MEMORIA DE MI CALSET QUE EN PAZ DESCANZE "EL DIABLO PUTOS ES EL PADRE DE DIOS" COMO USTE MI CHOLO NO HABIDO ALGUIEN QUE LEVANTE TANTO EL BARRIO. BY: EL FUSE.

PRM ( e-mail: MEXICLES )
Viernes 24.06.2011 / 11:55
PUTOS AZCACAS Y LINIEROS PENDEJOS YA NO TIENEN NADA YA LES GANAMOS LA PLAZA POR OJETES Y MIERDAS QUE SON.ECHEN UN OJO EN LA PINTA FEDERAL Y VERAN COMO LOS TRAEMOS DE PANIQUIADOS PUTOS. PURO PRMMM..."PRM".

ALFA ( e-mail: gn@hotmail.com )
Viernes 24.06.2011 / 11:10
PURA GENTE NUEVA EN CD JUAREZ, LIMPIAMOS MARRANOS,EXTORCIONADORES Y PINCHES RATEROS MUGROSOS AAA Y SE ME PASABA PINCHE LINIEROS DE MIERDA NO TRAEN NADA, YA LOS CHINGAMOS A TODOS, ATTE: GENTE NUEVA!!!

sHORE ( e-mail: eyou@hotmail.com )
Viernes 24.06.2011 / 11:07
KAKOS 90 O LOS FRESAS INFO TEC, SALUDOS COMPAS

MR * DREECK COHON ( e-mail: http://www.mundonarco.com/2011/05/video-en-donde-l )
Jueves 23.06.2011 / 14:27
dime donde te beo y como te disen PARA DARNOS EN LA MADRE SI ES QUE ME ANDAS BUSCADO YA SABES LO QUE LE PASO A TU GENTE POR ANDAR TIRANDO MENSAJITOS JAJJAJAJAJAAJ ATENSION ESTAMOS DETRAS DE USTEDES SIGAN ESCONDIDITOS PEROOS SINO QUIEREN DARSE UN TOPE CON NOSOTROS ATTE LOS AZTECAS LINEA DE JUAREZ Y LA ULTIMA LETRA AL SERVISO DE EL CARTEL DE JAUREZ *656* DIGAN DONDE ????????????:_________________________________________________________________________________________________

MR * DREECK COHON ( e-mail: http://www.mundonarco.com/2011/05/video-en-donde-l )
Jueves 23.06.2011 / 12:26
SIGES DE A FERADO PREGUNTALES A TUS CAMARADAS LO QUE LES PASO MARANOS

PRM ( e-mail: BORRACHO )
Miércoles 22.06.2011 / 11:50
DEJA DE FUMAR ESA MADREEE. TE ALUCINAS MACHIN,NI UN POLLO DESTAZAS TU,TIENES MIEDO HASTA DE TU SOMBRA,COMPROBADO ESTA QUE TIEMBLAS AL VER UNA TROCA.TE ESCONDISTE HASTA DEBAJO DE LAS PIEDRAS PARA NO DARNOS LA CARA Y ANDABAS TODO PANIQUEADO PORQUE SABIAS QUE TE ANDABAN BUSCANDO Y TU GENTE TE CAGO PORQUE NO LE SALISTE AL TORO.QUIUBOOO... SE HASTA DONDE PISAS PUTO. PURO PRMMMM...

MY DREECK .V* B*T*13 AZTECAS ( e-mail: SOMOS DEL V*B*T* COCHONES .AZTECOTAS )
Miércoles 22.06.2011 / 10:47
asies mi diabloJAJAJAJ ESTE ES UN MENSAJE PARA PAS PERAS FLACAS DE LOS JARUDAS Y LOS PRM JAJAJJAJAJA YA BIERON EL COLOR PUTOS LLA QUE NO SON NADA JAJAJA ASTA ME ASEN REIR MIERDAS QUERIAN BERGA Y LES DIMOS ATTE.EL CARTEL DE JUAREZ SOY EL DRREECCCKK EL QUE DESTASO A TU GENTE SIGES TU ABRE LOS HOJOS QUE ESTAMOS SERCA DETI ESTAMOS EN LA CASERIA ___________________________________

SONDOLOKOOTEE..!! ( e-mail: JARUDOTEE )
Miércoles 22.06.2011 / 10:07
que tranza putoss el SONDOO del jarudo LOkoss..!!!

juaritoz ( e-mail: )
Miércoles 22.06.2011 / 09:26
que grasero es el tal diablote.asi le hablas a TU PUTA MADREEEE ???? no sea mal hablado.

diablote ( e-mail: wfzotes )
Miércoles 22.06.2011 / 08:16
wfzotes wf wfff locotes b. corunota

lokote el diablo ( e-mail: www.corunota wf .com )
Miércoles 22.06.2011 / 07:29
ke tranza putos pinchis bola dde perras flacas aqui el diablo calandolos a todos esos que de P... nacieron saludenme a sus carnalas putos me pelan la vergotttotota un huevo y la mitad del otro pinches becerros att el diablote

anonimo ( e-mail: )
Lunes 20.06.2011 / 06:11
saluds para el guero de los amos xv. eh mijo todavia t stoi sperando

FMC ( e-mail: )
Viernes 17.06.2011 / 20:33
PURA FMSOTA PUTOS! DE VIRREYES.

PRM ( e-mail: MEXCALEROS )
Jueves 16.06.2011 / 15:41
TE MEAS DE MIEDO AL IGUAL QUE LOS BASTARDOS QUE TE RODEAN.CONTESTAME LO QUE SE TE PREGUNTA.QUE PEDO CON EL VATO DEL IMSS 35?APOCO NO ERA TU CAMARADA? O LO VAN A NEGAR COMO A LOS 2 PUTOS QUE ENCOBIJE??? YA NO LES QUEDA TERRENO DONDE PIZAR YA NOS LOS CHINGAMOSSSS....JUAREZ ES DE NOSOTROS.Y EN CUAL COLONIA ME BUSCAS?? NOSOTROS NO TENEMOS COLONIA PENDEJO NO SOMOS BARRIO.ESTAS BIEN VERDE PARA SER LIMON,ESTUDIA EL CONCEPTO DE LA PRM Y NOS ENCOTRARAS.NOSOTROS ACADA RATO ENCONTRAMOS azcacas y lineas de M... Y COMO YA AN VISTO LES PONEMOS EN SU MADRE.PURO PRM COOOMMMPAAAA....

MR*PERICKOTE ( e-mail: jajajajajajJAJAJAJAJAJAJ NO ME AGAS REEEIR MIRDES )
Jueves 16.06.2011 / 14:34
EY PERROOO SI ME ANDAS BUSCANDO TE ESPERO A QUI AFUERA DE TU CASA O EN LA ESQUINA DE PERDIS PONGO MI NOMBRE YA QUE USTEDES SE LA DAN DE BALIENTITOS AS TU PUTA CONFIANSA JAJAJAJAJAJ MEJICAS DE MIERDAS CHAPULINES ALINIENSE O LES BA A PESAR ATTE EL DREECK Y PERIKO Y SU GANTE EMOS ESTADO EN SU PUTA COLONIA DE MIERDA NI SUS PUTAS LUSES SALGALE AL TOROOO JAJAJJAJAJ PARA QUE BEAN CON QUIEN TRATAN MONTA PERROOOS SON LOS SIGIENTES TE QUIERO BER ESTAMOS SECA DE TI Y TU FAMILIA CHAVALITO LINPIATE EL CULO SIGE MANDANDO TUS MENSAJES ....._________________________AZTECAS AL MANDO Y LOS LINSES ESTOI EN LA OSTIONERIA EL RICHI MANDAME UNA SELLAL PERRO PARA CAERTE

PRM ( e-mail: MEXCALEROS )
Jueves 16.06.2011 / 07:07
Si es verdad, la violencia esta muy cabrona lo mejor es no meterse en problemas. y explicarles a los morros que se creen valientes que la vida solo es una y que se acaba en un segundo.

yo ( e-mail: )
Miércoles 15.06.2011 / 22:46
la guerra esta bien cabrona en juarez no se sabe de donde te ba a llegar ! aun que seas un cholo macuarro te matan es muy peligrosa esa ciudad!

PRM ( e-mail: BORRACHOS )
Miércoles 15.06.2011 / 15:48
Gracias carnal y digale a los BORRACHOS que espero pronto verlos y meda H... o de gusto que el lito ya ande fuera de la jaula ese es un PRM.me gustaria ser yo quien agarre a ese P... para regalarle una cobija calientita,pero en eso andamos en la caseria de pieles rojas.puro PRM puro CORAZON MEXICANO. si puede me manda su directa para piztear machin.

clao ( e-mail: )
Miércoles 15.06.2011 / 14:44
saludos carnal y saludos de los canales le manda saludos l negro a se unos dias se abeno un jalesote mis respetos y lo atoraron al carnal peroo lla esta afuera no le isieron nada y se carcajea x los marranos el senor en caliente no lo eccho pa fuera lla andamos x ese dreeck pero ni en juarez o conosen x que los de ese barrio noi lo conosen pero ni modo x ese mocoso ban a mamar algunos mejor limpienlo ustedes mismos jaa

PRM ( e-mail: BORRACHOS )
Miércoles 15.06.2011 / 11:01
y a ti como al panochudo del imss 35.... que pedo no contestas nada de lo que se te dice en mensjs abajo. PORQUEEE???? por puro pinche miedooo. puro PRM compa....

MY DREECK .V* B*T*13 AZTECAS ( e-mail: SOMOS DEL V*B*T* COCHONES .AZTECOTAS )
Miércoles 15.06.2011 / 10:38
esto les ba a pasar A TODA LAGENTE DE EL CHAPO EN JUAREZ ATTE MY DREECK ME COCHAJAJAJAJAJAJJA.......____________________http://www.mundonarco.com/2011/05/video-en-donde-la-linea-del-cartel-de.html

pollita ( e-mail: )
Miércoles 15.06.2011 / 09:18
aii shikititos ia no se pelen tantooo la mafia no deja nadaa buenoo atte.rita S

eL LoRsWaaN1 ( e-mail: FUMO MOTA AL 100 )
Martes 14.06.2011 / 20:37
He mii Sondo ay tamos pa lo ke se ofresca homii ya se la save pal paro tambien pa su gente ay tamos karnal chida

PRM ( e-mail: mensaje para las linias y azcacas )
Lunes 13.06.2011 / 17:41
QUE ME DICEN DEL VATO DEL IMSS 35 ??? LO MATARON BIEN GACHO.POBRESITO.HAAAAJJAJAJAJAJAJAJA. PINCHES PANOCHUDOS JOTOS.LES DIGO QUE NO LA LIBRAN." ANIMO MI GENTEEEE, PURO PRM"

PRM ( e-mail: mensaje para los panochudos linieros y azcacas )
Lunes 13.06.2011 / 12:10
que pues ratas de basurero,ustedes solo sueñan con ser grandes,estan muy verdes para ser limones.aun siguen paniquiados con lo de FE Y VIDA. porque si solo fue una pequeña muestra? luego 2 azcacas le jugaron al heroe y los tubimos guardados por 2 meces esperando que 1 de ustedes linieros vinieran por ellos y NADAAA. nunca vinieron pues porque?? pues que no son camaradas? si ustedes son marranos del mismo corral.por lo C... que son los dejaron morir en el cerro. que miedo dan ustedes...ustedes no intimidan a nadie lo unico que causan es LASTIMAAA.y te lo dice 1 PRM y yo encobije a tus 2 camaradas. y queeee????

( e-mail: JARUDOLOKOTES! )
Lunes 13.06.2011 / 11:06
ui ui qe miedo ! todos en este perro mundo estamos PIRATAS

MR*PERICKOTE ( e-mail: MENSAJE PARA MIS CAMARADAS LOS AZTECAS )
Lunes 13.06.2011 / 10:51
que transa SALUDOS A MY CAMARADA EL DREECK ESTAMOS EN LA CASERIA DE LOS BORRACHOS MENTADOS Y LOS CHAPUTOS JAJAJAJA PINCHES DOBLADOS Y LOS PINCHES JARUDITOS DE MIERDA PRIMERO LINPIENSE EL CULO PERROS JAJAJAJ MEJICLES DE MIERDA ABRAN BIEN LOS HOJOS MOCOSOS ATTE LOS DEL V*B*T13 Y AZTECAS ESTAMOS CON EL CARTEL DE JUAREZ _________________________________________________________________________________--JAJAJJAJAJAJ PARESE QUE BAN A PODER COMO EL FLACO JAJAJAJAJAJ ABRAN LOS HOJOS POR QUE LES BAMOS A SER SU DESMADRE SOY EL PERICOTE SUR ESE

( e-mail: ____________ )
Lunes 13.06.2011 / 09:50
JUARITOS RIFA! ____________

PRM ( e-mail: MEXICLES )
Sábado 11.06.2011 / 14:09
la PRM precente y reprecentando a todos los BORRACHOS.animo gente todo anda MUY BIEN. "PRM".

( e-mail: )
Sábado 11.06.2011 / 13:27
FMC FMC FMC FMC FMC

CAMPESTRE VIRREYES ( e-mail: DEDICATORIA )
Sábado 11.06.2011 / 13:24
SIEMPRE TE RECORDAREMOS MI CALSET. PURA FMCSOTA FOREVER.

FMC ( e-mail: CAMPESTRE VIRREYES )
Sábado 11.06.2011 / 13:18
IN MEMORY OF EL CALSET. BY:EL FUSE. EL ABION

Juaritos ( e-mail: )
Sábado 11.06.2011 / 11:05
disculpen y con respeto les pregunto.quienes son los longos??? pregunto para no tener problemas con nadie pero ya abia escuchado algo de longos.gracias y disculpen espero me digan qienes son los longos.

yanerote ( e-mail: )
Sábado 11.06.2011 / 08:43
nel prm no tengo nada contra ustedes ni con jarudo pero una tranza si les digo no soy osicon y a los jarudos les pido perdon x una tranza k mi tio cometio ase muchos anos ase como 15 masomenos no c si decirles x este medio ,, como ustedes kieran pero c lo cuentan a los longos x favor

( e-mail: )
Sábado 11.06.2011 / 08:32
yo cometi un error ase rato parecido con lo k paso en el jarudo pero uno como sabe kien anda en pedos y kien no compa..no somos adivinos cuando cueteo tiro a la pinchi bola y luego salen conke apenas empesaba en el barrio o k el no era del barrio,y yo c tranzas del jarudo canalito k tu ni t acuerdas ese kieres k t diga una o k tranza

yanerote ( e-mail: )
Sábado 11.06.2011 / 08:23
nel ese yo nomas digo la neta aunke les cale hueyes,andan con sus pinches M... k un paro a los prm devolada ay tamos y la H... ada..si no son prm mandenlos a la V... y punto salganle solos ,, o sino amarrence un huevo x k les tumban a otros,.. abajo escribio un huey diske de los longos pongan su pinhe nombre no sean culos

PRM ( e-mail: MEXICLES )
Sábado 11.06.2011 / 07:54
son muchos los vatos osicones,pura mugre de juaritos.a esos verijones que corren el osico se les avisa: EL JARUDO NOOOOO ES SQUINA DE LA PRM, EL JARUDO CORRE SOLO Y ES BARRIO. PERO ES RAZA Y ALA RAZA SE LES APOYA. MUCHO CUIDADO CON HABLAR MAMADAS PORQUE LO QUE NOS SOBRAN SON COBIJAS Y LLELERAS. entendidoooo??? yo no me ando con M... y ME VALE MADRE PADRES O HERMANOS y si les quedan dudas chequen el jale del centro de reabilitacion FE Y VIDA.

( e-mail: B.JARUDO )
Sábado 11.06.2011 / 07:38
calmese pinchi llanero ni sabe que pinchi rollo we,, y que le valga V... la informacion del jarudo canaa,,JARUDOTELOKOS

PRM ( e-mail: BORRACHOS )
Sábado 11.06.2011 / 06:05
la PRM esta limpia,fue un vato que hablo por el jarudo pero tengo entendido que el jarudo NO estubo de acuerdo.ala PRM le aguita ese jale que H... uen a morros que no quieren pedo.el punto es el ubicar a ese vato que andubo hablando por el jarudo y darle unas nalgadas.es probable que ese vato leea este muro y ya este enterado.pero para entenderlo mojor leean los correos de este muro. con respeto y apoyo "LA PRM".

el yanero ( e-mail: )
Sábado 11.06.2011 / 04:28
k royo jarudos x k yoran dicen k les tronaron a gente k no andaban en pedos . si les asen paro a los prm aguanten la V... si no no agan paro a ninguna mafia y listo,...... el pancho era el lider del barrio o puro pedo?

PRM ( e-mail: MEXICLES )
Viernes 10.06.2011 / 09:31
asi es, la P... linea no sirve para nada.son culos igual que los cochinos azcacas.

MISTER TECOLOTE ( e-mail: )
Viernes 10.06.2011 / 02:11
QUE TRANZA HIJOS DE SU PUTA PERRA BOMBA MADRE USTEDES NO SON CHOLOS PURA CARPA LEVAS NO TRAIN NI LA BACHA KAIGANLE A TIJUAS LEVAS PAKE WUACHEN KETRANZA COMO SALEN CHIKOTIADOS AKI BIEN LOKOTE BIEN ONDEADOTE FUMANDOME UN DONAS DE ICE Y UNOS GALLOS DE CANABIS CON EL CUETE EN LA SINTURA PAÑUELO AZUL SUREÑOS LOKOS X3 DE POR VIDA LA LINEA VALE VERGA PUTOS NARCOCHOLOS ARRIVA EL SEÑOR GUZMAN BDT KDC MISTER TECOLOTE AKI BIEN LOKOTE.

PRM ( e-mail: borracho )
Miércoles 08.06.2011 / 10:36
Que pues BORRACHINES??? aqui su carnal ARVIZU alpendiente de la PRM esperando como los buitres. puro PRM RAZZZAAAAAA::::

123 ( e-mail: 123 )
Miércoles 08.06.2011 / 10:29
K TRANSA CARNALES YA BOLBI HAY ESTOY AL PENDIENTE CON MI JENTE K ME APOYA Y A LA 123 HAY DISCUPEN CARNALES POR NO REPORTARME PERO ME ANDABAN ENTAMBANDO PERO EL K TIENE GUEN PADRINO SALE POR K SALE SALUDO AL 14

PRM ( e-mail: MEXICLES )
Lunes 06.06.2011 / 11:56
Oyeme cabron.sigo esperando a que me ubiques segun tu ya tenias toda mi libreta.PUES QUE PASA??? TIENES MIEDOOO??? NO VERDAD.los azcacas son culos incluyendote a ti,solo corren el osico y no atoran.me ban a dejar esperando como a sus 2 camaradas? oye aun siguen resando el novenario para los de FE Y ESPERANZA? puro PRM.

MY DREECK .V* B*T*13 AZTECAS ( e-mail: SOMOS DEL V*B*T* COCHONES .AZTECOTAS )
Lunes 06.06.2011 / 10:45
JJAJJAJAJAA SIGEN DANDO LATA YA BERAN CARTEL DE JUAREZ REPRESENTANDO MARANOS DE LOS PRM Y JARUDAS BALE BERGA MY BARRIO ES EL BYG TRISTE 13 Y FAM.AZTECA ESE CAIGALE PERROS ATTE .MY DREECK SWK.SC. LINPIANDO LA PLAZILLA DE LA GENTE TRAISIONERA CHAPUTOS

SHAGYOneR ( e-mail: WFSOTES** )
Domingo 05.06.2011 / 03:54
WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF

PRM ( e-mail: MEXICLES )
Viernes 03.06.2011 / 11:23
que pues raza?? un saludo para todos los BORRACHOS REVOLUCIONARIOS que siempre reprecentan machinn.ANIMOOO QUE TODO ESTA SUPER BIIIEENNN¡¡¡¡ puro PRM.

SONDOLOKONEE.. jarudote ( e-mail: )
Viernes 03.06.2011 / 10:43
el sondo putos del jarudote lokotess..!! la seguimos rifando hijos de su pinchi madre! somos barrio putos no necesitamos de mafias para ser vergas

( e-mail: )
Jueves 02.06.2011 / 20:29
AI ANDAMOSS CON LA RAZA DE MI JARUDITOSSSS EL KLEEEN CANA ... AI TAMOS PARA LO K SEAAAA I ESTO NO ES MAFIAAAA ES DE MI TIEMPOS BARRRIO JARUDO LOKOS OSEA BJL SE LOS COCHA

( e-mail: )
Jueves 02.06.2011 / 20:22
con una M... NO ENTIENDEN K NOSOTROS NO SOMOS NADAAAAAAAAAAAAAA I EL PENDEJO K ESTE HABLANDO POR LOS JARUDO NETEEEEEE K LE BA KARGAR LA BERGAAA IJOS DE PERRA AKI LOS JARUDO LOKOS KUESTA SIGUE CIENDO UN BARRRIO POKOS PERO LOKOSSSSS

JARUDOTES,, ( e-mail: )
Jueves 02.06.2011 / 06:53
ese pinchi mokoso tira mucha pinshi M... jajajaja das risas wey no mame,, a los jarudos nadie nos controla P... tus pinchis aztecas no la pelan cana por algo se la an pelado,,jarudotes putosss..!!

PRM ( e-mail: MEXICLES )
Miércoles 01.06.2011 / 12:37
y la PRM vicitando centros de reabilitacion para alludarles alos linieros y azcacas.la PRM les alluda a que se reabiliten mas pronto y los deja muy encobijados disque porque el frio esta cabron...

MR * DREECK COHON ( e-mail: SOMOS DEL V*B*T* COCHONES .AZTECOTAS )
Miércoles 01.06.2011 / 11:10
EL CARTEL DE JUAREZ CONTROLA LA PLAZA Y LOS LINSES Y AZTECAS CONTROLANDO ALOS JARUDOS QUE TIRAN TANTA MIERDA Y LOS PRM ATTE DREECK ME COCHA JAJAJAJAJA____________________________________________

SHAGYONER ( e-mail: dOblE U eF SOTeS )
Martes 31.05.2011 / 13:38
WFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWF

PRM ( e-mail: REVOLUCIONARIOS )
Martes 31.05.2011 / 07:38
Que pues raza ¡¡!!! aqui 1 BORRACHO mas de los muchos que hay reprecentando la"PRM" y borrando lineas de drogadictos. QUE NOOO????

CDS GUZMAN LOERA ( e-mail: )
Lunes 30.05.2011 / 19:37
DE ACA ARRIVA LOS VEO POLLITOS ALINIENSE ATTE: JOAQUIN GUZMAN LOERA CDS

PRM ( e-mail: BORRACHO )
Domingo 29.05.2011 / 10:43
Huy cucuy...QUE MIEDOOOO¡¡¡¡

LA-LINEA DE CHIWUAS ( e-mail: )
Jueves 26.05.2011 / 01:22
COMO ME DAN RISA BOLA DE ESTUPIDOS USTEDES SIGAN ESCRIBIENDO PENDEJAS PUTOS TENGO EL IP DE CADA UNO DE USTEDES I LOS TENEMOS LOCALISADOS CONTESTEN LAS LLAMADAS YASAVEN SINO QUIEREN AMANESER DECAPITADOS APAGAN CUOTA POR SU SEGURIDAD LA LINE LA LINEA LA LINEA------------------

SHAGYONER ( e-mail: WFSOTES )
Miércoles 25.05.2011 / 12:23
BARRIO WORLD FIVE LOKOTES

MY DREECK .V* B*T*13 AZTECAS ( e-mail: SOMOS DEL V*B*T* COCHONES .AZTECOTAS )
Miércoles 25.05.2011 / 11:03
asi cañaditos seben mas bonitos jaja

MY DREECK .V* B*T*13 AZTECAS ( e-mail: SOMOS DEL V*B*T* COCHONES .AZTECOTAS )
Martes 24.05.2011 / 11:12
JAJAJAAJAAJ ABER CUANDO LE CAIN MIERDAS LOS ESPERAMOS DONDE DIGAN PERROS EL DREECK MECOCHA AZTECAS Y SUREÑOS LIOSTOS PARA DARTES EN SU MADRE OTRABES JARUDOS DE MIERDAS ABRAN BIEN LOS HOJOS PORQUE LES BAMOS A LLEGAR

MR*PERICKOTE ( e-mail: MENSAJE PARA MIS CAMARADAS LOS AZTECAS )
Martes 24.05.2011 / 10:23
QUE TRANSA MI DREECK YO LE TIRO ESQUINA CON ESOS PINCHES MOCOSOS DE MIERDAS Y TODOS LOS JARUDAS Y LS PRM DE MIERDAS CUANDO BAMOS POR EÑOS MY DREECK MARA DARLE S EN SU MADRE PARA QUE BEAN QUE NO ES GUEGO ESTE ROLLO DE LINPIAR LA PLASZA DE LA ESCORIA DE LA GENTE DE EL CHA PUTOS JAJAJAJAJ A Y AESOS PUTOS CUANDO QUIERAN NOS BEMOS PERROS PARA DARNOS EN LA MADRE SUREÑOTES 13 DE LA FLORENSIA Y MONTE FLORES DE CALI. SIENPRE FIRMES CON LOS AZTECAS Y LOS LINSES AJAJAJAJAJ

jarudote ( e-mail: el kleens )
Lunes 23.05.2011 / 16:41
arre mi compa clavo ay estamos puestotes BJL siempre presente carnal,,un saludo a toda mi gente y morras del jarudo ay estamos gente.

clavo ( e-mail: )
Lunes 23.05.2011 / 15:16
saludos carnales de parte de su carnal clavo y el negro nuetros respetos para usted y los bjl hay que estar siempre firmes pero siempre preparados todos nosotros estamos al 100 y camellando me dariA mucho gusto conoserlo y brindarle nuestros respetos pero entendemos como corre el pedo por este medio pero agarre nuestros respetos para usted usted sabe que todo se cammella x sentido comun y este marrano del dreck que lo quiere ubicar que digga don de nos damos un tope a nosotros tambien nos morimos x bicarlo al perro y usted siempre estara respaldado x la prm y x mexicles y afiliados los carnales guachan esta pajina y se queman todos los rollos que aqui se tiran pero lamentan que no podamos estrechar manos y a esos marranos de la linea y aztecaz el senor tambien les a mandado muchos videos digale ala sup que no los quite el publ tambien los quiere ber llorar jajaja

MY DREECK .V* B*T*13 AZTECAS ( e-mail: SOMOS DEL V*B*T* COCHONES .AZTECOTAS )
Lunes 23.05.2011 / 10:22
yyy NOS SEGIMOS COJIENDO ALOS MEJICLE DE MIERDA Y ALOS DOBALDOS JAAJAJAAJJJAJAJAJ ATTE TU MATON EL DREECK COCHON PRM BALE BERGAS DE MIERDAS CHAPUTAS

PRM ( e-mail: MEXICLES )
Jueves 19.05.2011 / 15:53
Que pues,cual plaza?solo que el mercado.ya no tienen plazaaaa... ustedes son tan culos que no salen de cd juarez ¡¡¡mira P... LA PRM ESTA EN TODO CHIHUAHUA,TIJUANA,REYNOSA,MATAMOROS,NV LAREDO,SINALOA,DURANGO,GUERRERO , DF Y GUANAJUATO.dime, como ustedes infelices microbios piensan terminarnos con LA PRM ? ustedes estan tan mendigos que ni pal pasaje tienen.bueno, pero si le resan el novenario a los de FE Y VIDA? y a tus 2 camaradas que dejaste aca conmigo los dejaron morir solos .QUE GACHOS NOO?jajajajajajajaja¡¡¡¡¡¡

MR * DREECK COHON ( e-mail: SOMOS DEL V*B*T* COCHONES .AZTECOTAS )
Jueves 19.05.2011 / 14:27
SIGIMOS LINPIANDO LA PLAZA DE LA GENTE COMO LOS MECACAS Y ALIADOS DE LA CHAPUTOS ATTE DREECK JAJJAJA___________________________________________-

MY DREECK .V* B*T*13 AZTECAS ( e-mail: SOMOS DEL V*B*T* COCHONES .AZTECOTAS )
Jueves 19.05.2011 / 11:16
MMMMMM SIGES DE AFERADO PUTO TE BOI A RODILLAR MARANOS MATAN GENTE INOSENTE PERROS PERO ÑA NOLA COBRAMOS JAJAJAJAJAJAJAJAJ DREECK TE COCHA

PRM ( e-mail: MEXICLES )
Miércoles 18.05.2011 / 10:58
Oye pendejo? pues que LA PRM Y MEXICLES NO SON LOS MISMOS?? no conoces nada.putos AZCACAS se mean cuando ven a un PRM. PERO QUE NESIO ERES,NO ME DICES NADA DEL JALE FE Y VIDA'''???¡¡¡ ono saves nada??

MY DREECK .V* B*T*13 AZTECAS ( e-mail: SOMOS DEL V*B*T* COCHONES .AZTECOTAS )
Miércoles 18.05.2011 / 10:53
http://www.blogdelnarco.com/2011/05/video-en-donde-integrantes-de-la-linea.html#moreMMMMMMMMMMM DERATO LLA TE ESTRAMOS UBICANDO MIERDAS UNO POR UNO AJJAJAJJAJJA ATTE DREECK GENTE AZTECA Y LOS LINSES CARTEL DE JUAREZ

PRM ( e-mail: BORRACHOS )
Miércoles 18.05.2011 / 10:48
Pues porque te tardas? mi gente esta por todos lados somos muy facil de encontrar. o tienen miedo por eso solo ladran.nunca vinieron por sus camaradas y me tome la molestia de dejarlos en el cerro con 1 oyo de 9mm en la cabezota.pero que pues?? dime algo del jale FE Y VIVA CENTRO DE REABILITACION.

MY DREECK .V* B*T*13 AZTECAS ( e-mail: SOMOS DEL V*B*T* COCHONES .AZTECOTAS )
Miércoles 18.05.2011 / 10:44
PRM Y JARUDOS Y MEJILES DED MIERDA SELOS BA ACARGAR EL PALLASO JAJAJJAJAAJAJ PONGANSE TRUCHA Y CON LOS OJOS BIEN ABIERTOS JJAJJAJAAJJA LOS LINSES Y AZTECAS PASANDO EL RONDIN PARA QUE GUACHEN JAAJAJAJAJAJAJAJJAJAAJJA

MY DREECK .V* B*T*13 AZTECAS ( e-mail: SOMOS DEL V*B*T* COCHONES .AZTECOTAS )
Miércoles 18.05.2011 / 10:39
LLA TE ESTAMOS UBICANDO TU Y TU GENTE DE MIERDA TE BOI A RODILLAR PERRO JAJAJJAAJAJ ATTE.DREECK ME COCHA

PRM ( e-mail: MEXICLES )
Miércoles 18.05.2011 / 10:34
Miren pinches jotos,ya dejen de piratear videos chafas.esos jales son de los zz y ustedes no peinan un chango a nalgadas."LA PRM MEXICLES" les parte su madre facil y con la izquierda. que me puedes decir de los 19 muertos en "fe y vida"? sentro de reabilitacion.o no saves nadaaa? PRM MEXICLES SENTANDO azcacas. O NOOOO???

MR * DREECK COHON ( e-mail: SOMOS DEL V*B*T* COCHONES .AZTECOTAS )
Miércoles 18.05.2011 / 10:32
http://www.blogdelnarco.com/2011/05/video-en-donde-integrantes-de-la-linea.html#more

MY DREECK .V* B*T*13 AZTECAS ( e-mail: SOMOS DEL V*B*T* COCHONES .AZTECOTAS )
Miércoles 18.05.2011 / 10:21
QUE TRANSA NIÑITAS DE LOS MEJICLAS Y SU BARRIO DE MIERDAS DELOS JARUDOS Y LOS PRM LOS AZTECAS COCHAMOS PUTAS LESDEJO UN VIDOE PARA QUE LO GUACHEN NENAS ATTE DREECK DELOS AZTECA ANDAMOS AL 1000000 LINPIANDO LA PLAZA DE LOS CHAPUTOS JAJAJJAJAJAJAJAJJA.http://www.blogdelnarco.com/2011/05/video-en-donde-integrantes-de-la-linea.html#more

( e-mail: bjl! )
Martes 17.05.2011 / 18:23
jajajajaj EL ARESENAL LO TENEMOS BARRIO JARUDOTE LOKOTOTOTOTOTES !

( e-mail: B-JARUDO )
Martes 17.05.2011 / 17:46
ARRES PUES MIS PRM GRACIAS AQUI ESTA EL APOYO CARNALES, HECHENOS LA MANO CON UNOS AZTEQUITAS QUE ANDAN CALENTANDO EL BARRIO NOS CAEN EN LA PUNTA DE LA VERGA PERO COMO TE DIGO NOMAS SOMOS BARRIO NO TENEMOS ARSENAL PARA SACARLOS A LA VERGAA..!

PRM ( e-mail: BORRACHOS )
Martes 17.05.2011 / 15:55
ESTA MAS QUE CLARO,DESDE EL PRINCIPIO SE DIJO QUE NO EXISTE NINGUNA RELACION ENTRE LA PRM Y JARUDO.YA QUE SOMOS MUY DISTINTOS,USTEDES VARRIO Y NOSOTROS FAMILIA. NO HAY NINGUNA CONFUSION YA QUE LA PRM SOLO OFRECE APOYO SIN CONDICION Y NUESTRO JALE ES OTRO.PERO CLARO QUE EL PARO ESTA PERO CADA QUIEN SE PARA POR SU RESPETO.ECHENLE GANAS Y LA GENTE NO TIENE PORQUE CONFUNDIRSE YA QUE LOS PLACASOS SON DIFERENTES. NUNCA SE DIJO QUE JARUDO ERA PARTE DE PRM.PERO TODO MACHIN. ANIIIMOOOOO. SOMOS RAZAAAAA¡¡¡¡¡¡¡

B-JARUDO ( e-mail: B-JARUDO )
Martes 17.05.2011 / 13:38
SIMON CARNAL ASI ES, NO QUEREMOS QUE NOS CONFUNDAN MIS PRM SI TIENES PARO PERO ACLAREN QUE NO SOMOS PRM NOSOTROS, ALZAMOS BANDERA PERO LA DEL JARUDO SI ME ENTIENDES? UN PARO O ALGO SI LE SALIMOS MIS PRM PERO NO NOS INVOLUCREN EN ESO PORFAVOR, YA AN DE AVER ESCUCHADO LOS RUMORES DE QUE UN CHINGO DE RAZA NOS ESTAN TRONANDO POR ESOS ROLLOS Y LA NETHA MIS PRM A LOS QUE NOS TRONARON NO ANDABAN EN ESAS MOVIDAS AHY QUE ACLARAR LOS ASUNTOS.

( e-mail: BARRIO JARUDO ! )
Martes 17.05.2011 / 12:08
asi es carnal tienen el apoyo, i nosotros esperamos lo mismo de uds. pero no jalamos para nadien. encerio carnal esa pinchi tal rita nadien en el barrio la conoce ni nada no existe para nosotros, no necesitamos de una panocha qe nos defienda ) aiestamos

( e-mail: B-JARUDO )
Lunes 16.05.2011 / 13:51
MIS PRM TIENEN EL RESPETO Y LO SABEN SOI JARUDOTE DE LOS RUKOS, EL PEDO ES KE NO QUEREMOS QUE PIENSEN QUE SOMOS PRM TIENEN EL PARO SIMON PERO NO JALAMOS PARA NADA DE ESO..!!POR ESOS ROLLOS NOS AN ESTADO TRONANDO GENTE EN MI BARRIO CARNAL, EN EL JARUDO NO HAY NINGUN MEXICLE NI AZTECA SOLAMENTE LEVANTAMOS AL BARRIO JARUDO.

PRM ( e-mail: MEXICLES )
Lunes 16.05.2011 / 11:56
QUE PASO JARUDOS? PRM MEXICLES ES FIRME. CUAL ES EL CORAJE?

( e-mail: B JARUDO LOKOS ! )
Lunes 16.05.2011 / 09:24
PINCHI MADRE IJOS DE PUTA JARUDO NO ES AZTECAS NI MEXICLES OKEI? ESA PINCHI MOCOSA LA TAL RITA ES UNA PINCHI LEPA ESTUPIDA KE NO SABE COMO CORRE EL AGUA I EL WEI KE LE SIGA LA CORRIENTE ES UN PENDEJO EN POCAS PALABRAS ! BARRIO JARUDOTE LKOS !SOLOS PODEMOS OKEI ?

BJARUDOL ( e-mail: )
Domingo 15.05.2011 / 20:52
que tranzaaa BARRIO JARUDOO LOCOOOOS RIP DOSIL&KOALA aitamoooos

SHAGYMAN ( e-mail: WFWFWFWFWFWF )
Domingo 15.05.2011 / 11:32
WFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWFWF WORLD FIVE **WORLD FIVE**WORLD FIVE**WORLD FIVE**WORLD FIVE**WORLD FIVE**WORLD FIVE**WORLD FIVE**WORLD FIVE**WORLD FIVE**WORLD FIVE**WORLD FIVE**WORLD FIVE**WORLD FIVE**WORLD FIVE**WORLD FIVE**WORLD FIVE**WORLD FIVE**WORLD FIVE**SHAGYMAN**SHAGYMAN**SHAGYMAN**SHAGYMAN**SHAGYMAN**SHAGYMAN**SHAGYMAN**SHAGYMAN**SHAGYMAN**SHAGYMAN**SHAGYMAN**SHAGYMAN**SHAGYMAN**SHAGYMAN**

PRM ( e-mail: BORRACHOS )
Sábado 14.05.2011 / 14:08
prmaz97@prodigy.net

JARUDO ( e-mail: )
Sábado 14.05.2011 / 13:41
dame tu correo prm..!!

PRM ( e-mail: MEXICLES )
Sábado 14.05.2011 / 09:07
Que pues JARUDO. necesitamos hablar dime como le hacemos. la otra ves les escribi a los correos que me diste y nada. estamos puestos.

SHAGYONER ( e-mail: WFSOTES ONES )
Sábado 14.05.2011 / 08:53
K ROIO K ROIO MURO BY SHAGYONER DEJANDO LA RAYA DEL DEY MIS CHAVOS OK SOBRES PS DESDE TIERRA NEW UNO BARRIO WORLD FIVE ONES

SIGUE VIVO JARUDO ( e-mail: )
Sábado 14.05.2011 / 04:41
KOMO ME EPUTAAAA K SE AGAN DE ASER DE MI BARRIO DEL JARUDO IJOS DE PERRA NO SABEN COMO EEE BATALLADO PARA LEBANTARLO KADA DIA MEJOR KASI EEE MUERTO POR LEBANTARLO IJOS DE PERRA PINCHI MOKOSAAAAAA DEJA ASER TU BABOSADASSSS LA TAL RITA PINCHI MOKOSAAAA SIGUE KAGANDO EL PALO AKI WEY Y NETA YA TE TENEMOS UBIKADA MIERDA KARNALA DE IVON OK PENDEJA AKI NOSOTROS SOMOS PURO JARUDO Y ESTA SE LLAMA BARRIO NO AKI TIRAMOSSSS ALOS PUTO K SE KIERAN PASAR DE BERGAS NOSOTROS RESPETAMOS ALOS K NOS RESPETAN OK .... BJL

EL DRAW DE LA MSF ( e-mail: MSF CUESTA LOKOS RIFA )
Viernes 13.05.2011 / 21:57
NO MAMEZ prm YA QUISIERAS PEDALIAR DE LA BICIQULETA K YO PEDALEO WEY ME DAZ RIZA PENDEJO NETHA ME LA PELAZ ASI DE BONITO JAJAJA SIMON Z4 REPORTANDOSE AQUI EL PRM Z6 PARA MAMARSELAS JAJAJA ME LA PELAS WEY YA VEZ A RITA MI MORRITA YA ES MSF COMO VEZ TAL VEZ ALGUN DIA TU PRM SEAS MSF PERO NO CREO POR K ME ERES UNA ESCORIA MAZ DE MI JUAREZ LOKO SIMON ASI LO EXPRESSSO EL DRAW DE LOS MSF SE LOS COCHA RITA CAIGALE MIJA SABE USTED K ES MSF FOR EVER

EL DOEF CAYANDO BOCAS ( e-mail: )
Viernes 13.05.2011 / 20:38
el doef controlando en juarez y donde kieran chavalas y de ke le sirve ke tiren rollo lokos mejor densen de vergasos paresen niñas salgale por su barrio y de ke les sirve chapetes y juarez la riffa hay no mas y estamos en juarez aka del grangero no mas para ke wuachen y de la seventeen park and griffindoors smook weed brythay kana

PRM ( e-mail: MEXICLES )
Viernes 13.05.2011 / 16:17
YA ESTA,YO ME REPORTO.

Z 4 ( e-mail: C DG )
Viernes 13.05.2011 / 15:42
ese PRM porfavor reportece conmigo al correo o num del Z7 necesito toriquear con usted. con respeto Z4.

PRM ( e-mail: BORRACHOS )
Viernes 13.05.2011 / 15:32
putos osicones de los msf donde as visto que tu P... varrio visicletero se compare con "LA PRM" que no te das color de lo idiota que estas? solamente eres tu o tambien son todos los de tu varrio? yo pienso que solo eres tu el bastardo que sueñas despierto en ser alguien porque solo eres un misero microbio jugando a ser grande.

LA RITA ( e-mail: )
Viernes 13.05.2011 / 12:32
HAHAHAAA ES TODO MI DRAW TIENE MI APOYO

LA RITA ( e-mail: )
Viernes 13.05.2011 / 12:21
rokerita50@hotmail.com HAHA CREO K TE VA A PARESER BIEN MI IDEA

EL DRAW DE LA MSF ( e-mail: MSF CUESTA LOKOS RIFA )
Viernes 13.05.2011 / 12:19
arres hay te va mija draw_esteban@live.com.mx pasa el tuyo

LA RITA ( e-mail: )
Viernes 13.05.2011 / 11:52
PAZE SU CORREO WEEE KIERO ABLAR KON USTED Y X SIERTO YO YA NO SOI DEL JARUDO NESESITTO SU CORREO ARRE O K LE CONVIENE

EL DRAW DE LA MSF ( e-mail: MSF CUESTA LOKOS RIFA )
Viernes 13.05.2011 / 11:47
K TRANZA PINCHES bjl DE MIERDA SABEN BN K ME LA PELAN WEYEZ SIGAN HABLANDO MIERDA COMO LOS PRM YO SE K AL ULTIMO ME LOS VOY A TERMINAR COCHANDO Y ALA RITA DE PASADA DE HAY TE VOY A PASAR DOS K TRES PERRRITAS MIAS OK AVER SI MUY VERGA Y NO MAMEN PINCHES prm y bjl SON DE AGUA SABEN BN PENDEJOS SON UN PAR DE CULOS LOS bjl y los prm YA NI LOS VEO POR MI JUAREZIITI POR K POR K POR CULOS ASI NOMAS YA SALGAN PUTOS O TIENEN MIEDO D K ME LOS COCHE JAJAJA YA SE LA SABEN MSF LA CUESTA LOKOS RIFA FOR EVER EL DRAW SE LOS COCHA Y SIGAN HABLANDO DE MI O DE MI BARRIO ALCAVO SON PURAS PALABRAS MENSAS K PONEN NETHA Y YA PONGANLE PLAY PUEZ PUTOS PURO BLA BLA BLA BLA COMO DISE MI ROLA PREFERIDA LA DEL CARTEL DE SANTA JAJAJA SIGAN HABLANDO K AQUI EN ESTE MURAL NO SON NADA Y ECHENME ASUS JEFAS SIMON JAJA YA SABEN DONDE VIVO MSF LA CUESTA LOKOS RIFA FOR EVER EL DRAW SE LOS COCHA MSF MSF COMO VEZ TE CALA WEY...Y EL WIKE NO MAMEZ WEY ES CAMARADA PERO ME UBIERAN CAIDO AMI AVER SI TE CORRO WEY PERO NO CREO MI

LA RITA ( e-mail: )
Viernes 13.05.2011 / 08:09
SABES K TU WEY YA ME TIENES ARTA NETTAAAA PURAS BABOSADAS DICES NETTA:@ IIA PARALE NOOO NETTAA AI GRAX JARUDO LASTIMA K IIA NO SOI DE AI:(

jarudolokotees ( e-mail: )
Jueves 12.05.2011 / 16:09
arre we aqui te calmamos nomas no dures muchoo ee,, jajaja pinchi hablador P... jaja

MY DREECK .V* B*T*13 AZTECAS ( e-mail: SOMOS DEL V*B*T* COCHONES .AZTECOTAS )
Jueves 12.05.2011 / 14:32
QUE TRANSA PINCHES NIÑAS DE LOS JARUDOS LES BAMOS A CARE PÚTAS PARA QUE SELES QUITE LO CHINGONES CUANDO LES DEJEMOS 2 O 3 DECAPITADOS PERRAS TE ESTAMOS CHECANDO PUTA RITA YO EL DRFEECK TE BA A AGARAR Y TE BOY ADAR UNAS CIJIDAS ATTE DREECK DE LA COL.INDEPENDENCIA 1 Y 2 CAIGALE GENTE DE EL CHAPO Y LOS QUE QUIERAN PARA DARLES UN SUSTITO JAJAJAJAJJAJ__________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________-CONTROLA LA PLAZA AJAJJAJAJAJAJAJAJAJAJAJAJAJAJAJAJAJAJAJAJAJA NO LE SA QUEN BAN A TENER NUEVAS NOTICIAS JARUDOS Y LOS QUE LO APOLLEN ATTE.MY DREECK COCHON JA JA JA

PRM ( e-mail: BORRACHOS )
Jueves 12.05.2011 / 13:49
Simon JARUDOS ya tira al lion a estos hijos de puta, ya se esta calentando este muro y con puras stupideces de estos weyes que solo corren el osico alo pendejo. pero que no se pase de madre ese P... que insulta y falta el respeto a Rita que no se pase de pendejo. Rita ya tiene mi correo hay me escriben JARUDOS. y puro PRM Y JARUDOS los demas son OJETES.

BJL ( e-mail: )
Jueves 12.05.2011 / 13:31
JARUDO LOKOS .PEREEME..PURA ESKINA LLA NO AI Q ACEER CASO A ESTOS BASTARDO SE LES NOTA LA ENVIDIA

Z 4 ( e-mail: C D G )
Jueves 12.05.2011 / 12:45
ESTE MURO ESTA CHINGON Y ME GUSTA PARA INVITAR ALA RAZA A CHAMBEAR Y GANAR BILLETE.LOS INVITAN LOS ZZZZ

SHAGYOneR ( e-mail: WORLD FIVE OneS )
Jueves 12.05.2011 / 12:33
K TRANSA K TRANSA NOMAS DEJNADO EL RAYON OK BARRIO DOBLE U EFE UNO BY TIERRA NEW

Z 4 ( e-mail: C D G )
Jueves 12.05.2011 / 12:25
ESOS PENDEJOS DE LA LINEA Y AZTECAS.YA NOS TIENEN FASTIDIADOS DE TANTO QUE HABLAN Y NO HACEN NADA.QUIEN DE USTEDES VA A MANDAR LOS DECAPITADOS? SOLO QUE SEAN POLLOS.ABUSADOS CON LO QUE HABLAN. EL Z4

LA RITA ( e-mail: )
Jueves 12.05.2011 / 12:08
EI CALMADO CARNAL KIERO CONTACTARME CONTIGO PAZA TU CORREO PLISS

MY DREECK .V* B*T*13 AZTECAS ( e-mail: SOMOS DEL V*B*T* COCHONES .AZTECOTAS )
Jueves 12.05.2011 / 12:03
QUE TRANSA PINCHES NIÑAS DE LOS JARUDOS LES BAMOS A CARE PÚTAS PARA QUE SELES QUITE LO CHINGONES CUANDO LES DEJEMOS 2 O 3 DECAPITADOS PERRAS TE ESTAMOS CHECANDO PUTA RITA YO EL DRFEECK TE BA A AGARAR Y TE BOY ADAR UNAS CIJIDAS ATTE DREECK DE LA COL.INDEPENDENCIA 1 Y 2 CAIGALE GENTE DE EL CHAPO Y LOS QUE QUIERAN PARA DARLES UN SUSTITO JAJAJAJAJJAJ__________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________-CONTROLA LA PLAZA

LA RITA ( e-mail: )
Jueves 12.05.2011 / 10:41
CALMATE PENDEJO Y CONECTATE PA ACLARAR LAS COSAS

ZARAZUA ( e-mail: )
Jueves 12.05.2011 / 10:23
Busco a una amiga en Brownsville Tx se llama Maria Luisa Salas tiene 4 hijos la mayor se llama Inez,David y Alondra la mas pequeña vive en la calla coffe port rd no se el numero.si alguien la conoce porfavor reportenlo al muro.muchas gracias.

( e-mail: !* )
Jueves 12.05.2011 / 10:20
aceptame lepa !

la rita bjl ( e-mail: )
Jueves 12.05.2011 / 09:58
PURO BJL AUNK TE CALE SOY DEL JARUDO ATI ES EL UNIKO K TE VA A CALAR HAHAA

LA RITA ( e-mail: )
Jueves 12.05.2011 / 09:55
ES ROKERITA50@HOTMAIL.COM AGREGA WEY TENGO MUZHAS COSAS K RECLAMARTE TARADO

( e-mail: JARUDOTE! )
Jueves 12.05.2011 / 09:39
HAHAHAHAHAH! yononecesito qe una pinchi mocosa como tu defienda mi barrio, okei? dame tu P... correo lepa.

JARUDOLOKOS..!! ( e-mail: )
Miércoles 11.05.2011 / 12:40
TODOS LOS QUE HABLAN DEL JARUDO Y PRM NOS REIMOS WEYES NO CREAN QUE NOS CAUSAN CORAJE,,ESCRIBIMOS AQUI Y HASTA NOS REIMOS DE LAS PENDEJADAS QUE PONEN LOS DEMAS, POR KE LES CALA QUE EL JARUDO LA RIFA ESE WEY DE LOS MSF NO MAMES WEY TU BARRIO NI SE CONOCE WEY EL JARUDO AHORITA SIGUE SONANDO TALVEZ NO COMO ANTES PERO SIGUE LEVANTADO NOMAS ES CUESTION DE QUE NOSOTROS QUERAMOS Y NOS LEVANTAMOS PERO AHORITA ESTAMOS CHIDA COTORREANDOLA TODOS LOS DIAS, A NUESTRO BARRIO NO ENTRA NINGUN PUTO Y ESOS ES DE A LEY NO PONGAN COSAS MEKAS WEYES SI SU BARRIO ES CULO NI PEDO TRATE DE LEVANTARLO PERO NO POR INTERNET NO SEAS PENDEJO LEVANTELO CON HECHOS QUE SEGUN USTEDES TIENEN CUETES PUES ORALE VATO A TRONARLO NO SON DE COLECCION,, CHIDA WEYES EL JARUDOLOKOS-LBP-RPS.!!

LA RITA ( e-mail: )
Miércoles 11.05.2011 / 11:55
JAJAJAJAJAAA NA TU EL TAL JARUDO NETTA ME REIII EEE HEHEE ON TU APODO XK SI SOY ROCIO PERO REALMENTE NO SABES NADA DE MIIII NOI K PEDOOO AVER PASA TU CORREO PA ACLARAR LAS COSAS DIGO XK AHUEBO K SOY DEL JARUDO ES MAS PREGUNTELE AL PITY PA K VEAS Y DI K ESTOY APOYANDO A MI BARRIO EEE LOS ESTOY DEFENDIENDO HAHAHAAAAA ENTONSES ESPERO TU CORREO AAAA Y SI KIERES ME BOY A OTRO BARRIO SOLO LO SIENTO X MIS AMIGOS Y LOS RPS Y KN PUZO ESO PUDRETE HAHA

( e-mail: PARA RITA ! )
Miércoles 11.05.2011 / 11:02
e mija, ya cayese mejor ala E... puro mal qemon con ud, primero limpiese la pinchi cola bn ya se quien eres eres rocio, eres una pinchi lepa i yano digas nada porqe nadie te conoce estas bn cagada. le dire atu mama i atu papa para qe te pongan una putiza por abladora no sabes ni qe royo en el jarudo ni SALES JAJA! ke risa con tigo LEPA! tirenla alion vatos no es jarudo . ATT JARUDO

cesar ( e-mail: )
Miércoles 11.05.2011 / 10:51
no mamen la veerrga los dos peendejos ese we de los prmamones estan coochados al igual k el jarudo como la ben jejeje demen mas risa jejeje

LA RITA ( e-mail: )
Miércoles 11.05.2011 / 09:44
MUCHAS GRASIAS PRM X DEFENDERME Y PARA EL PINCHI MARIKON DEL CESAR VETE ALA VERGA PENDEJO NO SABES NI KIEN SOY Y AI ANDAS PINCHI MOKOZO ESTUPIDO SI ASI ESTAS TU COMO ESTARA TU BARRIO Y DEJA DE METRTE KON LOS PRM PENDEJO TSS VE Y METETE KON UN BARRIO DEBIL = K SU BARRIO PURO BJL Y PRM Y TE CHINGASTE PENDEJO Y YO NO SOY DE BLA BLA BLA WEY NO TE CONFIES DE MI

PRM ( e-mail: MEXICLES )
Miércoles 11.05.2011 / 05:47
La unica P... que conosco es tu madre y tu hermana y de bastardos solo tu. y la morra de los JARUDOS te pone una putisaa de a 100. ella es de ley no osicon como tu. tu eres como los demas microbios solo corren el osico a lo pendejo.siento que tu no vales la pena ya que lo P... se te ve desde lejooosss.y te lo dice tu padre LA PRM.

CESAR** ( e-mail: BDEU )
Martes 10.05.2011 / 18:12
PRO MAMA VeRRGA NO MAMEN PENDEJOS ASI A LA BRABA ME PELAN LA CHORA PINCHES PRM DE MIERDAS JEJEJE Y ESA PINCHI VIEJA FILIADA K DISK DEL JARUDO TAMBIEN CHINGGEEN A TODA SU PUUTA MADRRE NOMAS DISEN K LAS HIELERAS Y K NO ANDAN CON MAMADAS NO MUNCHO PINCHHI BLA BLA BLA Y ARRE PS DEJENSE KAER O K LES TIEMBLA CULONNES SI PS AY C GUACHA EL COLOR JEJEJE YA C LA SABEN PS PEENDEJJOS THE CESAR BDEU

LA RITA ( e-mail: )
Martes 10.05.2011 / 10:26
ESTA ES UNA CANCION PA LOS PENDEJOS WACHA PERRA EN EL CENTRO DE MI TIERRA K SUENEN LAS BOSINAS QUE EMPIEZE LA GUERRA NO ECHES TANTA TIERRA MEJOR LA BOCA CIERRA K K ELLA PELEA TENGO MAS EN LAS ESQUINAS PANDILLEROS ASESINOS CALLEJEROS VENGA A VER KIEN DOMINA RESIÑA MUCHACHO MEJOR CAMINO BARRIO JARUDO ESCUCHA NUESTRO LEMA TU TEMA SE KEDA MUDO OJOS DIENTES FLOW PERRA K AYAS CENTIDO NO TE METAS CON LA B TE METES CON LA MEJOR!!!TRAIGAN A ZUS SORRAS PERDON DIGO A SUS MORRAS HAHAHAHAHAAAAAAAAHAHAH PURO BJL

PR M ( e-mail: ARVIZU )
Martes 10.05.2011 / 09:31
Gracias Rita, yo se que EL JARUDO ES FIRME.ayer te mande un correo, si lo checaste? orale pues.

la rita bjl ( e-mail: )
Martes 10.05.2011 / 09:25
eiii PRM TIENES MI APOYO SI NESESITAS ALGO ME DISES Y MAS VALE K DEJEN A LOS PRM NETTA PINCHIS PENDEJOS NO SABEN KON KIEN SE METEN NO ANDEN DE CAGA PALO MEJOR ESFUERSENSEN PARA SER COMO LOS PRM Y JARUDO

PRM ( e-mail: BORRACHOS )
Martes 10.05.2011 / 09:14
Para el tal cesar.tu que puedes saver de famas y menos de la PRM,lo mas conveniente es que sierres el osico apestoso.y la PRM le da respeto y la mano a quien lo a ganado y es ES EL JARUDO.como ves,coraje o envidia?? ademas no creeo que tu me vallas a decir donde y cuando escribir.o si?

LA RITA BJL ( e-mail: )
Martes 10.05.2011 / 07:59
NO LES AGAS CASO PRM TU DI LO K KIERAS HEHEHE Y SABEN K CHINGEN A SU MADREE LOS K MOLESTAN AL JARUDO XK SABEN K EL JARUDO SI TIENE HUEVOS NO COMO OTROS AZII QUE NO LES CONVIENE TENERNOS DE ENEMIGOS....

cesar ( e-mail: b d e )
Lunes 09.05.2011 / 19:15
k ese we k esta poniendo k la prm y todo ese pinchi roio tekatote como el we k kreo k lo pone no mames wey losk andan en todo ese roio no andan con estas transas k poniendo H... aderas ni mamando huevos de barrios bale berga como las jaruda no mames wey es el muro del grafiti wey no para poner M... de narcos y asta culon eres we no pones kien eres de atiro vales V... putito

PRM ( e-mail: MEXICLES )
Lunes 09.05.2011 / 14:05
ya fastidiaron estos pendejos,en ves de dar coraje dan lastima y que putos linieros?ustedes son gatos de los azcacas.necesitan pedir permiso para hablar.linia?? linia la que traes en el culooo.ese P... escuincle de los msf dile a mama que ya te deje ver la TV y quedate en casa. puro "PRM Y BJL JARUDOOOOOOO"

LA RITA ( e-mail: )
Lunes 09.05.2011 / 13:32
AAA CHINGADO AORA ASTA TENGO K PONER MI CORREO PA K LO KIERES WEY

LA RITA ( e-mail: )
Lunes 09.05.2011 / 13:26
oiie no te ddaaa verguenza ser de aii :O de ese barrio estupidoo TSS A MI SI ME DARIAAAA HAHAHAAA PURO BJL NO HAY MAS

( e-mail: RPSCREW! )
Lunes 09.05.2011 / 13:25
saca tu correo rita HAHA! qe no te saco

( e-mail: RPS CREW! bjl pacuando quieran JAJA! )
Lunes 09.05.2011 / 13:20
hahahahahah KETRANZA MI DRAW! kerisita campion hahahahah! mire mijo, la ves qe caimos como 50 hahaha eran los pelonsillos i barios jarudos haha como siempre jarudo pues pocos pero lokos, hahaha note miento peqeño preguntale al WIKE! hahahahaha como le iso alberga i lo devolvi a puro cuetazo hahahaha pero el ruko le iso al vergas HAHAHAAHHAHAHAAH! qe miedito un 3 80 NO ABLE mijo, MEJOR CAIGALE! HAHAHAHAHA! no able tanto menos internet i mas accion HAHAHAHAHAHA!

LA RITA BJL ( e-mail: )
Lunes 09.05.2011 / 13:14
PARA EL DRAW SE LOS COCHA MIJO YA ME ABURRIO KN LO MISMOO MIJO SE VALE SOÑAR HAHAHA PERO CREO K DESTRUIR ALOS BJL ES UN SUEÑO K NO SE TE CUMPLIRA NUNCA UPSSS SORRY HAHA PENDEJO BABOSO NO TIENES HUEBOS CABRON PINCHI PENDEJO ME CAES EN LOS HUEBOZ K NO ME DIERON PUTOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOO CHINGA TU MADRE ESTUPIDO BJL K TE KEDE CLAROO SOMOS LOS MANDAMOS

LA RITA BJL ( e-mail: )
Lunes 09.05.2011 / 12:24
NETTAAAAAAAAAA PINCHIS HIJOS DE PUTAA LOS K MOLESTAN AL JARUDO NO ANDEN KN MAMADAS MEJOR BAIIANSEN A VER BARNI EN VEZ DE ASERSE LOS MUY VALIENTES NETTA K ESTAN BIEN PENDEJOS PURO BJL Y PRM NO HAY MAS HAHAHAAAAAAA NETTA YA ME CANSARON CABRONES Y MAS VALE K NO SE LES OCURRA INSULTAR AL SKIT XK AORA ZIII ME LAS VAS A PAGAR PENDEJO BARRIO JARUDO SE COCHA A TU BARRIO PUTO

MR * DREECK COHON ( e-mail: SOMOS DEL V*B*T* COCHONES .AZTECOTAS )
Lunes 09.05.2011 / 11:59
-______________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________-QUE TRANSA PUTOS MEJICLAS BALE BERGA EL DREECK LOS COCHA PUTAS JAJAJJAJAJAJA

PRM ( e-mail: MEXICLES )
Lunes 09.05.2011 / 11:40
SI BJL,PERO LOS OTROS msf NI DE PEDO LA HACEN.SOLO ES ESTE BASTARDO ALUCINADO,TIENE UN OSICOOOTE!!A ESTE PUTO ESCUINCLE msf ME GUSTARIA DARLE VENENO DE RATA PORQUE NO DESQUITA NI UNA BALA.YO PIENSO QUE ESTE VATO VIVE FRUSTRADO POR SAVER QUE NACIO IDIOTA.O TU QUE CREES?ADEMAS SUEÑA CON DERROTAR ALOS JARUDOOOSS!!ESTE msf ESTA PERO SI BIEN PENDEJO ,STUPIDO E IDIOTA.CON EL JARUDO NO PUEDEN Y SUEÑAN CON TERMINAR ALA PRM.DIME SI NO ES DE IDIOTAS.

jarudolokos ( e-mail: )
Lunes 09.05.2011 / 11:22
jaja pinchi jent abaldora como ben mis PRM con estos pendegos..ladran mucho como ben si los callamos lla jaja los msf ME DAN RISA SON PARA MI UNA BROMA BJL`PRM. UNA GRAN UNOS PURA ESKINA

MY DREECK .V* B*T*13 AZTECAS ( e-mail: SOMOS DEL V*B*T* COCHONES .AZTECOTAS )
Lunes 09.05.2011 / 08:47
el dreeck me cocha .jajajajajaja aliniensen traisioneros yano anden chapuliniando ette. tu maton el dreeck

PRM ( e-mail: BORRACHOS )
Lunes 09.05.2011 / 08:14
ESCUINCLE STUPIDOOO,VES MUCHA TV Y YA TE HISO DAÑO Y TU PUTA SN MUERTE ESTA IGUAL DE PENDEJA QUE TU. YA DILE QUE TE QUITE LO PENDEJO.TU NO SABES NI QUIEN ES LA PRM VERDAD?INVESTIGA UN POCO PARA QUE SE TE QUITE LO IDIOTA.NO TE DA VERGUENSA ESTAR TAN INBECIL?ERES UN PUTO MICROBIO INSIGNIFICANTE.Y PARA QUE AGARRES ALGO DE CULTURA PREGUNTALE ALA LINEA Y AZTECAS QUIEN ES "LA PRM"AHH¡DILE A TU STUPIDA SN MUERTE QUE ME LA PASO POR EL ARCO DE LA CALZADA JUNTO CON TIGOOOO....JAAAAAJAAAAAJAAAAA

EL DRAW SE LOS COCHA ( e-mail: MSF FOR EVER DE CORA )
Domingo 08.05.2011 / 21:22
NO TE MORDISTES LA LENGUA PENDEJO NO HAY PEDO TE PUEDO PASAR MI 3 80 PELADA POR TU PINCHE CULO ABIERTO COMO VEZ Y LA SANTA MUERTE NI TE METAS CON ELLA PENDEJO ELLA POR ELLA VOY A DAR CON TIGO UN DIA Y TE VOY A CHINGAR Y K YO LADRO NO MAMEZ WEY Y TU K PENDEJO COMO ME DAZ RIZA NO SABES NI LO K DISES VERDAD???MEXICLES NO MAMEZ WEY K MAMADAZ SON EZAZ K NO TE METES CON CHAVOZ ENTONSES ERES UN PINCHE MOCOSO PENDEJO K NO SABE NADA NI DE LA MAFIA NI DE LOS MEXICLES QUIALQUIER PUTO K ESTE EN LOS MEXICLES O AZTECAZ O LO K SEA IMPORTANTE SE METE CON CUALQUIERA K SE LE PONGA AL FRENTE PENDEJO NO SABES NI MADREZ WEY Y bjl NO MAMEZ WEY EZOZ PUTOS ME DAN LASTIMA AMI SABES POR K NO SALEN DE PENDEJOZ CHAPETES MAMADOREZ Y CHAVALITAZ LA NETHA WEY YA SABES EL DRAW DE LOS MSF TE COCHA prm ME LA PELAS PON TU APODO CULERO SI TE ATREVEZ WEY POR LO MENOZ O ERES TAN CULO K NO JAJAJA YA SABES PURO MSF FOR EVER EL DRAW DE LOS MSF SE LOS COCHA PURO MSF Y MI SANTA MUERTE CUIDA AMI BARRIO POR EZO SEGUIMOZ DE PIE CO

PRM ( e-mail: MEXICLES )
Domingo 08.05.2011 / 12:32
MIRA ESCUINCLE PENDEJO,TU 380 DE JUGETE Y TU STUPIDA SN MUERTE MELAS PASO POR EL ARCO DE LA CALZADAAAA...LA PRM NO SE METE CON MOCOSOS COMO TU,TU QUIERES ECHOS Y TE LA PASAS LADRANDO.ERES UN ESCUINCLE BABOSO QUE AUN NO SABE NI LIMPIARSE EL CULO. AL JARUDO LE DA LASTIMA LOS msf TE IMAJINAS LO QUE USTEDES SIGNIFICAN PARA LA FAMA? USTEDES SON UNA MIERDA MAS EN EL VASURERO.EL JARUDO DESAPARESE POR COMPLETO alo msf Y LA PRM SE QUEDA CON LAS GANAS.USTEDES MUGROSOS NO SON PIEZA PARA NOSOTROS.Y TE LO DICEN TUS PADRESS"LA PRM MEXICLES Y BJL JARUDOOOO."

EL DRAW SE LOS COCHA ( e-mail: MSF FOR EVER )
Domingo 08.05.2011 / 11:49
K PUES BJL Y PRM NO MAMEN WEYEZ LES SEGUIRE CAGANDO EL PALO A USTEDES Y ASU JENTE PENDEJA DE AQUI HASTA K ME LOS TOPE DE FRENTE Y LES DE MUERTE HIJOS DE LA VERGA NO ME INTIMIDADN CON SUS PALABRAVAZ PENDEJAZ NETHA K MEXICLES NO MAMEN DEMUESTRENMELO CON ACCION PUTOS NO CON MIERDA YA OLLERON PAR DE PENDEJOS FUERAS MEXICLES SUPONGAMOZ YA ESTUVIERAN MUERTOS Y KLEN NO ME LA MAMEZ TANTO NI TU RITA YO SE K LES CALA TODO ESTO PERO YO K AGO JAJAJA PURA RIZA PURA RIZA ME DAN ESTOS PENDEJOS NO ENTIENDEN QUIEN ES LA VERGA MSF FOR EVER EL DRAW SE LOS COCHA COMO SIEMPRE AQUI LOS ESPERARE SIEMPRE CON MI 3 80 CON ESO ME ALIVIANO Y CON LA SUERTE K ME DE MI SANTA MUERTE MSF IS MY PUTA LIFE RECUERDENLO PENDEJOS QUIEN ES LA VERGA EL DRAW DE LOS MSF SE LOS COCHA

anonimo ( e-mail: juaritoz )
Domingo 08.05.2011 / 03:53
si msf tomen los consejos que les dan,ustedes aun son niños que merecen crecer y vivir trnquilos.los mexicles o PRM son ojetes son unos acesinos sanguinarios son cartel no son barrio.piensenlo muchachos y no se metan con esa gente acesina que solo les ba adar dolor y sufrimiento a sus mamas y familia.gracias por escucharme.

BORRACHO ( e-mail: ARVIZU )
Domingo 08.05.2011 / 03:10
mira pinche escuincle pendejo,dejate de estupideces porque te estas metiendo en pedos grandes.aun sobran yeleras para ti y los putos mocosos que te acompañan.mejor ya no mortifiques a tu jefita con mas preocupaciones.te lo digo EN SERIO.dedicate a otra cosa y no te metas en problemas de esta tamaño. "te lo dice LA PRM MEXICLES".

JARUDO LOKOS ( e-mail: )
Sábado 07.05.2011 / 20:20
SABES K WE CHINGA ATODA TU MADREEEE WE YA NOS KALMAMOS NOMAS SIGUE KAGANDO EL PALO EL KLEN PUTOSSSSS JARUDO LOKOSSSSSS

LA RITA ( e-mail: )
Sábado 07.05.2011 / 17:03
haaaHaaa EnnseRiioo Q riSSaaaaa :P haaaHaaaaa SSee Cren laa Grannn CCossa PENDEJOOOOOOOO PURO BJL COMO TE DIJE Y TE CHINGASTE Y ME VALE LO K DIGASSS VOLA DE PUTOSSSSSSSSSSSSSSSSSSSS

EL DRAW SE LOS COCHA ( e-mail: MSF FOR EVER DE CORA )
Sábado 07.05.2011 / 13:12
SIMON CAIGANLE POR MI CUANDO TENGAN LOS SUFICIENTES HUEVOZ PAR DE PENDEJOS COMO VEN?????? ???ME PRESTAN ASUS VIJEAZ RRAMERAZ ALIGUAL K SUS JEFAS????===NO MAS PARA ABRIRLES MAS EL CHIQUITO Y DEJENSE CAI JAJAJA CUANDO QUIERAN Y LES CALA BN Y BONITO TODO LO K LES DIGO JAJAJA COMO ME DAN RIZA JAJAJA YA SE LA SABEN EL DRAW DE LOS MSF SE LOS COCHA SIMON CALENSE CON UN WEY CON MUCHOS HUVEOS MSF FOR EVER DE CORA PUTOS COMO VEN EL DRAW Y NO E VISTO K NADIEN SE RIA DE MI Y K ZONDO COMO TE CALAS CON EL NAZ WEY SI TE CHINGA EL NAS TE CHINGO YO PELADA WEY COMO VEZ ME LA PELAS AL IGUAL K LOS BJL Y LOS PRM Y TODOZ LOS ENTRADOZ BALLANSE MUCHO ALA VERGA ASI DE SIMPLE MSF SE LOS COCHA FOR EVER MSF EL DRAW DE LA CUESTA LOKOS RIFA EL DRAW DE LOS MSF SE LOS COCHA COMO SIEMPRE

EL DRAW SE LOS COCHA ( e-mail: MSF IS MY PUTA LIFE )
Sábado 07.05.2011 / 12:50
NO MAMEZ RITA YA MAMAME ESTA OK PENDEJA JAJA COMO ME DAN RIZA SABES EN TU BARRIO SON BN CULOS LA NETHA CHAPETONES DE CHET SIMON COMO EL ZONDO TIRAVA MUCHA MIERDA EL WEY PELONES DE MIERDA SEGUN EL PUTO Y HAORA ME CHAPETEO HAORA SOY BJL NO MAMEZ PINCHE MOCOSO CULON SABES BN K ME LA PELAS PUTO Y K CALLERON NO MAMEZ WEY CALLERON COMO 50 WEYEZ Y NI ASI ISIERON NADA NI AMI BARRIO SE ATREVIERON A ENTRAR POR K POR K POR CULOS SABEN K SON DE AGUA Y YO NO ESTAVA PUTOS CUANDO CALLERON ESTAVA EN EL CHUCO PERO SI USTIVIERA CUANDO CALLERON SI ME LLEVAVA A UNOS 20 DE USTEDES PELADA UNO SOLO DE USTEDES NO CAI PUTOS POR CULOS SIMON PRM NO MAMEN K RESPETO ASUS VIEJAS RRAMERAS JAJA SABEN ECHENME ASUS JEFAS PUTOS AQUI LES DOY POR EL CHIQUITO Y NO MAMEN K ME VA ASER UNA 9 PENDEJO YA YA E TRAIDO UNA 3 80 EN MI CABEZA Y NI ASI PUTOZ SIGO DE PIE COMO VEN HIJOS DE LA VERGA ME LA PELAN BN Y BONITO PURO MSF FOR EVER YA SE LA SABEN SIN DETALLE EL DRAW DE LOS MSF SE LOS COCHA A TODOZ CAIGANLE POR MI CUANDO TENGAN

LA RITA BJL ( e-mail: )
Sábado 07.05.2011 / 07:23
PUROOOOOOOOOOOOOOO BARRIO JARUDOOOOOOO Y PRM NADIEN NOS GANNA

W-FIVE OneS*** ( e-mail: WORLD FIVE ONES )
Viernes 06.05.2011 / 13:31
WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF SHAGYONER SHAGYONER SHAGHYONER SHAGYONER

LA RITA ( e-mail: )
Viernes 06.05.2011 / 11:19
PURO BARRIO JARUDO LOKOS LES GUSTE O NO SIEMPRE VAMOS A MANDAR PRM Y JARUDO SON LOS MEJORES Y LOS K NOS DISEN KOSAS CHINGEN SU MADRE CABRONES ABLAN X PURA ENVIDIA SABEN K NO LA AZEN SON DE LENGUA NOMAS PA K VEAN EL JARUDO ESTA LLENOS DE CHAVOZ CON HUEBOS PURO BJL Y SI NO TE GUSTA PUDRETE UN SALUDO A TOMATE,PITY,SKIT,KLEN,NOX,ZORO,NACY Y AMI NOVIO TE AMO HEHE AKI ANDAMOS JARUDO LOKOZ

JARUDOTE ( e-mail: )
Viernes 06.05.2011 / 11:05
GRACIIAS MIS PRM COMO SIEMPRE DANDOLES ESQUINA CARNALES AHY UN SALUDO PARA TODA LA RAZA DE LOS PRM CHIDA CARNALES CUIDENSE,,,!!

ARVIZU ( e-mail: PRM )
Viernes 06.05.2011 / 10:35
unsaludo a todos los homeboys y morras de "LA PRM Y EL JARUDO" que se vea ese animo al ciennn...puro corazon.

LA RITA BJL ( e-mail: )
Viernes 06.05.2011 / 09:29
PA q se den una QUEMADITTAAA EII YO APOYO AL SONIDO BJL ES CIERTO LO K DISES WEY Y AHUEBO K SIEMPRE SALTAREMOS X EL JARUDO LOS OTROS PINCHIS BARRIOS NOS VALE VERGA LO K LES PAZEEE PURO BJL Y SI NO TE GUSTA PUES TE LA PELASTE

EL SONDO..BJL ( e-mail: )
Jueves 05.05.2011 / 13:19
QUE TRAI PINSHI MOKOSO TU PINSHY BARRIO SIIEMPRE ME LA A PELADO WEY AHY ENTRO CUANDO QUIERO CULERO QUE NO SE ACUERDA COMO NOS CORRIERON WEY PINSHIS NENAS Y SI SOI DEL JARUDO QUE PUTO A USTED QUE LE VALGA VERGA WEY YO LE SALTO POR EL JARUDO Y ASI SEGUIRA SIENDO WEY CUANDO QUIERA CAIGALE DEJE DE HABLAR TANTO WEY TODOS SE HAN DE REIR DE LO QUE PUBLICAS PINSHI MEKO

la rita ( e-mail: )
Jueves 05.05.2011 / 11:58
eii PRM IIA ME BOY ALA CALLLE HAHAHAAAAA DE BAGA BIIE TKM

la rita ( e-mail: )
Jueves 05.05.2011 / 11:54
zimon

BORRACHO ( e-mail: PRM )
Jueves 05.05.2011 / 11:51
YA TE MANDE OTRO CORREO OK.

LA RITA ( e-mail: )
Jueves 05.05.2011 / 11:42
SI YA ME LLEGO HEHEHE NOMAS K NO ZE XK NO PUEDO CONTESTARTE:( AMM BUENNO PERTENESCO ALOS ''RPS'' JIJIJI Y PZ SOE BN DESMADROSSA HAHAHAHAAA

PRM ( e-mail: )
Jueves 05.05.2011 / 11:29
pues si pero si el vato te tiene ley no tienes de que preocuparte . bueno cuando puedas checa tu correo aversi ya te llegaron los correos ok. ya no hagas corejeeessss....

LA RITA ( e-mail: )
Jueves 05.05.2011 / 11:24
COMO K TRANKILA PZ SIII ES COMO NI NOVIO IIA MERO ES AHHHH Q CORAJE :@

PRM ( e-mail: )
Jueves 05.05.2011 / 11:21
TRANQUILA.TODO TIENE SOLUCION.CHECA SI TE LLEGO MI MENSJ

LA RITA ( e-mail: )
Jueves 05.05.2011 / 11:17
AHHHHHHHH ESTOY ENCABROADA ME KIEREN KITAR A MI TOMATTE MENDIGA VIEJA ES MIOOOOO

Laa RITA ( e-mail: )
Jueves 05.05.2011 / 10:55
aaaaH ARRIBA BJL Y PRM

LA RITA ( e-mail: )
Jueves 05.05.2011 / 10:33
MEJOR CONECTATE AL MSN AI PLATIKAMOS MEJOR

PRM ( e-mail: )
Jueves 05.05.2011 / 10:30
Hola rita mi correo es prmarvizuzarazua@hotmail.com

LA RITA BJL ( e-mail: )
Jueves 05.05.2011 / 10:29
EI PRM IIO TE MANDO UNO MEJOR VA PASAME TU CORREO

MY DREECK .V* B*T*13 AZTECAS ( e-mail: SOMOS DEL V*B*T* COCHONES .AZTECOTAS )
Jueves 05.05.2011 / 10:27
BARRIO TRISTE 13 PARA QUE RESPETEN PUTOS DE LA COL. INDEPENDENCIA

LA RITAA ( e-mail: )
Jueves 05.05.2011 / 10:25
O DEJAME TU CORREO YO TE ESCRIBO

PRM ( e-mail: )
Jueves 05.05.2011 / 10:25
YA TE LO MANDE

LA RITA ( e-mail: )
Jueves 05.05.2011 / 10:20
AMMM AVER MANDAME OTRO XK NO HAY NADA TUYO ME MANDAS OTRO VA

PRM ( e-mail: )
Jueves 05.05.2011 / 10:17
ya te mande un correo checalo y me escribes.

LA RITA BJL ( e-mail: )
Jueves 05.05.2011 / 10:13
AMM AVER ZI ME PAZAS TU CORREO X FA PA MANDARTE ORITA MNS VA

LA RITA ( e-mail: )
Jueves 05.05.2011 / 10:07
SI MIRA MI CORREO ES rokerita50@hotmail.com ES SIERTO PRM ESA ES PURA BASURA HEHE AKI PA TODO PRM TIENEN MI APOYO

PRM ( e-mail: BORRACHOS )
Jueves 05.05.2011 / 10:04
Hola Rita y un saludo a todo EL JARUDOOOOO...!! ya deja a esas ratas de basurero no valen la pena lo unico que corren es el osico. si puedes mandame un correo para escribirte o te mando el mio. Bueno saludame a los homeboys del jarudo y alas morras jarudas de corezon.AAHHH!!! y UNA RAYADA DE PUTA MADREEEE A TODOS LOS QUE CHINGAN CON EL JARUDO.

LA RITA ( e-mail: )
Jueves 05.05.2011 / 09:47
PARA EL DRAW SE LOS COCHA VETE ALA VERGA EL K VAS A MAMAR HUEBOS DEL LOS DEL JARUDO ERES TU PENDEJO TE VAS A REVOLCAR PENDEJO VAS A SANGRAR NO TIENES NADA EN DONDE TE MAMAREMOS JAJAJA DAS RISA EN VEZ DE CORAJE CHINGA TU MADRE PINCHI ESTUPIDO Y TAMPOKOO TE METAS KN LA PRM JARUDO LOKOS USTEDES SON LOS MEJORES Y PRM AKI ANDAMOS PA TODO AZI K VAJALE DE HUEBOZ CULERO

LA RITA ( e-mail: )
Jueves 05.05.2011 / 09:42
TU PENDEJO EL DE LOS DEMONIOS VAJALE A TUS HUEBOS ESTUPIDO CLARO SI ESK TIENES AQUI AL JARUDO LO RESPETAS XK NOSOTROS SOMOS LOS K MANDAMOS Y TE CHINGAS PA K VEAS NOSOTROS TENEMOS UN CHINGO DE HUEBOS A NOSOTROS NADA NOS DA MIEDO ESTUPIDO SI NO SABIAS PARESES VIEJA PINCHI PENDEJA DEÇJA DE ANDAR DE CAGA PALOS VETE A VER BARNY ESTUPIDO Y DEJA DE CHINGAR BARRIO JARUDO LOKOS COCHA A TU BARRIO PENDEJO Y ESTUPIDO DE MIERDA

PRM ( e-mail: REVOLUCIONARIOS )
Jueves 05.05.2011 / 09:15
QUE OSICOTE TIENES!!! LO UNICO QUE TU Y TU PINCHE CHUSMA DAN ES LASTIMA.DESDE LEJOS SE VE LO IDIOTA Y PUTOS QUE SON.Y ALAS MORRAS DEL JARUDO LAS RESPETAS. LAS UNICAS PUTAS SON TU MADRE, TUS HERMANAS Y TUS TIAS. PINCHE MUGROSO MUERTO DE AMBRE DE RESPETO NO CONOCES NADAAA...CUANDO SIENTAS LA 9 EN EL PESCUESO TE CAGAS. Y TE LO DICE TU PADRE "LA PRM.." Y QUE PENDEJO????

EL DRAW SE LOS COCHA ( e-mail: MSF IS MY PUTA LIFE )
Jueves 05.05.2011 / 08:42
...MSF...CUESTA...LOKOS...EL DRAW...MSF...FOR EVER...EEMMEE SSEEIISS EEFFE...MSF..MSF...CUESTA...LOKOS...EL DRAW SE LOS COCHA...PURO MSF FOR EVER...YA SE LA SABEN SIN DETALLE... POKOS PERO LOKOTES PUTOS...MSF...EL DRAW...EEMMEE SSEIISS EEFFEE...EL DRAW...DRASE...NAS...DIE...SOAR...SALUDOZ ATODOZ LOS UNIDOS SIMON...MSF...EL DRAW FOR EVER...MSF IS MY PUTA PERRA LIFE FOR EVER...EL DRAW DE LA CUESTA LOKOS MSF COMO SIEMPRE ASIENDO DE LAS SUYAS DONDE QUIERA K ESTE YA SEA EN EL CHUCO O EN TODO JUARITOZ...MSF...MSF...YA SABEN MSF SE LOS COCHA Y EL DRAW TAMBIEN PUTOS...SABEN BN K LES DAMOZ GUERRA DONDE QUIERA K ANDEMOZ SIMON ASI CON MUCHOS HUEVOZ LES DIGO PURO MSF LA CUESTA LOKOS RIFA FOR EVER EL DRAW SE LOS COCHA....MSF...LA CUESTA...LOKOS RIFA...EL DRAW DE LOS MSF...EEMMEE SSEEIISS EEFFEE...MSF...

EL DRAW SE LOS COCHA ( e-mail: MSF IS MY PUTA LIFE )
Jueves 05.05.2011 / 08:12
K TRANZA PINCHES CHAVALITAS DE CHET JAJAJA COMO ME DAN RIZA LOS BJL LA VERDAD COMO LES GUSTA MAMAR VERGA ALA MONI MAMAME ESTA ALA RITA TAMBIEN PASATE POR ACA PARA K ME LA MAMES JAJAJA NETHA JAJA PINCHES MORRAZ PENDEJAZ DE VERDAD Y LOS JARUDOZ A ESCUCHARON PUTOS AL NAZ PURO CHAPETES Y CULOS EN LOS BJL JAJAJA NETHA K SIMON PURO MSF LA CUESTA LOKOS RIFA FOR EVER COMO VEN PUTOS JAJA MSF Y LEVANTAN AL SONDO POBRES PENDEJOS A ESE WEY CASI LO VIOLO JAJAJA PURO CHAPETES LEVANTAN JAJAJA NETHA RIZA ME DAN PUTOS Y EZAZ PUTITAZ DE LOS BJL EMOZ JAJAJA MANDENME UNAZ PUTITAS DE LAS SUYAZ SIMON JAJAJA PURO MSF FOR EVER EL DRAW SE LOS COCHA PURO EEMMEE SSEEIISS EEFFEE EL DRAW SE LOS VUELVE A COCHAR....MSF....DRAW....

DOBLE U EFE UNO ( e-mail: WORLD FIVE ONE )
Jueves 05.05.2011 / 07:28
WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF

PRM ( e-mail: REVOLUCIONARIOS )
Jueves 05.05.2011 / 04:44
CALMEN SU PEDO MORROS PENDEJOS,NO SE METAN EN PEDOS PARA QUE CORREN EL OSICO SI NO LA LIBRAN.MEJOR QUEDENSE EN CASA Y PORTENSE BIEN.

DEMONIOS 3 ( e-mail: TEONER-NCG@HOTMAIL.COM )
Jueves 05.05.2011 / 04:35
QUE TRANZA PUTOS EL TEONER DE LOS DEMONIOTES 3,VALLANSE A LA VERGA LOS JARUDO O QUIEREN QUE NOS HECHOMOS OTRAS CALAQUITAS PUTOS JAJA AY ME SALUDAN AL DOSIL Y AL PANCHO JAJAJAJAJA NCGRAFF LA RIFA PUTOS A LOS DEL INFO TAMBIEN NO LA PELAN WEYES DMS3

LA RITA ( e-mail: )
Jueves 05.05.2011 / 03:08
NOOO MAMES TU ESE DE LOS AZTECAS PINCHI BARRIO PENDEJO AKI NO VENGAN KON MAMADAS AKI PURO BJL Y PRM Y SE FREGARON

PRM ( e-mail: BORRACHOS )
Miércoles 04.05.2011 / 13:24
Ese video es mas biejo que tu P... madre y es jale de los z,ustedes se alucinan soñando despiertos. ya despierten ala realidad,lo unico que ustedes corren es el osicooo.

MY DREECK .V* B*T*13 AZTECAS ( e-mail: SOMOS DEL V*B*T* COCHONES .AZTECOTAS )
Miércoles 04.05.2011 / 13:19
QUE TRANSA CHABALAS AA QUUIII MANDAN LOS AZTECAS DE LA COL.INDEPENDENCIA 1 Y2 ATTE MY DREECK TECOCHA JAJAJAJAJA................http://www.blogdelnarco.com/2011/05/video-la-linea-interroga-integrante-del.html#more JAJAJAJAJJAJA PARA QUE SEDEN UN QUEMONNN PUTOS CHAPETES JAJAJAJAJ V*B*T*13

LA RITA ( e-mail: )
Miércoles 04.05.2011 / 10:32
uffff HAHAHAAAA ME VALEN TODOS LOS BARRIOS PURO BJL

tHe bAbY OnE ( e-mail: sOloS xv )
Miércoles 04.05.2011 / 10:23
MEEE PEEELLAAAN LAAAA VERRGA LOSS PIINCCCHEEE SSDOBLAAADDOOOS DEEEE KAAKAA IJOS DE LA RIATAAA SOLOS XV SOUTH SIDE LOKOS 4:20.............

LA RITA ( e-mail: )
Miércoles 04.05.2011 / 10:19
SIMON WEY SUEÑAS HAHA DAS PENNA NOMAS TU CREES ESO PS DEJAME TE DIGO K AKI EN EL JARUDO LE SALTAMOS NO SOMOS CULOS Y ME VALE VERGAS TU Y TU BARRIO PENDEJO PURO BJL Y TE CHINGASTE

msfk ( e-mail: )
Miércoles 04.05.2011 / 10:14
pura EME SEIS EFEE PUTOS,, JAJA LOS DEL JARUDO SON CULOS EL KLEN PELA VERGA CANA EL NOX PARECE NIÑA EL WEY A TODOS LOS E HECHO CORRER Y ESE MORRA QUE EL SONDO ES BIEN CHAPETE EL CULERO QUE NO ERA DE LOS PELONES Y AHORA ES JARUDO EL WEY JAJAJAJA QUE RISA ME DAN, PODRAN SER MUCHOS WEYES PERO SI SE FIJAN LA MAYORIA SON CHAPETES O CULOS Y NO LE SALEN MSFK RIFA PUTOS (EL NAS PUTOS)

LA RITA ( e-mail: )
Miércoles 04.05.2011 / 09:59
HAAA arriba el jarudoo BJL LOS DEMAS BARRIOS NOS ASEN LOS MANDADOS

monii ( e-mail: )
Miércoles 04.05.2011 / 09:54
saludos a los del jarudo de aca del jarudo haciendas la monii.. saludos al nox,klen,nomy,gun,fiver,mi compita el sondo y el chato que los acabo de conocerr,skit,stik,tomate,yesk,a mi panchito que en paz descanze y a todas las jarudas,

MR * DREECK COHON ( e-mail: SOMOS DEL V*B*T* COCHONES .AZTECOTAS )
Miércoles 04.05.2011 / 09:51
http://www.blogdelnarco.com/2011/05/video-la-linea-interroga-integrante-del.html#more

LA RITA ( e-mail: )
Miércoles 04.05.2011 / 09:49
EL JARUDO ES EL MAS CHINGON AUNQUE LES CALE

MY DREECK .V* B*T*13 AZTECAS ( e-mail: SOMOS DEL V*B*T* COCHONES .AZTECOTAS )
Miércoles 04.05.2011 / 09:24
JAJAJAA LLE GOOOO EL GOBIERNO PUTAS JAJAJAJ DE LOS AZTECAS CONTROLANDO TODO EL PEDO EY LES DEJO UN VIDEO PARA QUE SE LO QUEMEN LOS CONTRAS ATTE. MY DREECK COCHON LINPIANDO LA PLAZ DE LA GENTE DE LA CHAPIS JAJAJAJAJA TUBANDO CABESAS CAIGALE ESTAMOS SIENPRE FIRMES PUTAS ATTE DREECK .DE LA COL. INDEPENDENCIA 1 Y 2

juaritoz ( e-mail: )
Martes 03.05.2011 / 11:27
no se te quita lo idiota,pues como si naciste stupidooooo. ya despiertaaaa.

WF COCHA ( e-mail: DABLIU EF UNO )
Martes 03.05.2011 / 10:10
WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF

SHAGYMAN ( e-mail: WFSOTES )
Martes 03.05.2011 / 10:07
K ROIO K ROIO PUTITO DE LOS PBC NOS PELAN LA BERGA MIS CHAVOS YA NI POR K ESTABAMOS DISKE EN SU BARRIO NOS ASIAN DE AGUA PUTITOS JEJEJEJE Y ESE WE K LES ENFIERRE K ROIO MIS CHAVOS JEJEJEJE YA SABEN KIN SOY MIS NENAS BY SHAGYMAN BARRIO WF1 LOS COCHA YA SABEN DE DONDE TIERRA NEW 1 JEJEJEJE

LA RITA ( e-mail: )
Martes 03.05.2011 / 07:45
ES TODO PRM YA SABEN TIENEN MI APOYO GRASIAS X APOYAR AL JARUDO Y AHUEBO K APOYO A MI BARRIO ESTOY ORGULLOSA DE EL JARUDO, BJL SOMOS CHINGONES Y PRM TAMBN JUNTOS COCHAN A TODOS LOS BARRIOS

PRM ( e-mail: MEXICANOS )
Martes 03.05.2011 / 07:30
la PRM apoyando al jarudo y un saludo a todos y todas los homeboys del jarudo y PRM borrachos. y felicidades por las morras que reprecentan su barrio especialmente a Rita. con respeto un PRM.

LA RITA ( e-mail: )
Martes 03.05.2011 / 07:03
AHUEBOOOOO PURO BJL NADIEN COMO NOSOTROS IIO LA RITAA ESTOY ORGULLOSA DE MI BARRIO SOMOS CABRONES

PRM ( e-mail: borracho )
Martes 03.05.2011 / 06:22
ESA ES LA GENTE BONITA ME GUSTA ESE APOLLO. Y CLARO QUE APOLLAMOS AL JARUDO.

LA RITA ( e-mail: )
Martes 03.05.2011 / 06:06
le mandoO un SaaLuDoo0 aaaL PITY,SKIT,NOX,TOMATTe...LoOs Quieroo tambn a toOdos los deL jarudoO aQii tiennen mi apoYoO PURO BJL AHUEBOO

la RITA ( e-mail: )
Martes 03.05.2011 / 04:02
NETTAA NINGUN BARRIO SE COMPARA COMO EL JARUDO NOSOSTROS NO SOMOS CULOS NOSOSTROS SI LE ENTRAMOS Y PARA LOS PENDEJOS QUE DISEN COSAS DEL JARUDO VAIIAN Y CHINGEN A SU MADRE NOS VALE VERGAS LO K DIGAN COMO DISE LA CANCION BOLA DE PUTOSS

JARUDOTEE ( e-mail: )
Lunes 02.05.2011 / 13:11
aquii estamos mis PRM puestotes siempre con ustedes para dar esquiina,, estos aztequillas no la arman carnal netha sin M... los del jarudo emos hecho de awua a dos tres de ahy

PRM ( e-mail: BORRACHOS )
Lunes 02.05.2011 / 12:55
GRACIAS JARUDOS,Y ESTOS AZCACAS NADAMAS CORRIENDO EL OSICO.POBRES PENDEJOS QUE SUEÑAN DESPIERTOS.SON TAN CULOS QUE NO QUIEREN VENIR POR 2 DE SUS CAMARADAS.PUES QUE VALOR DE GENTE?? ANIMO JARUDOS PORQUE USTEDES LA ESTAN ASIENDO MACHIN Y TIENEN CHINGO DE CORA Y RESPETO.

RITA BJL ( e-mail: rokerita50@hotmail.com )
Lunes 02.05.2011 / 12:11
ARRIBA EL BARRIO JARUDO LES PESE A KN LES PESE PURO BJL....(y)

JARUDOTEE ( e-mail: )
Lunes 02.05.2011 / 12:01
callese wey los aztecas ni la rifan cana la netha los jarudo emos hecho de agua a dos tres que son aztecas P... no nomas porke andan tinteados piensen que la rifan putos,, no valen V... putos ya dejen de tirar tanta M... weyes agarren el rollo P... no sean mekos weii,,sengun ustedes hacen de awua al chapo y ke la V... si eso fuera ya lo hubieran tronado pero no lo hacen porke son culos,, ay un saludo a los PRM CARNAL aqui el jarudo y a dos tres carnalitos que estan en la torcida que son PRM tambn saludos carnales jarudolokos,,

MY DREECK .V* B*T*13 AZTECAS ( e-mail: SOMOS DEL V*B*T* COCHONES .AZTECOTAS )
Lunes 02.05.2011 / 11:03
sSOI EL DREECK COCHON JAJAJAJAA LE DUELA A QUIEN LE DUELA PERRAS JAJJAJAA AZTECAS COCHAMOS

mexico ( e-mail: )
Lunes 02.05.2011 / 10:45
ese video es bien pinche biejo,y es jale de los z, los putos linieros ni celular traen se alucinan viendo jales en TV y sueñan que son ellos.pero la realidad es que son culos solo roban stereos y viejitas inocentes.

PRM ( e-mail: MEXICANOS )
Lunes 02.05.2011 / 10:11
PENDEJO,NO SAVES NI LO QUE DICES.USTEDES AUN JUEGAN MAQUINITAS Y CUAL PLAZA? EL MERCADO? "LA PRM" ES MUY SUPERIOR A CUALQUIER PUTO azcaca Y SEGUIMOS BORRANDO LINEASSSS. Y LLA LO EMOS COMPORBADO. O NOOOO?

MY DREECK .V* B*T*13 AZTECAS ( e-mail: SOMOS DEL V*B*T* COCHONES .AZTECOTAS )
Lunes 02.05.2011 / 04:50
ATENSION PUTAS BEAN ESTE VIDEO PERRAS JAJAJAJAJA DE LA COL.INDEPENDENCIA 1 2 ATECAS ------------JAJJAJASOMOS LOS QUE ANDAMOS LINPIANDO LA PLAZA DE LA GENTE DE EL CHAPIS GUZMAN ATTE MR.DREECK .http://www.mundonarco.com/2011/05/video-en-donde-la-linea-de-el-cartel-de.html

PBC ( e-mail: LOCOTES )
Lunes 02.05.2011 / 04:09
SABES K PINCHES JARUDOS,MSF,MSH,SWK,WF1 VALLAN Y CHINGEN A SU MADRE ASY DE FACIL K LOS WF NO SE ACUERDAN DE LAS CHINGAS K LES PONIAMOS EN LA #75 JUNTO CON LOS BAJEÑOS Y ALOS OTROS PENDEJOS LOS IBAMOS A CUETIAR PARESIAN HORMIGAS PENDEJOS Y MEJOR LOS MSH CREO K SON LOS MONSTER MEJOR NO SE PONGAN A DESIR NADA Y TODOS BALLANSE ALA VERGA PUTOS TIRAS MUCHA MIERDA JARUDO YA TE KIERO BER EN UNA RIÑA CON NOSOTROS PARA IRNOS RESIO YA SELA SAVEN PENDEJOS A CHINGAR SU MADRE PUES PBC COCHA

juarez ( e-mail: )
Lunes 02.05.2011 / 03:05
ERES UN PENDEJO,MENTIROSO,OCICON Y JOTO IGUAL QUE TODOS LOS DISQUE msf.PURAS NIÑAS DE MAMA.

SHAGYSTER ( e-mail: WORLD FIVE ONES )
Domingo 01.05.2011 / 18:48
JEJEJEJEJE PS AY C MIRA EL COLOR DE MIS CHAVOS JEJEJEJE K PIENSAN K C COMEN AL MUNDO JEJEJE BARRIO DOBLE U EFE UNO JENTE NOMAS NO MUCHA FELONIA MIS CHAVOS

Jarudolokos ( e-mail: )
Domingo 01.05.2011 / 11:41
jarudo la rifa canas ya haganse a la costumbre de escuchar esoo,,

MSH 17 ( e-mail: )
Domingo 01.05.2011 / 11:23
pinches hea msf bjl pelones y tofos los barrios de juaritos son culos upura emesehere

mc trak ( e-mail: trak.18@hotmail.com )
Sábado 30.04.2011 / 13:36
LA SWK PUTOS DESDE JUARITOS CONTROLANDO PINCHE GENTE CULERA DE LOS SUT Y TODOS LOA DEMAS CHAVALAS VALEN PUERA VERGA CULEROS A LA VERGA CON EL RESTO A HUEVO CABRONES PINCHES BARRIOS CULERON Q HAY APRENDAN A LA SWK CABRONES Y ARRIVA JUAREZ PUTOS CHUPEN PURA VERGA JAJAJA

wFSOTeS ( e-mail: WORLD FIVE ONE )
Sábado 30.04.2011 / 12:49
ARRE ARRE JENTE K C WACHE MACHIN EN EL MURO K ROIO MIS CHAVOS JEJEJEJEJ ay nomas para k C ENCANDILEN PARA Y DESDE TIERRA YORK OK SHAGYONER WF1 SHAGYONER WF1 SHAGYONER WF1 SHAGYONER WF1 SHAGYONER WF1 SHAGYONER WF1 SHAGYONER WF1 SHAGYONER WF1 SHAGYONER WF1 SHAGYONER WF1 SHAGYONER WF1 SHAGYONER WF1 SHAGYONER WF1 SHAGYONER WF1 SHAGYONER WF1 SHAGYONER WF1 SHAGYONER WF1 SHAGYONER WF1 SHAGYONER WF1 SHAGYONER WF1 SHAGYONER WF1 SHAGYONER WF1 SHAGYONER WF1 SHAGYONER WF1 SHAGYONER WF1 SHAGYONER WF1 SHAGYONER WF1 SHAGYONER WF1 SHAGYONER WF1 SHAGYONER WF1 SHAGYONER WF1 SHAGYONER WF1 SHAGYONER WF1 SHAGYONER WF1 SHAGYONER WF1 SHAGYONER WF1 SHAGYONER WF1 SHAGYONER WF1 SHAGYONER WF1 SHAGYONER WF1 SHAGYONER WF1 SHAGYONER WF1 SHAGYONER WF1 SHAGYONER WF1 SHAGYONER WF1 SHAGYONER WF1 SHAGYONER WF1 SHAGYONER WF1 SHAGYONER WF1 SHAGYONER WF1 SHAGYONER WF1 SHAGYONER WF1 SHAGYONER WF1 SHAGYONER WF1 SHAGYONER WF1 SHAGYONER WF1 SHAGYONER WF1 SHAGYONER WF1 SHAGYONER WF1 SHAGYONER WF1 SHAGYONER WF1 SHAGYONER WF1 SH

JARUDOTE..!! ( e-mail: )
Sábado 30.04.2011 / 09:57
WACHEN PINCHIS PBC USTEDES NI SE CONOCES WEYES NO LA PELAN ASI DE SIMPLE PORESO NO TE PONDRE MUCHA ANTENCION WEI LOS HACEMOS DE AGUA Y APARTE DE ESO CUANDO EN TU BARRIO SON COMO 15 WEYES EN EL MIO SON MAS DE 200 PENDEJO PREGUNTELES A TODOS LOS BARRIOS QUIENES SON LOS DEL JARUDO,,Y A LOS DMS YA NO AHY PARO CON USTEDES WEYES PORKE LOS MORRILLOS LOS DE LOS NCG LA CANGAN MUCHO EL PINCHI NEGRO DEL DEKORE SE CREE LA VERGA Y ES UN PINCHI MOKOSO QUE NO VALE VERGA LA NETHA WEYES, NOMAS ANDA DE BULE CAGANDO EL PALO Y DE RATO NO SE CREAN NOMAS POR QUE TRAIAN PARO CON LOS DOBLADOS SE CREIAN MUI VERGAS LOS NCG PERO LA NETHA PELAN VERGA WEYES DE RATO LES CAEMOS PARA TOPARNOS DE FRENTE Y YA SE LA SABEN QUE NOSOTROS SI NOS LLEVAMOS DOS QUE TRES CALAVERITAS DE USTEDES NO NOS ANDAMOS CON MAMADAS PUTOS,, JARUDOLOKOTES

PRM ( e-mail: BORRACHOS )
Sábado 30.04.2011 / 09:52
ESOS PAIZAS,UN SALUDO A TODOS LOS QUE LEBENTAN SU BANDERA MACHIN. ANIMO,SIGAN REPRECENTANDO Y PARANDOSE POR SU RESPETO.CON RESPETO "LA PRM"

PBC ( e-mail: LOCOTES )
Sábado 30.04.2011 / 08:11
DIJE K NO ESTOY ENTRADO CON EL JARUDO PERO EL PINCHE PERRO DELOS MSF O COMO SE LLAME SU BARRIO PERO TIRA MUCHA MIERDA EL GUEY PERO COMO KIERA EL PINCHE JARUDO K PÌENSA K NOS BA ASER DE AGUA EL HIJO DE PERRA POS NO SELA VA APELAR EL HIJO DE PUTA PINCHE PERRO AS DE SER UN PINCHE MOCOSO CULO K NO ALLA NI K ASER MEJOR EMPINATE PA DARTE POR EL FUNDIYO LOS DOS BALLANSE A LA VERGA PUTITAS Y YA SELA SABEN PBC LOS COCHA TRABESTIS

jaja ( e-mail: )
Sábado 30.04.2011 / 04:15
eyeyeyeye k ese mentado solano k ese wey k nomas esta de mama huevos jejejeje es el muro del graffiti che peendejo ya cambia de pajina mi mama choras

sparki ( e-mail: )
Sábado 30.04.2011 / 03:42
guacha jarudo nosotros no sabemos quien corrio esa mamadora de que queremos pedos con ustedes jarudo y demonios siempre a estado firmes y aunque an caido algunos carnales estamos bien firmes y les brindamos respetos jarudo y dms 3 rip por el pancho era amigo de una de nuestra chompas el camote rip jarudo

solano ( e-mail: juaritoz )
Viernes 29.04.2011 / 12:33
tranquilo pariente,se te ba aderramar la bilis!! pues que no te muerdes la lengua cada ves que hablas? ademas nadie te cree tu valentia todos los que estamos en el muro nos reimos de todo lo que escribes.ya conocemos tu gente corriente.

SHAGYMAN ( e-mail: WFsOTeS )
Viernes 29.04.2011 / 12:22
PS A LA VEERRGGA EL PAPA BARRIO WF1 DE TIERRA NUEVA Y C CHINGO OK SOBRES PS MIS CHAVOS YA C LA SABEN WORLD FIVE ONE SHAGYONER

solano ( e-mail: juaritoz )
Viernes 29.04.2011 / 11:43
eso si da risa,yo soy el que anda solo y la verdad los msf son puro chiste divertidos estos vatos. mas de una ves me los e topado y les e cantado un tiro y no amarran. porque me tienen miedo si soy solo? porque son culos y ocicones. ya lo tengo comprobadooooo.

EL DRAW SE LOS COCHA ( e-mail: MSF IS MY PUTA LIFE )
Viernes 29.04.2011 / 11:28
K TRANZA PINCHES CHAVALITAS DE LOS HEA AMARRENSE UN HUEVO PUTOS POR CHAPETONES CULEROS VALLAN AMAMARSELA ALOS PELONES DE MIERDA MIERDA Y MIERDA SE COMPRENDEN SIMON HOY YA SE JAJAJA DONDE KIERA K NO LOS TOPEMOZ PUTOS DE LOS HEA LOS VAMOZ A DESMADRAR ASI DE SIMPLE PUTOS ESTAN EN TERRENO MSF LA CUESTA PUTOS NUESTRA ZONA SOLO QUIERO DESIR K LOS HEA DE LA JILOTEPEC BUENO DE LA MORELIA SON UNA BOLA DE CHAPETES NO SON NI MADRES LOS PENDEJOS SON DE AGUA EL DRAW SE LOS DISE PUTOS CAIGANLE AL BARRIO PUTOS PARA DARLES EN SU MADRE O QUIEREN K VALLAMOZ POR USTEDES PENDEJOS PURO MSF FOR EVER EL DRAW COMO SIEMPRE Y LOS BJL VALLANSE ALA VERGA SABEN K EN DONDE QUIERA K ESTEN NO LA PELAN Y EL GUN PARA K PONES SKOR PENDEJO YA SE K ERES TU PINCHE MOCOSO Y YA SE QUIEN ERES PUTO ASI K AMARRATE Y TUS VIDEO NO MAMES JAJAJA MI ABUELITA LOS ASE MEJOR JAJAJA TIENE MAS FLOW K USTEDES PELADA JAJAJA MSF LA CUESTA LOKOS RIFA FOR EVER EL DRAW SE LOS COCHA PUTOS COMO VEN

HeAcK1 LoRsWaaN1 ( e-mail: )
Jueves 28.04.2011 / 20:04
AKI EL LORS REPORTANDOSE PURA SOUTH SIDE 13 AND TS

JaRUDOTE..!! ( e-mail: )
Jueves 28.04.2011 / 18:39
vallance a la V... PBC a nosotros nos gusta estar entrados con todos los barrios porke traemos el power que ningun barrio trae todos no la pelan,, y para los del jarudo es un orgullo pertenecer al barrio putos,, nadiee nos tumba canas andemos solos o en manada siempre le salimos por eso nos conosemos y si te topamos solo te marraniamos porke asi somos no perdonamos a nadiee canas pa ke se calen JARUDOTELOKOS

el que anda solo ( e-mail: juarez )
Jueves 28.04.2011 / 11:27
no se te entendio nada,porfavor explicate.no te molestes solo que tu mensj esta muy enrredado y confuso.gracias.

PBC LOCOTES ( e-mail: )
Jueves 28.04.2011 / 11:05
VAYAN Y CHINGEN ASU PERRA MADRE MUY VERGAS CAIGANLE A MI BARRIO NUNCA EMOS MAMADO ANADIE Y NO TENEMOS MUCHO NADAMAS COMO 7 AÑOS PERO VIEN VIVIDOS PUROS PBC PUROS PINCHES MALANDROS DELINKIENDO Y NO TIRAMOS MUCHA MIERDA AY CUANDO KIERAN CAERLE AMI BARRIO POR VERGA AY SI SOY DE LOS MSF NO ESTOY ENTRADO CON LOS DEL JARUDO Y TAMPOCO SOMOS GENTE PARA K NO PIENSE EL CREW O COLE DIGAN A ESE PENDEJO DE LOS MSF K ME MANDO EL JARUDO Y HAY ESTAMOS PINCHES PIRUJAS E PBC LOCOTES

BORRACHOS ( e-mail: MEXICANOS )
Jueves 28.04.2011 / 09:19
cual plaza controlan?? solo que el mercado donde sus hermanas compran verduraaaa!!! ustedes ya no tienen plaza o quieren mas yeleras?? puro PRM BORRACHOSSS y vengan por sus 2 camaradas o los ban a negar.

MY DREECK .V* B*T*13 AZTECAS ( e-mail: SOMOS DEL V*B*T* COCHONES .AZTECOTAS )
Jueves 28.04.2011 / 07:19
---------------------QUE TRANSA CHAVALAS A QUI CALLANDO DOSTRES CULONES COMO LOS MEXICLES PURO AZTECAS CONTROLANDO LA PLAZA CARTELOLTE DE JUAREZ AZTECOTASS CAIGALE ESTAMOS EN LAS COL. AZTECA Y SATA MARIA GALIANA MORELOS INDEPENDENSIA 1 Y 2 FRANCISCO I MADERO REVULUSION COTROLANDO AL CHAPO BALE BERGA ATTE.DREECK.................ME COCHA ...........-------------------JAJAJJAJAJAJAJAJAJJA

el kozZa ( e-mail: )
Jueves 28.04.2011 / 06:19
nomamen bola de P... aka puro kzv kanas pelan todos aka de eco 2000 rifando

sHAGyOneR* ( e-mail: wORlD FiVe One )
Jueves 28.04.2011 / 04:12
MMMMMM PS A LA VEERRGA TODO LO DE MAS BARRIO DOBLE U EFE UNO DE TIERRA NEW 1 MIS cHAVOS OK wF1 bY TIERRA NUEVA 1 THe sHAGyOneR*

Jarudotess..!! ( e-mail: )
Jueves 28.04.2011 / 04:06
para que maman al antro jajajaja ese wey es de awua cana no la pelan putos,, JARUDOLOKOTESS..!!

eL LoRsWaaN1 ( e-mail: )
Miércoles 27.04.2011 / 20:10
ANDEN PINCHES CHAVOS NO NOS MAMEN KUANDO KIERAN KAIGANLE A LA JILO ESA ES DE NOSOTROS SUREÑOTES LOKOS DE LA HEAK 1 AND HEANTRO1

nsl18 ( e-mail: )
Miércoles 27.04.2011 / 19:58
ponganse vergas todos los HEA pinches mocosos culos valen V... son como 50 y nadamas le salen el lors el antro todos los demas son chavalas mis repetos para ellos trucha pinches levas atte:NORTH SIDE 18

BJL ( e-mail: )
Miércoles 27.04.2011 / 16:31
arres mis PRM aqui estamos,, seguimos en contacto carnales aqui estamos para lo que serse ya se la saben,, somos gente y somos mexicanos orgullosamente..!! JARUDOTE

PRM ( e-mail: BORRACHOS )
Miércoles 27.04.2011 / 14:46
Como estan mis jarudos? aca en el centro del mapa todo bien. ya no hagan caso a esos chamaquillos que dicen puras tarugadas toda esa gente esta ardida porque saven que no la libran, ya ves dice el solano que los msf no le atoraron a un vato que anda solo!!!! esa gente solo corre el ocico. sobres pues... PURO SENTIMIENTO JARUDO PURO ORGULLO MEXICANOOOO...

sur side 13 ( e-mail: surcrow@hotmail.com )
Miércoles 27.04.2011 / 13:06
q rollo jarudos que tan cierto es que andan de sicarios los de un barrio de ahy los LBP?? o es puro rollo ese o kee..!!

JARUDO ( e-mail: )
Miércoles 27.04.2011 / 11:53
que tranza weyes el jarudo sigue representando juaritoz putoss,, un saludo pa los PRM ahy estamos gentee..!! JARUDOLOKOS

j.l ( e-mail: esojodagled_otrebor@yahoo.com )
Miércoles 27.04.2011 / 11:49
cabron con q me topo vieno estas pajinas pero lo q leo son puras M... por ninguno es sierto lo q dise por sur es el mas H... o sstk zaragosa

JARUDO ( e-mail: )
Miércoles 27.04.2011 / 11:35
JARUDO EL LA VERGA ES UNJ BARRIO REAL Q NO ANDA CON MAMADAS Y SIGAN DE ABLADORES TODSO ESOS .NIñOS .garduo la rifa donde se pare bjl ,,saludo para los PRM..BJLOKOS

( e-mail: )
Miércoles 27.04.2011 / 06:50
asi me gusta weyes k c callen el pincgi ocico cuando wachen k les dicen la neta C... jajajajaja y eso es poco de lo k les puedo segir diciendo cabrones jajajajajjajajaajajjajajaja

Jarudo..! ( e-mail: )
Miércoles 27.04.2011 / 05:43
wacha cana nosotros si sabemos quienes hicieron el barrio pendejo,, pero eso no es lo que importa wey lo que importa es que lo hicieron hace un H... o de años y nadie nos a tumbado P... como vez,, aqui seguimos puestotes cana, ahy barrios enteros wey de 20 o 30 weyes que tiran culon y prefieren hacerse del jarudo porke saben que si se entran con nosotros no la cuajan puto..!! no nomas hablen por hablar weyes al jarudo nadie lo va a tumbar nunka putos..!! JARUDOLOKOS..!

( e-mail: )
Miércoles 27.04.2011 / 03:15
yo k nisikiera soy de sus pinchis barrios se mas k ustedes pinchis mocosos son de leche todabia weyes a un barrio se le respeta cuando yevandola de perder no se rajan con los jarudos nos paso eso 2 ke 3 veses por eso les tengo respetillo pero eso fue muchos anos yo andaba con mi carnal y no sabia k royo pero ahora huacho k si le salian ...los msf no tenia k ser barrio se suponia k era un crew de grafiteros pero no salio asi.bueno eso es algo de lo k yo c

( e-mail: )
Miércoles 27.04.2011 / 02:49
jajajajajajajaja kien saco a los msf t apuesto k ni sikiera sabes bato y no soy del jarudo pa k sepas wey , y ni los chavillos del jarudo saben kien levanto su barrio,para tirar barrio deben de conocer kien lo iso y kienes lo levantaron no nomas tirarlo weyes

Jarudo..! ( e-mail: )
Martes 26.04.2011 / 17:22
simon PRM,, a estos weyes ahy que dejarlo que hablen no la arman tiran mucha mierda, son de esos weyes que nomas por aqui hablan y hablan,, al jarudo nos gustaq que nos demuestren con hechos putos sin nos van a tronar nomas haganlo y no digan tantas P... lo que vallan a hacer haganlo,, y acuerdense weyes los mas vergas caminan callados,,EL JARUDO SIEMPRE PUESTOTE

PRM ( e-mail: MEXICANO )
Martes 26.04.2011 / 13:57
fijense pues,los MSF dicen que ya tienen muchos años y no sirven para nada pinches coyones viciosos.y EL JARUDO apenas 3 años y ya traen H... o de respeto pues PORQUE SERAAA???? porque EL JARUDO LO DEMUESTRA y los msf SOLO CORREN EL OCICOOOO. ESTOY DEACUERDO CON EL VATO QUE ANDA SOLO LEEAN ESE MENSAJE AQUI ABAJO.

JARUDOLOKOSS..!! ( e-mail: )
Martes 26.04.2011 / 12:06
Kiieres apodos pues yo soi el kleens P... como la vez,, no mame wey el jarudo esta antes de que se hicieran tus pinchis ratoneras,,!! agarre el rollo wey nunka le emos corrido a los msf jaja si hace poquillo cuando fuimos con los pelones no salieron corriendo todos weyes,, son culotess,, no la arman putos es la netha cuando quieras caile y hazme correr como dices jajajajaja.!!

EL DRAW SE LOS COCHA ( e-mail: MSF )
Martes 26.04.2011 / 11:06
JAJAJA PINCHES JARUDITOS DE CHET COMO ME DAN RIZA POR K DISEN PURAZ MAMADAZ WEYEZ NO SABEN NI K PEDO VERDAD PINCHE MOCOSO PENDEJO K DISKE 18 AÑOS TIENEN JAJAJA APENAS LLEVAN COMO 3 WEY NOSOTROS ISIMOZ LA MSF ASE UN CHINGO DE TIEMPO WEY ANTES DE K TU NACIERAZ PENDEJO SABES TE DIGO ALGO WEY SE ISO LA MSF PRIMERO PUTO ANTES K LOS PINCHES JARUDO DE MIERDA TALVEZ LOS LONGOS DE TU VARRIO CAGADO LO ISIERON Y LO CREEARON WEY EZOZ SI MIS RESPETOS WEY PARA K DIGAN... PERO LOS K ESTAN HAORITA NO VALEN VERGA ASI ES JAJA DONDE QUIERAN K ME LOS TOPE SIEMPRE LOS AGO DE AGUA SIMON Y TE LO DIGO WEY ASI DE PELADA PREGUNTALE ATU PINCHE KINDER DE HOY COMO CORREN DISIENDO MAMI MAMI ME QUIERE MATAR UNO DE LOS MSF Y LE DISEN EL DRAW SON BN CULOS LOS PRM ASI DE SENCILLO0 IGUOAL K LOS BJL NI APODO PONEN LOS CULOS POR K SABEN BN K ME LA PELAN Y DONDE QUIERA K ME LOS TOPE LES DOY SUELO NO POR NADA ME DISEN EL DRAW Y YO SOLO PUTOS LOS BARRO A TODOS DESDE SU PICHE BARRIO CAGADO K DISEN K HAY FRESAS NO MAMEN EN M

( e-mail: )
Martes 26.04.2011 / 10:31
VAGOTES

JARUDOLOKOSS..!! ( e-mail: )
Martes 26.04.2011 / 10:22
wacha cana pareceremos limosneros como tu dices, pero aun asi nos tiemblan todos los barrios en juarez wey, quiero verte decir eso en el barrio, te apuesto a que caminando no entras wey y sabes porke porke nomas hablas y hablas pero sabes que el jarudo la rifa y sabes que ninguno del jarudo se te hace para atras y si entras sales bailando a plomazos canaa, aqui hasta el mas morrillo si no trai cuete ya deperdida trae su hechiza pero le saltaa,, agarren el rollo weyes con el jarudo no pueden..!!

( e-mail: )
Martes 26.04.2011 / 10:09
jajajajajajaja simon parecen limosneriyos en el video en ves de asustar dan lastima jajajajajaja.... en una rola mensionan pelon toto y a otro..en donde kedo el pancho k no era el lider o algo asi,

( e-mail: )
Martes 26.04.2011 / 09:56
orale ese kienes son los k estan entrados con jarudo ponganse firmes vatos x k el jarudo sigue en el juego simon k si la BJL desmadra k no!!!! arre putos salganle

JARUDOLOKOSS..!! ( e-mail: )
Martes 26.04.2011 / 07:22
GraciAS mis PRM aqui tambiien los respetamos, son gente que le sale por el color de su bandera mexicana y eso es de respeto nunka olvidar cuales son tus raices..!! PRM para lo quenecesiiten ahy estamos,,BJL

PRM ( e-mail: MEXICANOS )
Martes 26.04.2011 / 07:14
SALUDANDO A TODOS LOS JARUDOS Y BORRACHOS DE CORAZON PURA RAZA FIRME ANIMO GENTE USTEDES SON PURO RESPETO Y LO AN GANADO CON ECHOS COMPROBADOS Y NO PALABRAS.

JARUDOLOKOSS..!! ( e-mail: )
Martes 26.04.2011 / 07:12
NA carnal a nosotros no nos afecta lo que piensen los demas barrios,,puede que el del video que dices se vea perilla pero caigale al barrio wei y ahy mushos que se ven mekones o fresas pero no les tiembla para darte en la madre y eso es lo ke importa carnal,, chida lokos del jarudotee..!!

( e-mail: )
Martes 26.04.2011 / 06:55
ey jarudos diganle al gun k no suba fotos de mocosos gordos k no son maliyas del barrio,la neta pura kemason suban fotos de ustedes ,el gun sube fotos bien cagadas neta cualkier kabron se rie de los videos estan bien culerotas y todos piensan k asi son todos los jarudos jajajajaja

juarez ( e-mail: )
Martes 26.04.2011 / 06:48
esos MSF son bien coyones,solo tienen ocico para ladrar no atoran ya los e checado y valen madre, soy solo no ando con nadie y ningun P... de los disque MSF me asusta son bien culones. esos P... son de agua ya los e checado.

JARUDOLOKOSS..!! ( e-mail: )
Martes 26.04.2011 / 06:23
aqui el jarudoo,, como siiempre levantando banderaa..!! la seguiremos rifando entre los barrios locales le pese a quien le pese weyes,, somos la pandilla que la rifa y son tener ningun paro solitos los hacemos de awua a todos..!! jarudolokoss

( e-mail: )
Martes 26.04.2011 / 04:56
pinchis demonioas como k son 2A pues no k solos pueden pinchis chaketas !!!!aki puro de juaritos .la _____________ controla x k somos locales

( e-mail: )
Martes 26.04.2011 / 04:26
como se yama el rapero del jarudo..le dicen el gun pero cual es el nombre

( e-mail: )
Martes 26.04.2011 / 03:51
ese P... d la msf m da risa no sabe ni kien invento ese crew pobre P... y dice k msf for life jajajaja ... son de agua chavalas!!!!! apenas tienen unos 8 anos k c invento y dice k ya controlan juarez jajajajaaja...todabia tienen k pasar x mucho apenas empiezan el jarudo tiene como 18 anos como barrio eso ya marca y se siguen levantando

JARUDO ( e-mail: )
Lunes 25.04.2011 / 19:23
arres demonios amarrence weyes ya saben todos los pinchis barrios locales de juarez quienes son los del jarudo putos,, por algo no emos ganado el respeto porque mi gente no se raja desde el mas morrillo hasta el mas ruko sigue levantando la bandera,, y usted callese pinchi mokoso los msf no la pelan wey y usted sabe bien weii no la caliente cana ya sabe como corre el agua aqui, y si wey te entiendo la PRM no les dice a ustedes que los respeta porke saben que no valen vergaa en cambio los del jarudo nos ganamos el respeto de ellos por ke saben que en un paro el que sea le salimos..!! ahy estamos y los demonios de rato les caemos weyes..!! JARUDOTE LOKOSS..!!

( e-mail: )
Lunes 25.04.2011 / 17:07
ERES UN PENDEJO IGUAL QUE TODAS TUS COMADRES,MEJOR SIGAN ROBANDO BICICLETAS Y JUGANDO MAQUINITAS Y YA NO SE METAN EN ASUNTOS DE GENTE GRANDE PORQUE LES PUEDEN DAR SUS NALGADAS. SE LOS DICE UN PRM.

EL DRAW SE LOS COCHA ( e-mail: MSF )
Lunes 25.04.2011 / 10:17
HAY ESTAMOS JENTE AQUI MUY PRESENTES UN SALUDO ATODOS AQUELLOS DELICUENTES K SE LA RIFAN DIARIAMENTE SALUDOS MSF Y TAMBIEN ALA NUEVA JENTE K SE UNIO CON NOSOTROS CONOSIDOS COMO LOS MC CRIMEN Y EL ARTE URBANO COMO VEN EL DRAW DE LOS MSF FOR EVER DE AQUI HASTA LA MUERTE SOLAMENTE SOY UN DELINCUENTE MAS DE NUESTRO JUARITOZ LOKO ASI ES YA SABEN MSF LA CUESTA LOKOS RIFAAAA MSF Y EL DRAW CONTROLANDO LA CUESTA Y POCO A POCO JUAREZITII

EL DRAW SE LOS COCHA ( e-mail: MSF )
Lunes 25.04.2011 / 10:11
PINCHES JARUDITOS PENDEJOS NO SABEN NI K HABLAN CULOS SIMON VAMOZ A SER MAS JENTE POR K NO VALEMOZ VERGA JAJAJA PRM PRM VENTE VENTE VAMOZ A AGARRARNOS DE LA MANO Y METERNOS LA VERGA DIARIMENTE JAJAJAJA K LA LINEA K LOS AZTECAS VALLANSE MUCHO ALA VERGA SI FUERAN EZO LO K DISEN YA ESTUVIERAMOZ ENTERRADOS 6 PIEZ BAJO LA TIERRA PENDEJOS PERO SEGUIMOZ AQUI COMO SIEMPRE LA MSF PUROS LOKOS DELICUENTES MSF FOR EVER IS MY LIFE PUTOS YA SABEN QUIEN CONTROLA MSF PUTOS SIN LINEA NI SIN LOS AZTECAS WEY CAIGALE AL BARRIO PINCHES MOCOSOS DE MIERDA YA SABEN QUIEN LA DISKE PRM Y LOS JARUDO DE MIERDA JAJAJA RIZA ME DAN PINCHES MUGROSOS DE CHETYO MISMO ME LOS COCHO EN SU BARRIO Y EN EL MIO COMO VEN Y LES DEJE UN RECUERDO MUY PRESENTE EN SU BARRIO JARUDOS YA SABRAN CUAL Y SI NO SABEN FUERON SUS PUTITAS CAIDOZ WEYES EL DRAW DE LOS MSF SE LOS COCHA SABEN BN

( e-mail: )
Lunes 25.04.2011 / 10:07
K TRANZA MIS JARUDOS UN PUTO C ESTA BURLANDO DE DOS CARNALITOS K LES DIERON PISO,CON RESPETO OI K KEBRARON AL PANCHITO A KIENES MAS AN TRONADO,,YO FUI DE SU BARRIO ASE UN CHINGO EL LAGARTO B.J.L

( e-mail: )
Lunes 25.04.2011 / 09:53
ese wei de los dms pinchi chavala deseguro as de ser un pinche mokoso pendejo,alcontrario pinchi P... t deveria de aguitar k kiebren a los jarudos de seguro ni conoces al pancho preguntale a un veterano de tu P... barrio pa k conoscas un poco de los jarudos wey

123 ( e-mail: 123 )
Lunes 25.04.2011 / 05:49
PINCHE PENDEJO SI NO SABES QUIENES SON AA Y PRM MEJOR NO ABLES SOY DEL 4

TU MACHETE ( e-mail: TU MACHETE )
Lunes 25.04.2011 / 03:27
saludos alas mamas de todos los P... k escriben en esta M... ya maduren compas pongase a hacer algo util se cren la gran V... escribiendo sus M... ponganse a pensar 5 minutos nomas k la neta estan bien P... perdiendo el tiempo en esta M... no les digo k no agarense a madrasos pero aganlo no nomas con sus hay te voy a matar hay no yo primero,hay dame mis munecas y toma tus canicas pongase las pilas pinches chabalas vien vergas por aqui se cren hijos del chapo y ala mera hora bien culones si van a hacer su desmadre aganlo y no tiren tanta M... por aqui se van a matar matense pero aganlo putos no nomas digan y no digan tantas M... los que se cren mafiosos si de verdad fueran no estarian aqui con sus M... ponganse a pensar esto 5 minutos y es la neta agren el rollo y como les digo si van a hacer su desmadre aganlo pero no sean P... y se pongan aqui a escribir sus M... bueno H... en asu madre y ya maduren putadas!!!!!!!!!!!

DYNER.DMS3 ( e-mail: )
Sábado 23.04.2011 / 18:09
Q tranza mis jarudos culos, como le va al dosil y al koala en el cielo jajajajajajajajaja apoco pensaban que la rifaban mekos jaja, y ke apoco piensan que con mamar a los prm la van a cuajar pendejos, tambien ese wey que no mame deseguro es un pinchi lepe y anda mamando que es prm, no caguen la V... mekos saben que los AA son los que la rifan mekos... DEMONIOTES TRESS..!!AA

jarudo ( e-mail: )
Sábado 23.04.2011 / 15:56
ese wei,, jajaja no sea P... weii mejor callese si no sabe como esta el rollo para empezar al pancho ya lo tronaron y si no sabes por que pedos fueron mejor no hable pinchi mokoso meko.!!

xtrenger ( e-mail: )
Sábado 23.04.2011 / 13:43
para kien trabajaba el pancho,sin incluir al barrio x uno no la van a yevar todos nomas pa k sepan

JARUDO ( e-mail: )
Viernes 22.04.2011 / 09:44
si aztekiita de mierda,, ha nosotros demuestranos con hechos wey,, cualquiera puede tronar un cuete wey,,aqui en el jarudo tenemos la variedad meko no creas que son los unicos que tienes calibres grandes aqui tambn tenemos arsenal para darles en la madre a quienes se metan con nosotros pendejoo,,!! y no pedimos chichi wey simpplemente la PRM no son culos como ustedes y se ganan el respetoo

aztecotas ( e-mail: cocha )
Viernes 22.04.2011 / 08:32
mira pinche jarudo hijo de perra tu y los mexicles vayanse ala V... me los paso por los huevos y no pedimos chichi a nadie perro bendido y prm tu no tienes a nadie de mi gente camellando con tigo mamon y el langaro k dise k nadamas kedan gabachos estas P... estamos en juarez rifando como siempre porke los aztecotas siempre ban a estar para darles V... cuando kieran o pidan mis putitas dea free pinches pirujas y metanselo en la cabeza oen el C... k aztecas sienpre va a rifar putitas

PRM ( e-mail: MEXICANOS )
Viernes 22.04.2011 / 05:48
ASI SE HABLA JARUDO. YO TENGO A 2 DE ESOS PUTOS CAMELLANDO DESDE HACE 1 MES ESPERANDO QUE SU GENTE VENGA POR ELLOS Y NADA!! ESOS PUTOS NO ATORAN SON CULOS Y COMPROBADO LO TENGO. Y JARUDO PUEDE CON ESOS PUTOS Y MUCHOS MASSS.

JARUDO ( e-mail: )
Viernes 22.04.2011 / 04:51
el jarudo no trabaja con nadie carnal pero respetamos a la PRM y tiienen esquina de nosotros,, y ese wey que dice que no salimos ni a la eskina que no mame que se tumbe su rollo meko no por ke te creas azteca P... pienses que nos vas ha hacer de awuaa,,aqui tampoco nos tiembla tronarte el cuete en la chompa wey,,aztequillas culos conocemos dos que tres de tu gente wey que nomas por andar rayados piensas que la arman y no son nada,, agarre el rollo wey..b-jarudolokoss..!

( e-mail: )
Viernes 22.04.2011 / 03:38
PRM es una familia o mafia y los carnales son los que operan en esta organisacion los que ya conocen el contenido de PRM se nombran carnales o hermanos y de quien manda en el JARUDO pues yo pienso que EL MISMO JARUDO pues es su barrio y alo que yo se el JARUDO NO TRABAJA PARA NADIE. espero que esto responda tus preguntas y YA NO ANDES DE CURIOSO PORQUE ESTA CABRON.

( e-mail: )
Jueves 21.04.2011 / 17:10
NO SE ASUSTEN MIS HIJOS PUES NO LES VA A PASAR NADA ESTAS PREGUNTAS SON SOLO CURIOSIDAD,PERO SI LOS ESPANTO LES RUEGO ME DISCULPEN....

( e-mail: )
Jueves 21.04.2011 / 16:55
K YA NADIE CONTESTA SON ? MUY SIMPLES SAKENME DE MIS DUDAS

XTRENGER ( e-mail: JUARITONES )
Jueves 21.04.2011 / 16:51
K ES PRM? ESTOY CONFUNDIDO KIENES SON LOS CARNALES? KIEN DOMINA EN EL JARUDO?

xtrenger ( e-mail: )
Jueves 21.04.2011 / 16:47
para kien trabanjan los jarudos?

PRM ( e-mail: MEXICANOS )
Jueves 21.04.2011 / 14:47
ES TODO CARNAL,GRACIAS POR EL CATECISMO Y ESPERO SU DIRECTA Y ES LOGICO PORQUE ESTOS PUTOS YA ESTAN VAJANDO MUCHO Y YA NO LES QUEDA PLAZA.SEGUIREMOS CAMELLANDO Y SALUDEME A LOS BORRACHOS QUE ESTAN CON USTED.Y GRACIAS CARNAL.

clavo ( e-mail: )
Jueves 21.04.2011 / 14:38
creen que con marranearse con la jente de juaritos nos van a enconchar y nel carnal x que nos asen mas fuertes x que estos vatos son gabachos disfrasados pero como hay dos tres guecos sel entra el rollo de estos marrananoiy quioeren pelear en contra de nosotros pero revisen guecos prm pura raza mexicana atecas 2 barrioo lideres gabachos chompas gabachas que son guecos mecos piloteados x gabachos para agarrar poder en mexico pero se la van a pelar pero todavia hay jente que piensa y analisa la istori dse estos marranos y commo cammeellan

clavo ( e-mail: )
Jueves 21.04.2011 / 14:27
que transa carnal saludos y respetos al rato le ago llegar mi directa saludos para los jarudos y para todos los afiliados mire carnal estos pinches aztequitas que quedan no valen V... son unos chicanillos que se an querido meter a juarez buscando banderas de aqui pero son gabachos por eso buscaron afiliarse con los linieros para agarrar una bandera de juaritos pero estos batos la estan cagando x que quieren apoderarse dejuarez x medio de esa bandera pero se la estan pelando espero y los linieros agaren el rolllo atiempo x que estos vatos son unos tridores a su vandera y saben que no la pelan x eso le fueron a pedir chiche a los linieros x que sabian que la jente lla se etaban dando color de sus panes pero estos vatos siempre traisionan y terninaran x trisionar a sus chompas aora los linieros como ls isieron con pelucar chuy el diablo chacu y los de adeveras estos son vendidos que los proteje el fbi x pasarles informacion x medio de su chompa el chino pero piensan que con marranearse c

PEKADOR ( e-mail: )
Jueves 21.04.2011 / 12:11
YA KALLENSE PINCHES PUTOS JARUDOSMIERDAS TUMBENSE ESE ROIO DE K SON MALANDROS NI ALA ESKINA SALEN Y YA ESTAN TEMBLANDO PINCHES PUTOS YO ME E AVENTADO DOS TRES JALES EN SU PUTA CUADRA Y NO LE SALTAN KULOS $ AZTEKAS DE LA SANTA MARIA VETERANOS $ PUTOS

PRM ( e-mail: MEXICANOS )
Jueves 21.04.2011 / 08:34
Si mis JARUDOS ya se les explico a estos vatos pero no pueden en tender.EL JARUDO ES BARRIO PERO DE LEY Y TIENEN SU RESPETO BIEN GANADO. LA PRM ES FAMA Y DA LA MANO A QUIEN LA QUIERA Y NECESITE. a estos cabrones les duele que nos demos squina pues que esperaban.somos raza y nos paramos por nuestro respeto. esta gente ya se siente devil por eso le arde quedarse sola pero eso les pasa por ojetes. puro PRM y JARUDOS REPRECENTANDOOOOO.

BJL ( e-mail: )
Jueves 21.04.2011 / 07:32
arres PRM aqui el jarudo tambien les da esquina,,.. JARUDOLOKOS...!!!

PRM ( e-mail: MEXICANOS )
Jueves 21.04.2011 / 04:52
dices que azcacas rifa en juarez? solo que en una esquina de juarez porque LA PRM RIFA EN TODO CHIHAUHAU Y MEXICO ENTERO. YA LES GANAMOS LA PLAZA PERO LES PODEMOS DAR TRABAJO PARA QUE NO SE MUERAN DE AMBRE.PURO PRMMMM

PRM ( e-mail: REVOLUCIONARIOS )
Jueves 21.04.2011 / 04:46
ESTAS MUY ARDIDO,Y MI PATRIA ES MEXICO Y MI BANDERA LA MEXICANA PUESTO QUE LA TRAIGO TATUADA. Y MAS DE 5 AZCACAS SE ME AN INCADO SUPLICANDO PERDON.ESA ES TU PINCHE GENTE BRABA? AQUI TENGO A 2 PENDEJOS QUE LOS TRAIGO TRABAJANDO PORQUE NINGUNO DE USTEDES VIENE POR ELLOS.PUES NO QUE MUY CHINGONES. PURO PRM Y EL JARUDO TIENE RESPETO PORQUE SON DE LEY. TU PADRE "PRM"

aztecas ( e-mail: silbestre )
Miércoles 20.04.2011 / 17:12
aprendr a escribir y apoco tu tienes patria o bandera invesil.perro nunca an valido V... saves bien estupido todos ustedes me le pelan pinches verijones de M... y jarudo si es 1 barrio para que estan mamando ala pinche prm son unos P... no mamen a nadie ni respeten para k le dan esquina no k muy vergas los weyes dejenlos muy meniados ponganse a bender bonais para k ganen mas pork si sigen asi ban a pedir limosna como sus mamas las taraumaras y ya se la saben aztecas rifa en juarez y donde sea y el prm k dise k esta enmedio de mis bolas ben aca si te las das de muy vergas hijos de perra asta berguensa me da peliar con ustedes basuras

PRM ( e-mail: BORRACHOS )
Miércoles 20.04.2011 / 12:47
YA SAVES QUE SI.NO SE PARA QUE PREGUNTAS.Y LOS HIJOS DE PUTA PUES SON USTEDES,QUIEN MAS? O ACASO TIENEN PETRIA O BANDERA?

aztecas ( e-mail: silbestre )
Miércoles 20.04.2011 / 10:53
vayan a C... a su perra piruja madre de la mariscal apoco muy vergas C...

JARUDO ( e-mail: )
Lunes 18.04.2011 / 07:17
LA NETA NO SE KIEN ESTA MAMANDO NOSOTROSSSS NO MAMAMOSSS A NADIEN PERO RESPETAMOS AL KIEN NOS REPETE SOMOS BARIEDAD PERO NO TODOS LE SALEN NOSOTROS NO SOMOS MAFIAAAA SOMOS BARRIO JARUDO LOKOTESSSS ASI DE SIMPLEEEE.

el kyfesillo0 ( e-mail: )
Domingo 17.04.2011 / 19:34
heii heii aky andamos pinche bola de culos saven bn que los de la seventen se los cosha pa que andan kon M... puro msh becede south side lockos pinche bola te P... puro msh diecisiethotha lockototes ya se la saven puro msh 17 el kyfesillo de la seventen lockos putos son los que rifan todo el granjero C... y mas alla de el granjero by the kyfesillo0 de los msh becede THE AMO ALEJANDRA ERES MY TODO MY AMOR

( e-mail: Jlokottes )
Domingo 17.04.2011 / 13:07
KE BAYA I CHINGE ATODA SU PERRA MADRE EL KE ESTA ESCRIBIENDO POR EL BARRIO JARUDO IJOS DE SU PINCHI NADAMS QEMANDONOS IJOS DE PUTA! BAN A BALER BERGA SI NOS ENTERAMOS!

culos ( e-mail: )
Sábado 16.04.2011 / 16:59
nada cularos

culos ( e-mail: )
Sábado 16.04.2011 / 06:56
H... a tu madre prm de M... muy vergas pinche basura son culos de amadre wey me pelan la V... tiran mucho royo toda tu pinche gente bueno sies k tienes pinche perro bendido hijo de toda tu re perrisima madre de M... k tienes y al pinche jarudo de M... y wf tambien pinches cacas del diablo me la pelan

SHAGYONER ( e-mail: B'WFsOTeS 1 )
Jueves 14.04.2011 / 11:54
K TRANSA K TRANSA BWF1 DE TIERRA NEW OK MIS CHAVOS SOBRES PS DE RATO BY SHAGYONE'R

2AC ( e-mail: MOST'ER )
Jueves 14.04.2011 / 11:45
NO MAMEN COMO MAMAN JEJEJEJE CHES VATOS K JARUDO K SON JENTE DE HUEVOS PROPS ENTONSES SON MORRITAS CON HUEVOS POR K SON YGUAL DE MAMALONES K LOS PRM JEJEJE APENAS KEDAN CHAPETONES

JARUDO ( e-mail: JARUDO LKS )
Miércoles 13.04.2011 / 21:08
lla esta ablado mis PRM´´ ustedes igual ai estamos para lo q se ofresca y esos abladores lla no pierdan su tiempo en pendegadas ai q ser derechoos ..JARDUO ES BARRIO .ai estamos para la esquina `PRM ..JARUDO TAMBIEN SE LA RIFA..ai estamso en contacto todo para delante pura jent de huebos

PRM ( e-mail: BORRACHO )
Miércoles 13.04.2011 / 13:10
me da gusto conocer gente como EL JARUDO q le sale al toro y son derechos. y duro con esos putos q solo hablan M... son puros ardidos y poquiteros. cuando EL JARUDO NECESITE PARO AHI VA ESTAR LA PRM LISTOS PARA TIRAR SQUINA.

jarudo ( e-mail: jarudo )
Miércoles 13.04.2011 / 11:15
lla esta mis PRM ai estamos el resperto esta gandado x q ablan con seriedad y bien derechotes ustedes sigan en su jale zero broncas entre JARDUO Y LOS PRM.USTEDES RESPETO NOS DAN Y DENOSOTROS RESPETO RESIBEN .y no ai q degar q metan rollo entre nosotros ai estamos pues PRM ..JARUDOLOKOS

PRM ( e-mail: BORRACHOS )
Miércoles 13.04.2011 / 09:52
oye vato BTP,no se de que hablas.pienso q estas confundido checa bien los mensjs ya q solo le tiro rollo al jarudo y mis respetos para ellos. y si algo te ofendio a ti directamente pues estoy a tus ordenes. la PRM.

PRM ( e-mail: BORRACHO )
Miércoles 13.04.2011 / 09:43
Claro carnal y si usted puede mandeme su correo. y todo tranquilo terminando mi almhoada de plumas de guajolota ya casi la termino. y para que no sufran tanto puro PRM. o quieren otra caja como la del lunes?

clavo ( e-mail: )
Miércoles 13.04.2011 / 06:48
saludos para el borracho que carnal aqui estoy quemando sinta lellendo como se tira con las trensudas y con los linieros pero no vale la pena estos vendepatrias no son nada lla les llevamos mucha ventaja lla la jente esta asta la V... de ellos x ratas x C... alos paisas con sus putas cuotaslla estamos areglando eso x eso emos llenado muchas fosas y quemado muchos marranos uste sabe la basura se resicla lla los estoy usando de fertilizante en mi ranchito para que sirvan de algo toda esta basura y al P... liniero que gasta lineas mejor corre como toda tu jente para villa umada que te agarro o te uvico y te boy a comeri vivo alcabos lajente de villa ahumada no resibe basura y en poco tiempo no tendran donde esconderse y aqui con unos de tus amigos que tengo aqui me boy a tom amar a presente ytus palabras en estos dias te mando mi respuestya pura raza mexicana 3 lineas menos jjaaaaaaaaaaa

CHAVEÑOTA ( e-mail: BTP1 )
Miércoles 13.04.2011 / 05:31
arriva JUARITOS Y TODA SU PEOPLE PUTOS LOS PINCHES BARRIOS NUNKA BAN AMORIR Y ESO DE LA PRM Q NO TENGO NADA KN TIGO PRO KM KE TIRAS MUCHA KK SI TIRAS O NO AMI KE PERO DEPERDIS TIRALA EN EL MSN O EN EL FACE CANA KI NO AKI ANTES ERA DE PURO BARRIOS KE NO MIRAS KE DISE EL MURO DE LOS GRAFFITIS.......

PRM ( e-mail: BORRACHO )
Miércoles 13.04.2011 / 04:16
Sobres pues jarudos,todo tranquilo con nosotros.echenle ganas y animo alsando esa bandera. me da gusto ver que aclaraste ese detalle habla muy bien de ustedes. con respeto la "PRM".

MOST ( e-mail: 2AC )
Miércoles 13.04.2011 / 03:33
A LA VERRGA PINCHES CULONES DE MIERRDAA SON MAMALONES Y ESO ES WEYES K TANTA INSISTENSIA DE CONTESTAME JARUDO AAAAA ESO ES DE CULONES COMO USTEDES JEJEJE TAMBIEN JARUDO ABLA ABLA Y ABLA JEJEJE CHES VATITOS DE MIERDAA NOMAS NO YOREN CUANDO PASE EL SERRUCHO MIS PANOCHUDOS

bjl ( e-mail: jarudo )
Martes 12.04.2011 / 22:07
q rollo PRM guachense no degen q les metan rollo nosotros somos del jarudo y eso welles q estan escribiendo q qeremos ser PRM .es puro rollo nosotro nos no metemos en eso rollos de mafias nosotros no tenemos broncas con ustedes y nosotros no jalamos para nadie aqi nomas es barrio .y ai algien q se esta asiendo pasar por nosotros megor ai q taloniar a ese wei y ai q acerle un desmade por ablador ..ai tamos pues miS PRM..jarudo lokos

( e-mail: JARUDOTE! )
Martes 12.04.2011 / 20:22
no se anden con P... ijos de toda su pinchi madre jarudo no trabaja para nadie los del jarudo tenemos huevos i muchos ijos de P... porqe los emos tenido para mandar ala V... a doblados o a linieros asi qe H... en asu P... madre eso no lo an escrito jarudos lo an escrito los mismos P... ! con nosotros no podran

PRM ( e-mail: BORRACHOS )
Martes 12.04.2011 / 16:07
DEJA DE VER CARICATURAS,A TI NI EN TU CASA TE CONOCEN.WERCOS PENDEJOS POR ANDAR CORRIENDO EL OCICO APARECEN MUERTOS EN LOS VALDIOS.LA "PRM" NO ES NINGUN BARRIO NO SEAS WEY. MEJOR SIGUE ROBANDO BICICLESTAS PARA QUE JUEGUES MAQUINITAS CON TUS AMIGUITOS DE LA ESCUELA. Y SIEMPRE TUS PADRES LA PRMMM

meseehere ( e-mail: )
Martes 12.04.2011 / 15:29
lokotes diesiciete sigue rifando aki con mi mando uno siete siempre respetado pork al mirarme t kdas kagado.uno siete siempre representando putitas m s h s u r

msh diesiciete ( e-mail: )
Martes 12.04.2011 / 15:25
no mamen pinches mocosos ya no saben ni k poner pinches barrios kks k cuete si ni tienen en k kaerc muertos no mamen ay tamos diesiciete pa delante y nada pa tras culitos mios meseehere gravencelo south side

PRM ( e-mail: BORRACHOS )
Martes 12.04.2011 / 13:22
Jarudo, ya tira al lion a estos P... y dime que onda con los mails que te mande porque ya te mande 2. todos estos pinches poquiteros asi son, y cuando ven el cuete se cagan. ANIMO GENTE TODO MACHIN.

( e-mail: )
Martes 12.04.2011 / 11:59
JARUDO LOKOSSSSSSS ES LA BERGA NO SOMOS KULOS KALENOS PARA K GUACHEN NO SOMOS TRACIONEROS COMO OTROS MARRANOS YY SI SABEMOS APOYARRRR

AAc ( e-mail: 2Ac PRADERAS )
Martes 12.04.2011 / 10:31
K K K NO MMAMES WEY COMO LES GUSTA MAMAR VERGAS K KON LOS DEL JARUDO Y 2 3 MAS JEJEJEJE CHES PRM DENSE VALOR MAMA BERGAS JEJEJEJEJE Y ASI TIRAN TANTO ROIO JEJEJE

PRM ( e-mail: BORRACHO )
Martes 12.04.2011 / 08:19
Que pues jarudo,ya mande 2 correos en los dos mails q me mandaste y aun NO recibo respuesta. Que onda??????

JARUDOLOKOS ( e-mail: )
Lunes 11.04.2011 / 17:16
ni sabes que rollo con el jarudo wey no seas P... cual que estamos con la linea,, no cague la V... y metase en sus pinchis rollos wey..!! no hable por nosotros cana keremos representar PRM y no te tenemos por ke dar explicaciones del porque pendejo

VIVA LA PRM ( e-mail: BORRACHO )
Lunes 11.04.2011 / 12:57
MIra baboso,cuando la "PRM"comenso a ganar plaza la unica linea q avia era la q dejaban los putos como tu cuando los llevabamos arrastrando.el ardor q tu tienes esque no tienes bandera eres un P... sin patria. y si el jarudo camella para los azcacas o para cualquier P... d ustedes entonces dime porque quieren reprecentar PRM? yo te lo dire, porque SOMOS MAS CHINGONES QUE CUALQUIER PUTA LINEAAA.

VIVA JUAREZ WEIII ( e-mail: juaritos )
Lunes 11.04.2011 / 08:01
ese wei que representa diske al jarudo mejor no se meta en eso royos cana por que todos en juarez saben que el jarudo le camellan alos carnales.... y ese wei de la prm aki ke H... ados bienes aser si dises ke estas en el centro de MEXICO ni sabes que pedo aki en juaritos nomas la andas cagando as de ser un pinche mokso caga V... io tabn pero yo si se como corre el agua kn la gente aliniada y mejor no tires tu royo ni ese wei ke dise ser del jarudoo el jarudo es gente aztecas wei inche mokosiyo caca y saludeme ami carnal el duda,klen,y al scor de las haciendas.....de aka de las AZTEKAS DEL MOLINO 13...........

SHAGYONER ( e-mail: WORLD FIVE ONES )
Domingo 10.04.2011 / 18:29
K TRANSA ESE WE K ME KIERE CACHUKIAR PONIENDO MI MI ALIAS Y MI BARRIO K NOMAMES WE DATE COLOR Y DE PERDIS ESCRIBE BIEN MI APODO WE NO MAMMES

JARUDOLOKOS ( e-mail: )
Sábado 09.04.2011 / 08:55
NO CARNAL NO LLEGO NADA,, MANDALO AL CORRE QUE TE ACABO DE DAR,,..!! AHY ESTAMOS

PRM ( e-mail: BORRACHO )
Sábado 09.04.2011 / 06:33
Que pues jarudo, no has contestado mi correo.lo recibiste o no?

JARUDOLOKOS ( e-mail: )
Sábado 09.04.2011 / 02:26
aqui el jarudo, carnales de la PRM aqui les dejo otro msn pm1@live.com.mx este carnal tambn es del jarudoo

PRM ( e-mail: BORRACHOS )
Viernes 08.04.2011 / 16:01
si usted reprecenta algo hagalo con respeto y no como pendejo. digame que trae contra la "PRM" y te ACEGURO que lo harreglamos. pero no abras el ocico alopendejo. estamos a tus ordenes. PRM.

shagy ( e-mail: )
Viernes 08.04.2011 / 14:51
kinto mundo hijos de perra el shay wf1 en el refuego machin perros

shagy ( e-mail: )
Viernes 08.04.2011 / 14:48
pues bamonos resio C... apoco k piensan k la ban a cuajar escrementos de chiva world five one de tierra nueva 1 shagi

123 ( e-mail: 123 )
Viernes 08.04.2011 / 11:22
saludddddddddd carnal

PRM ( e-mail: BORRACHO )
Viernes 08.04.2011 / 09:20
HOMEBOY JARUDO, YA LE MANDE UN CORREO Y TODO CHINGON. GRACIAS.

JARUDOLOKOS ( e-mail: )
Viernes 08.04.2011 / 08:54
chatoracing_1632@hotmail.com..!! ahy estamos carnal jarudolokos dando apoyo..!!!

PRM ( e-mail: BORRACHO )
Viernes 08.04.2011 / 08:33
Que pues mi 123, me da mucho gusto del carnal q salio d la torcida ahi q alivianarlo en lo pocible y gracias por estar al pendiente del borracho. y q pedo con este microbio q esta faltando al respeto si usted lo colorea para q se contacte conmigo y arreglar el asunto. digame,usted tiene correo electronico?

PRM ( e-mail: BORRACHOS )
Viernes 08.04.2011 / 08:17
Que pues mis jarudos reportense mandenme su correo electronico para tirar rollo y chequen mi mensj anterior.

123 ( e-mail: 123 )
Viernes 08.04.2011 / 04:45
CHAGGY K PALABRAS NO ENTIENDES PENDEJO BARRIOS NO PELEO PERO SI KIERES BAMONOS RECIO PRM BRINDEMOS CARNALES PORK MI CARNAL YA SALIO DE PRICION UN BORRACHO MAS PARA DAR APOYO A 123

shagy ( e-mail: )
Jueves 07.04.2011 / 14:55
ke transa weyes tumbense el pinche royo P... ya me tienen asta la V... tiran mucha labia me la pelan barrio world five one doble u efe de tierra nueva 1 perrossssssssssss

PRM ( e-mail: BORRACHO )
Jueves 07.04.2011 / 11:13
ninguno d ustedes tiene correo electronico? porque si es necesario platicar.yo estoy en el centro del mapa pero puedo darles mi correo.

JARUDOLOKOS ( e-mail: )
Jueves 07.04.2011 / 09:03
AQUI EN EL JARUDO ESTAMOS PUESTOTES PARA HACERNOS GENTE PRM,, CUANDO NOS CAEN O KE ROLLO?? COMO LE HACEMOSS

123 ( e-mail: 123 )
Jueves 07.04.2011 / 05:16
SOMOS BARIOS PRM JARUDO YO SIEMPRE ESCRIBO A LA 123 PERO SOMOS LOS MISMOS POR K SOMOS HERMANOS Y HIJOS DE PANCHO VILLA

PRM ( e-mail: BORRACHO )
Miércoles 06.04.2011 / 07:33
Jarudo,si tienes correo mandamelo o tu dime como tiramos rollo. o yo te mando mi correo. estamos puestos. y al 123 "PRM" COMUNICATE CONMIGO LO MAS PRONTO PICIBLE.

123 ( e-mail: 123 )
Miércoles 06.04.2011 / 06:09
ya estan jarudo yo te buscare yo los tengo hubicados para estar en tregua y no se aguiten a la 123 PRM

barrio wf1 ( e-mail: de tierra nueva 1 )
Martes 05.04.2011 / 18:23
k roio k roio dloble u efe uno de tierra nueva shagy

JARUDOLOKOS ( e-mail: )
Martes 05.04.2011 / 13:47
EN EL JARUDO NO AHY NINGUN PRM,, PERO ESTAMOS PUESTOS PARA CUALQUIER ACCION,Y MEJOR DEVERIAMOS DE CONTACTARNOS POR OTRO MEDIO MAS SEGURO CARNAL..!!

PRM ( e-mail: BORRACHOS )
Martes 05.04.2011 / 12:45
Simon Homeboy, digame usted colorea a un borracho que traiga raya? necesito contactar algun PRM para darles la botella a ustedes. necesito que me diga como tirar rollo mas seguro. animo gente.

JARUDOLOKOS ( e-mail: )
Martes 05.04.2011 / 11:43
simon carnal y no nos awitamos por la gente que nos tronaron,, ya supimos como estuvo el rollo..!!

JARUDOLOKOS ( e-mail: )
Martes 05.04.2011 / 11:38
ARRE CARNAL AHY ESTAMOS,,EL JARUDO QUIERE REPRESENTAR A LA PRM..!!AQUI AHY GENTE QUE LE SALTA Y NO SE AWITA PARA NADA,,SEREMOS UNA PANDILLA PERO NO NOS TIEMBLA TRONAR A UN WEY,, ESPERAMOS SU RESPUESTA

PRM ( e-mail: BORRACHOS )
Lunes 04.04.2011 / 11:21
Que pues mis jarudos un saludote a toda la raza firme. ya tranquilos con los calacas fue una equivocacion y todo esta machin.animo gente y gracias por reprecentar y apollar ala "PRM".

calaverotas 15 ( e-mail: )
Lunes 04.04.2011 / 07:06
sobres tire al leon

123 ( e-mail: 123 )
Lunes 04.04.2011 / 05:31
ZORRI NO LEI LAS OTRAS PALABRAS PRM

123 ( e-mail: 123 )
Lunes 04.04.2011 / 05:27
ESTOY SERCA DEL JARUDO ESTAN FIRMES PARA DAR APOYO PRM VIVA PANCHO VILLA CALACAS NOSOTROS NO PELIAMOS CON BARRIOS PENDEJOS PERO SI KIEREN NI PEDO CON USTEDES CALARE MIS PISTOLAS ESPERO RESPUESTA JARUDOS

calaverotas 15 ( e-mail: )
Domingo 03.04.2011 / 19:23
e cana ya bien que significa prm

PRM ( e-mail: BORRACHOS )
Domingo 03.04.2011 / 18:30
Sobres pues. mi jale es con los putos linieros y toda esa chusma de nacos sin patria ni bandera. con respeto PRM.

calaverotas 15 ( e-mail: )
Domingo 03.04.2011 / 17:56
nada pero tu empesaste a desirme cosas mejor tirame al leon pues pero no mucho rollo

PRM ( e-mail: BORRACHOS )
Domingo 03.04.2011 / 16:46
SEAS LO QUE SEAS DIME CUAL ES TU PEDO CON LA PRM.

calaverotas 15 ( e-mail: )
Domingo 03.04.2011 / 16:33
ni tu gente vale V... C... ala V... prm i no soy de la linea weyonsote

PRM ( e-mail: BORRACHOS )
Domingo 03.04.2011 / 16:33
ES TODO MIS JARUDOS RAZA COMO USTEDES ES LA QUE VALE. LA "PRM" SABE QUE USTEDES ESTAN FIRMES Y UN SALUDO PARA TODO "EL JARUDOOOOOO" Y PUTO AL QUE NO LE GUSTE. Y ESTOS PENDEJOS DE LOS calacas flacas QUE ARDOR SIENTEN? Y CLARO QUE NO SON AZCACAS PORQUE AUN SON MAS PENDEJOS Y POQUITEROS. ANIMO MIS JARUDOSSS.

jarudolokos ( e-mail: )
Domingo 03.04.2011 / 15:44
cual pinchi linia cana el jarudo apoyando siempre a la PRM siiempre esperando cualquier orden putos la linea no vale V... son culos todos

calaverotas 15 ( e-mail: )
Domingo 03.04.2011 / 13:42
como te disen el mama vergas me la pelas prm k significa puras rameras mama fierro C... tu madre y no soy azteca ni de la linea perro

PRM ( e-mail: BORRACHO )
Domingo 03.04.2011 / 11:55
PUTOS LINIEROS POQUITEROS LAMBEN LA MIERDA Q DEJAN LOS PINCHES AZCACAS SON IGUAL D POQUITEROS Y PENDEJOS. YO SOY "PRM" DESDE ANTES Q SACARAN SU MAMADA D la linea NO T HAGAS PENDEJO Y DIME Q BANDERA ALSAS. PUES NINGUNA PORQUE NO TIENES TU Y TU PUTA GENTE VALEN MADRE. Y YA SABES PURO PRMMMM...

col ( e-mail: )
Domingo 03.04.2011 / 10:52
el cdg va por los ondeados de juares perros desde tamaulipas

calaverotas 15 ( e-mail: )
Domingo 03.04.2011 / 10:31
come caca tamaulipas y lupe de mierda

calaverotas 15 ( e-mail: )
Domingo 03.04.2011 / 10:25
vete ala V... C... tu y villa ahumada muy movido hijo de perra come M... puras cvs 15 west side el bebe te cocha puto

lupe ( e-mail: )
Domingo 03.04.2011 / 10:20
c d mier tamaulipas cdg y zetaz sedan con todo frontera caliente

( e-mail: )
Domingo 03.04.2011 / 08:02
este pinche de la PRM ke as de ser un pinche mokoso kaka ke nomas anda cagando la riata netha aki en juarez puro pinche aliniado....y este wei de los calacas mejor callese pinche lomero de M... pura gente de villa ahumada pendejosss

calaverotas 15 ( e-mail: )
Sábado 02.04.2011 / 08:28
controlando cvs 15

calaverotas 15 ( e-mail: )
Sábado 02.04.2011 / 08:23
H... en a su madre putos calacotas 15 los cocha pinches come tacos hijos de su P... madre los voy a cochar ponganse vergas cacas

PRM ( e-mail: BORRACHOS )
Sábado 02.04.2011 / 05:17
TE ALUCINAS MACHIN, YA DEJA DE VER PELICULAS. ESO NI EN TUS SUEÑOS YA NO SEAS PENDEJOOOO. LA "PRM" ESTA MUY POR ENSIMA DE CUALQIUER linea DE MIERDA. USTEDES SON POQUITEROS Y SIEMPRE LO SERAN.PRM SIEMPRE SERA MUY SUPERIOR A TODOS USTEDES MUGROSOS ROBA VIEJITAS.

villa humada ( e-mail: ________ )
Sábado 02.04.2011 / 05:03
pinches prm mmmmmmm ke tranza gente aliiada aka desde villa humada kn a jente del j1 rifando todo chihuahua y saven bien ke le ______ nunka va amorir C... pinchs montaperros ijos de la riata puro pinche comando emenems culerosss villa humada rifaaaa juarezz ________ linieros asta la muerte pura jente pesada h3 j1 R8 y mi cmpadre chaloo

JARUDOLOKOS ( e-mail: )
Sábado 02.04.2011 / 04:47
JARUDOLOKOS LOS COCHA PUTOS,, MSF NO LA PELAN CULOTES,, SI QUEREMOS DESMADRAMOS TODAS SUS RATONERAS WEYES DEJENSE DE MAMADAS USTEDES BN SABEN QUE LOS HACEMOS DE AWUOTA,, JARUDOLOKOS

SHAGYONER***** ( e-mail: DOBLE U EFE UNO )
Jueves 31.03.2011 / 19:16
K ROIO K ROIO MIS CHAVOS BY SHAGYONER BARRIO WORLD FIVE ONE DE TIERRA NUEVA OK WF1 DOBLE U EFE UNO ARRE PS MIS CHAVOS ANIMO

jorge ( e-mail: )
Jueves 31.03.2011 / 11:14
y porque tanto coraje con la prm?

juan ( e-mail: .................. )
Jueves 31.03.2011 / 10:50
los putos dpc rifando y controlando en cualkier parte putos la linea y la prm me la pelan

PRM ( e-mail: BORRACHO )
Martes 29.03.2011 / 07:54
ORALE CARNAL ACA EN EL CENTRO DEL MAPA TODO BIEN.ME GUSTARIA BRINDAR CON USTED SOLO DIGAME COMO.

123 ( e-mail: 123 )
Martes 29.03.2011 / 05:42
ESTAMOS A LA HORDEN LA PRM PARA APOYAR VIVA PANCHO VILLA UN SALUDO PARA TODOS LOS BARRACHOS YA LLEGE A JUAREZ

rene ( e-mail: )
Martes 29.03.2011 / 05:09
pues ami me gustaria apoollar alos de la prm ellos si son mexicanos y no mugrosos y rateros como los de la linea.

pendegos ( e-mail: )
Lunes 28.03.2011 / 17:37
ai cabron no mamen pinshis narcos estan cabrones ..cuando abian bisto un sibernarco jaja nomas en cdjuarez aunq estos no son narcos por q los berdaderon narcos no andan con estas pendegaditas de q llo soi poderoso y nono llo mas jaja pinshis tontos por eso estamos como estamos ojala y maten a todos esos dicke narcos ..y llo le boi a la linea x q soi de cd juarez .y por ellos aqui ai dinero

( e-mail: )
Domingo 27.03.2011 / 17:09
JARUDO ES LA BERGA

PRM ( e-mail: )
Domingo 27.03.2011 / 10:13
PINCHES IGNORANTES, TE ALUCINAS MACHIN TU PINCHE GENTE NOS OFRECIAN DINERO PARA Q LOS DEJARAMOS CHAMBEAR EN LA PRICION D TEXAS PUTOS AZCACAS DAN LASTIMA YO PERSONALMENTE INQUE A MAS D 9. QUE BANDERA ALSAN USTEDES? NIGUNA PORQUE NO TIENEN SON BASTARDOS SIN PATRIAAAAA... LA "PRM" LES PARTE SU MADRE DENTRO Y FUERA DEL SISTEMA.

linea ( e-mail: LINCES..AZTECAS )
Sábado 26.03.2011 / 22:04
aber ai q poner orden aqi lla ai q degarles bien en claro kien la tiene mas grande la linea. un cartel berdadero no pendegaditas como las d ustedes y llo no beo q borren lineas jaja llo cadabes be mas lineas y linces x todos los lados ..megor llla degan de matar jent inoosents y degen trabagar a la cd en paz lla o pidan cuotas ..pinshis muertos de ambre jaj a la linea lo q le sobra es feri en cd juares el sielo sige verde y sigen callendo los culos de los 2a y prmierda..y sus federales cada bes mas niñas se sigen viniendo con nosotros x q aca ai mas feriia en el cereso sige siendo el pawer de nosotros como en todos lados carrtel de carrteles la linea comandos linses sicarios malditos aztecas alcones dondeqiera si8cariso con placa munisipales y toda las corporasiones ..atte la linea y si qieren mas jales para ustedes nomas siganle de osocones putos

PRM ( e-mail: REVOLUCIONARIO )
Viernes 25.03.2011 / 11:12
HUY.. DIJO EL MIEDO.QUE COMES QUE CAGAS TAN AGUADO? ERES UN PINCHE PENDEJO AL IGUAL QUE TUS COMPAÑEROS ROBA STEREOS. FIJATE PRIMERO QUIEN ES LA "PRM". POR NOSOTROS TU TRAGAS NO TE HAGAS PENDEJO.(BUENO YA ESTAS). Y PARA LES DUELA MACHINNN. PURO PRM.PRMMMMMMM....

( e-mail: )
Viernes 25.03.2011 / 10:21
BARRIO JARUDO LOKOTESSSSS....AI ANDAMOS. LBPK

mauri ( e-mail: bbp )
Viernes 25.03.2011 / 09:53
chin.gen pro chin.gen a toda su madre esoso weyes de la prm para empesar pinchi vato C... no pone ni kien es k we tienes miedo k te maten mi nena jejeje ches vatos mierdas toda la bola de weyes ban a cAER CUAL ES EL PINCHE PEDO SI YA C LA SABEN K ANDAN CAGANDO LA BERGA ANIMO PINCHES VERIJAS MIONAS

osteer ( e-mail: cak_200@hotmail.com )
Jueves 24.03.2011 / 16:53
dc de oster

PRM ( e-mail: BORRACHOS )
Miércoles 23.03.2011 / 17:21
DESDE LEJOS SE LES VE LO PENDEJOOO. LA PRM NO ES UNA PANDILLA DE LA CALLE COMO USTEDES NI ES UN GRUPO NUEVO. LA PRM YA ES DE EXPERIENCIA Y LO ESTAMOS COMPROBANDO. PURO PRMMMM....

( e-mail: )
Miércoles 23.03.2011 / 10:05
soe el GUDO DE LOZ ANTRAX Y ME LA PELAN TODOZ LOZ DE LA LINEA Y EN JUAREZ NOZOTROZ YA KONTROLAMOZ LAS KALLEZ PERRITAS LLORONAZ!!!!! ARRIVA SINALOA!!!!!!!!!!!!!!!!! PINXIZ PERROZ VENDIDOZ!!!!!!!!!!!! ALWUN DIA VAN A KAER TODOZ LOZ PRM!!!!!!!!! KN MY KUERNITO DE CHIVO JAJA!!!!!!!

( e-mail: )
Miércoles 23.03.2011 / 09:43
qe transa pinxiz marikones de las aztekas aki viendo las P... qe dizen i para dezirles qe eskriben puras MAAAMAADAASSSSS!!!!!!!!!!!!!!!!! PENDEEEEEEEJOOOOOSSSSSSSSSS PURA PINXI LINEOTA RIFAMOZ Y KONTROLAMOZ LAS KALLES DE MY JUARITOZZZZZZZZZ PUTOZ!!!!!!!

PRM ( e-mail: BORRACHO )
Sábado 19.03.2011 / 15:55
ESTODOOOO CARNALES!!!!!ASI SE HACE YO ESTOY EN EL CENTRO DEL MAPA Y X ACA TODO TRANQUILO.LA ESTAMOS HASIENDO MACHIN.GRACIAS BORRACHOS.PURO PRM. HAA. Y ME ESTOY HASIENDO UNA ALMOHADA D PURAS PLUMAS YA CASI LA TERMINO. ANIMOOOOO.

clavo ( e-mail: )
Sábado 19.03.2011 / 12:05
saludos carnal de los borrachos de la frontera aqui andamos en la ranfla patrullando seguimos borrando lineas y destrosando emplumados me da gusto y no nos aga de agua que las pollas son para los carnales de la torcida los leones de la calles tambien queremos ver ese ganado que no aqui tambien traemos morras buenas y de guebos nadamas abisen cuando bajan y asemos fiesta hay me saludan al los senores y que miren el cromado hay cada 2 3 dias les estamos mandando todos sus monos atte el grupo 12

towi ( e-mail: )
Sábado 19.03.2011 / 11:55
mis respetos para mis carnalitos del prm en especial para mis carnales en el cereso estatal y en el municipal hay saludos de sus carnales de durango andamos arrasando pues aqui estamos rodeodos de chavalonas nadamas vajamos a la frontera y les bamos a llevar carne nueva alistense mis leones jajajaa

DOBLE U EFE LOKOS ( e-mail: WORLD FIVE ONES )
Martes 15.03.2011 / 11:11
JEJEJE LOS K NUNKA TIENEN K FALTAR EN EL MAPA BARRIO WORLD FIVE ONES DE TIERRA NEW DOBLE U EFE UNO DE TIERRA NUEVA 1 LO DEMAS SALE SIEMPRE SOBRANDO MIS CHAVOS OK DE RATO YA C LA SABEN

LOS TERRENOTES 13 ( e-mail: )
Martes 15.03.2011 / 04:38
K TRANSA PARA LOS TERRENOS 13 DE LA HERUES DE LAREVOLUCION EL POLLO LOS SALUDA PINCHIS CULOS COMO EL TANGA EL BORGI EL MACHO NESH CHOLO CLOU TOCHE NINO CACHO CHUKI Y LOS DEMAS TERRENOTES 13 RIFANDO PINCHI BOLA DE KULOS LOS JUANITOS EL POLLO LOS COCHA

sHAgYOneR'' ( e-mail: w five unO wf1 )
Lunes 14.03.2011 / 09:45
arre ARRE JEJEJE BARRIO WF1 LOKOS TRAY EL POWER EN TIERRA NEW 1 MIS CHAVOS JEJEJE ARRE ARRE

( e-mail: )
Lunes 14.03.2011 / 04:45
ESTO ES PARA LOS PBU DNS30 JARUDO NO ME ASEN NADA PERO ESTAN CALENTANDO LA CUESTA Y MI JALE ES PONER HORDEN CALMEN SUS PINCHES PELEITAS CULEROS A

emo0 ( e-mail: )
Sábado 12.03.2011 / 16:55
eiii ia kiero0 k se arm o0tra pela d emo0s en estha ciudad co0nthra lo0s pinchis punketho0s o lo0s darketo0s pro0 esta vez k sea en plaza la to0rres si no0 se arma pinchis culo0s enserio0

.I, ( e-mail: )
Sábado 12.03.2011 / 11:46
PINCHE BOLA DE CIBERNARCOS I CIBERCHOLOS PENDEJOS X ESO STAMOS COMO ESTAMOS USTEDES SON LA MIERDA DE LA CD OJALA LOS CHINGUEEN A TODOS I LES PARTAN SU MADRE PARA QUE DSPS ANDEN DE LLORONES COMO SIEMPRE

PRM ( e-mail: BORRACHO )
Sábado 12.03.2011 / 09:24
Pues yo soy PRM y ustedes siempre me an dado lastima,en la pricion en Texas ustedes lo unico q corren es el ocico. dan lastima ya aceptenlo YA PERDIERON LA PLAZA. y sabes porque? pues por P... y pasados d madre con la misma gente.por eso y mucho mas.... puro PRM.

brower ( e-mail: )
Sábado 12.03.2011 / 08:23
guache ese P... que le esta tirando a los aztecas nos pelas la V... no sabes nada de control nosotros controlamos todo lla tenemos juarez y nos la siguen pelando y a todos esos que se asen llamar paisas aqui en el chuco nos los estamos cochando atte el brower el paso texas rifa marrano

solos xv ( e-mail: bebeoner )
Sábado 12.03.2011 / 05:25
inches ks jajajajaja son re culos nomas son como 6 weyes y es me jor ke no tiren su kaka por ke van avaler V... si siguen cagando la riata van avaler V... ijos de la V... y diganle al punche smock ke ya sabems donde cantonea q no sigan cagando la riata putos !!!!!!!! solosxv controols haciendas

jarudolokos ( e-mail: bjlkz )
Viernes 11.03.2011 / 18:25
jaja x q seran tan mentirosos los msf de M... ..jaja tu apenas andas con esos rollos de los ebentos jajaja no mmes eso q we jaja qien shingaos ba a qerer ir a esas M... .ya tubec el rollo a rapero ahaa en el maika ahah bin cagadote a mc..jajaja nadiee t conose we xq estan bien pedorotes...bueno y lla dega d mentir we..no tiren el rollo de malandrotes xq no son son puro culon..condominieros culones jaja a multifamilaiarez pufff..me daria vergunsa desir q vivo ai la neta..no pelan la V... todos los entrados ..y los ks q qieren fama ..jaja tumbence ec rollo ustedes estan mas cagados q estos pendegos oo mas parese inposible pero no lo es x q alabaraba son un par de barrio de shabalas q ..me dan riisa ...jaja .bueno BARRIO JARUDO LOKOS COCHA PUTOS

( e-mail: )
Viernes 11.03.2011 / 12:21
jajaajjaja kual PARI JAJA PERO SI USTEDES DISEN KAIGALEEE ABER COMO NOS ARREGLAMOSS ARRE OKEEE. INCHIS PENDEJO EL KLEEEN SE LOS COCHA ATODOS LOS MSFF ..

DRAW MSF ( e-mail: la cuesta lokos rifa msf )
Viernes 11.03.2011 / 10:18
ya saben pinches bjl de M... saben bien k no la pelan P... di algo k sea verdad wey no mamadaz y para la otra ustedez weyes tiren adar segun train pistolas de agua y ni asi putos tienen miedo de caer alas grandes P... igual k los k.s de M... saben bn k no la pelan por k en los condo la msf rifa putos como ven me tiraz tus rimas cagadaz wey y estan bn pendejaz la netha tirame en el micro wey este domingo k biene como vez y ya saben ala V... con todoz los entrados de M... ......saben quien es la V... el draw de la cuesta lokos rifa for ever y me vale madre todos los entradoz como ven el draw ya se la saben caiganle cuando quieran para darles piso por k con solo doz putasos al suelo van adar y jarudoz hay pary en su barrio y lez voy a kaer hoy viernes con mi pipo como ven unos de achole o k

( e-mail: )
Miércoles 09.03.2011 / 12:14
los msf y acg son unos pobres mugrosos ridiculos, ya tumbense ese rollo CAGADO que traen,y si van a sacar sus pistolitas tiren a dar y no al cielo porfavor jajajaja

( e-mail: )
Miércoles 09.03.2011 / 11:40
K CHINGADOS KIERESSS... MEKOS KIEREN FAMA... OKEEE PORKE YA SE LE AKABO POR ESO .. INCHO PENDEJOS DE ABAJO JARUDO LOKOSSSS SE LOS COCHAA..... AAAA TODOS LOS ENTRADOS

pEkAdOr de LA K.S ( e-mail: )
Martes 08.03.2011 / 18:58
K TRANZA PINCHES PUTOS MSF DE LA K.S CREW KONTROLA EL JUEGO PUTOS PINCHE IMITACION DE BARRIO IGUAL K LOS PINCHES JARUDOSMIERDOS MELOS PASO POR LAS BOLAS $$ POR EL RUMBO YO TE TUMBO KON EL HUMO K YO FUMO JA JA $$ LA K.S CREW DEL MEZKITAL KAIGANLE PUTOS JUARITOS MEX

dobleuefeuno ( e-mail: )
Martes 08.03.2011 / 08:15
la klica de la ke tienen ke hablar sienpre se la han rifado sin pedirle chichi a nadie wf1 tierra nueva

world five OneS ( e-mail: wf1 de tierra nueva )
Martes 08.03.2011 / 04:50
arre arre MIS CHAVOS AKI LOS DOBLE U EFE DE TIERRA NEW ASIENDO MACHIN EL RREFUEEGGGOOOOOOO SOMOS LA EPIDEMIA DEL WORLD FIVE KINTO MUNDO ARRE PS MIS NENAS YA SE LASABANAS OK SOBRES DE RATO DOBLE U EFE UNO DE TIERRA NEW WF KINTO MUNDO

jarudolokos ( e-mail: )
Domingo 06.03.2011 / 18:29
jajaja q train los msfetos..pobres pendegos mamadores d barios jaja q no les da bergunsa ni los pelan ellos a ustedes y ustedes bagandoles el tramo para tirarle un mamelosn ...jaja a pues esas son las costumbres q les dan sus jefas bdd jaja pobres bastardos ..lomeros roñosos ondureños huatemaltecos muertos d ambre maqileros albañiles ruteros enpacadores parqeros jaja enfin simplement son la escoria d juarezy ustedes saben q jarudo se los cosha putos en sus ratoneras jaja...condominios jaja q C... jajacuando qeremos nos metemos a su barrio y ustedes q asen correr en cunto no bieron corrieron y mas cundo olleron los plomasos jaja pero sisi sigan d mentirosos eshenle ganas pera q se la crean ustedes saben q todos los sueños algna bes se pueden conbertir en realidad aunq el d ustedes no creo x q estan bien cagadotes y no nesesitamos d nadie para poderlos aser d awa d nuebo ai tams pues mis shabillos mamadored d pitos jajajaja..atte..SUS PADRES LOS JARDUOLOKOS

PRM ( e-mail: BORRACHOS )
Sábado 05.03.2011 / 07:42
Ustedes no acaban con nadie putos azcacas,que putas an echo? NADA. solo dar lastima.ni bandera tienen pendejos. puro PRMMMM.

JARUDO LOKOS ( e-mail: )
Sábado 05.03.2011 / 07:22
digame K CHINGADOS KIEREN LOS MSF MAMANDO LA BERGA ATODOS LOS BARRIOS SI PERO PARA ESO SIRBEN PARA DAR LASTIMA HIJOS DE PERRA K PIENSAN K JARUDO A AKABADO NO APENAS EMPIESAAA NOSOTROS NO PEDIMOS APOYO NI NADA SOLO DESIMOS LA BDD K NO SABEN ASPTAR NADA NO SABEN PERDER K SIRBE K PONGAMOS APODO WEYES. SI NO BAN ASER NADA SEGUIMOS KRECIENDO EL JARUDO LOKOSSS

MY DREECK .V* B*T*13 AZTECAS ( e-mail: SOMOS DEL V*B*T* COCHONES .AZTECOTAS )
Sábado 05.03.2011 / 07:17
QUE TRANSA PASANDO A SALUDARLOS ATODA LA GENTE DE LA LINIOTA Y LOS ASTECAZ SIENPRE FIRMES ACABANDO CON LOS MARANOIS DE EL CHAPO JAJJAJAJAJA

EL DRAW MSF ( e-mail: msf acg wf como ven )
Viernes 04.03.2011 / 10:36
esto es para todos los unidos puro para enfrente y nada para tras msf acg wf 4:20 HEA PAPITOZ 13 SUTHSIDE 13 EL DRAW MSF NAS MSF DIE MSF ARO MSF WIKE DKP SIWER DKP LTC EC GAMIZ DE LA TORRE SIGUEN Y SIGUEN FALTA PERO PARA K SE DEN UN KEMON PINCHES ENTRADOZ DE MIERDA ,,,,,,EL SARCK SOUTH SIDE13 REBOTE SOUT FAKE ACG SALUDOZ ATODOS LOS UNIDOZ PURO PA DELA JAJA ASI ES PIPO SAKELO AQUI EL DRAW Y LA JENTE FUMANDONOZ UN MARROTE EN MI CHANTI JAJAJA AL 100

DRAW MSF ( e-mail: MSF LA CUESTA LOKOS RIFA )
Viernes 04.03.2011 / 09:59
K TRANZA PINCHOS ROÑOSOS SABEN K SON BN CULOS PENDEJOS OTRA VEZ NI EL APODO PONES PENDEJO POR CULO POR K TIENES MIEDO DE K TE COCHE WEY JAJAJAJAJA Y ATU JEFA Y TUS PRIMAS JAJAJAJA ME ACUERDO COMO LAS ABRI BN RIKO LES TRONE ASTA EL CULITO BN RICO JAJAJAJA Y CUAL TROCA PENDEJO NO VEO NINGUNA NI E VISTO NI UNA TRAS MI JENTE PUTO SABES QUIEN ES LA VERGA AQUI PUTO MSF LA CUSTA LOKOS RIFA COMO VEZ DI COSAZ K SEAN VERDADEZ PUTO NO COMO TUS PENDEJADAS K DISES PINCHE MOCOSO DI LA VERDAD DI COMO NOS EMOZ COCHADO ALOS DE TU BARRIO CAGADO Y TUS PICHES LOMEROS DE MIERDA BUENO USTES bjl y pelones SON NUESTRAS AMAS DE CASA JAJA ME DAN RIZA PINCHES JOTOS YA SABEN MSF LA CUESTA LOKOS RIFA AAAATTTTEEEE EL DRAW PON APODO PUTO O ERES CULO YA SE ERES CULO POR EZO NO PONEZ NADA Y TE VOY A COCHAR BN RICO Y TE EQUIVOCASTES WEY A TU JEFA LE DOY EZOZ 20 PESOS PARA K TE LOS DE PARA LA ESCULA PARA K COMAS JAJAJAJA SIMON K SI EZE JAJAJA EL DRAW DE LOS MSF FOR EVER CRAZY COMO VEZ PUTO

PRM ( e-mail: BORRACHO )
Viernes 04.03.2011 / 09:58
Dices puras babosadas.que no te da verguensa ser tan idiota?

DOBLE U F 1 ( e-mail: WFSOTES )
Viernes 04.03.2011 / 09:13
DOBLE U EFE DOBLE U EFE DOBLE U EFE DOBLE U EFE DOBLE U EFE DOBLE U EFE DOBLE U EFE DOBLE U EFE DOBLE U EFE DOBLE U EFE DOBLE U EFE DOBLE U EFE DOBLE U EFE DOBLE U EFE DOBLE U EFE DOBLE U EFE SHAGYONER SHAGYONER SHAGYONER SHGYONER SHAGYONER SHAGYONER SHAGYONER SHAGYONER SHAGYONER SHAGYONER SHAGYONER SHAGYONER SHAGYONER SHAGYONER SHAGYONER SHAGYONER SHAGYONER MUERAN CUCARACHAS

chavalas ( e-mail: niñas )
Viernes 04.03.2011 / 00:44
k puro bla bla bla no mmamen weyes chi royiyo k estan peor k un niño tonto o de meses desmandrense ps aber si mucha accion les digo valen bergotaa pputos

jarudo ( e-mail: lokos )
Jueves 03.03.2011 / 22:22
jajjaajja nmmes we jaja nos dices roñosos lomeros jajajaa neta q eres bien bromista jajaja pinshis msfcagadotes ustedes bien sabs q estan bien cagadaotes y si qeremos nos les metemos cundo qieramos q lla no se acuerdan como corian en las ratoneras a sorri en los condominios jaja q culerote vivir ai ..asco asco jajaj q we y como le qed la troca a tu compa jajaja siganle aciendo a los vergas ..pinshis albañiles maqileros jaja bjlse los cocha en su P... barrio.e we tuu jefa se abiento buenas M... dile q mañna me caiga otrabes y le dooi susu 20 pesoso para su dosisi jaja ...pinshi bola d shapetes..son la escoria d juarez..lomeroskis ,roñososo.maqileros.albañilesjajajaja ...barrio jarudo lokos se los cocha putoas

PRM ( e-mail: BORRACHO )
Jueves 03.03.2011 / 15:03
Pues ya estoy fastidiado de estos putos mugrosos que solo corren el ocico apestoso. ahi que dejarles claro quien es la PRM.

WORLD FIVe OneS ( e-mail: B*DOBLE U EFE UNO )
Jueves 03.03.2011 / 12:59
WORLD FIVE WORLD FIVE WORLD FIVE WORLD FIVE WORLD FIVE WORLD FIVE WORLD FIVE WORLD FIVE WORLD FIVE WORLD FIVE WORLD FIVE WORLD FIVE WORLD FIVE WORLD FIVE WORLD FIVE WORLD FIVE WORLD FIVE WORLD FIVE WORLD FIVE WORLD FIVE WORLD FIVE WORLD FIVE WORLD FIVE WORLD FIVE

123 ( e-mail: 123 )
Jueves 03.03.2011 / 11:03
ESTAMOS PARA TIRAR PARO HERMANOS PURO PANCHO VILLA

PRM ( e-mail: BORRACHO )
Miércoles 02.03.2011 / 04:52
BAMONOS RESIO PUESSSS.PUTOS AZCACAS Y LINIEROS PENDEJOS NO TRAEN NADA. PURO PRMMMM

shagyOneR ( e-mail: doble u efe unO )
Martes 01.03.2011 / 17:09
WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF WF SHAGYOneR SHGYOneR SHAGYOneR SHAGYOneR

shagyOneR** ( e-mail: doble u efe uno wf1 )
Martes 01.03.2011 / 17:05
barrio wf1 de tierra new segimooos en el reffuego mis chavos ok sobres de rato desde tierra new rip bola mufas

EL DRAW MSF ( e-mail: MSF ACG )
Domingo 27.02.2011 / 16:09
AQUI PURO MSF COMO VEN .......PINCHES bjl culones ni apodo ponen por culos tienen miedo de caer al suelo jajaja asi de simple pendejospinche mocoso P... no saben ni con quien se meten jajaja me dan riza pinches lomeros de M... pinches roñosos de chet echenme asu jefa pebndejos pon tu apodo P... o te awitas wey ponlo P... y donde te tope te doy suelo unos de achole quiero ver k caigan otra vez al barrio para matarlos aqui los espero cuando quieran bola de puñales igual k sus carnales los pelones jajaja pinches roñosos de M... ni para un pan tienen jajaja les tengo k dar de comer al igual k ustedes bjl P... ......ya se la saben sin detalle el draw de los msf la cuesta lokos rifa for ever asi es msf acg is my life como ven putos msf la cuesta lokos y ballanse ala V... todos los entrados los esperamos cuando quieran

( e-mail: )
Domingo 27.02.2011 / 11:56
bjlks jarudo lokos estamos d pie putos los msf jaja q esatn bien cagadotes todos lomerotes pinshis plogientos puff me dan risa,,echenle ganas ....b.jarudo lokos

DRAW MSF ( e-mail: 4:20 )
Sábado 26.02.2011 / 17:24
MSF:MSF:MSF:MSF:MSF LA CUESTA RIFA:MSF:MSF:ACG:MSF:MSF:MSF:MSFMSFMSFMSFMSFMSFMSF

EL DRAW ( e-mail: MSF, ACG )
Sábado 26.02.2011 / 17:21
AQUI ANDO DE NEW PUTOS EL DRAW DE LOS MSF LA CUESTA LOKOS RIFA PUTOS ASI ES ACG MSF FOR EVER ASI ES PUTOS .............VALLANSE ALA VERGA TODOS LOS PINCHEZ ENTRADOS DE MIERDA YA OLLERON PINCHES ROÑOSOS DE MIERDA Y SI SON LOS jarudillos DE CHET..................YA SABEN K AQUI CONTROLA MSF ACG EL DRAW COMO LA VEN TIRO MSF AL 100 PUTOS COMO VEN.....Y COMO DIJO BALLANSE ALA VERGA TODOS LOS ENTRADOS

PRM ( e-mail: BORRACHO )
Viernes 25.02.2011 / 05:21
Ya no les queda nada,bueno nunca tubieron nada.ustedes acaban de nacer y ya los terminamos.ustedes solo son mugre de los azcacas.no tienen patria ni bandera por eso valen madre.dime tu historia pendejo. puro PRMMMMMM.

bbbbbbbbb ( e-mail: ggggg )
Jueves 24.02.2011 / 18:42
DOBLEUEFE UNO Descansen en pas unos cuantos homies del barrio WF1 de tierra nueva EL BOLA*EL MUFASA BATOS LOKOS FOREVER todo para enfrente nada para atras

linea ( e-mail: )
Jueves 24.02.2011 / 18:02
jaja asta pendego eres .te das mucho a conoser y no bales berga..eres un ablador el roba bicis as de ser tu ..pinchis muertos de ambre ja borracho mescaler ..tu y tu jente me la pelan si qieren atorarle lla saben donde estamos..controlando la linea todo el P... estado...

PRM ( e-mail: BORRACHO )
Miércoles 23.02.2011 / 12:32
y estos P... de abajo quien son? ni en su casa los conocen. bueno si es que tienen casa.

tHe bAbY OnE ( e-mail: SOLOS XV )
Martes 22.02.2011 / 17:35
inche 2A no la pelan ijos de la riata y siempre no la an pelado C... !! solos xv ssl controls

PRM ( e-mail: BORRACHO )
Martes 22.02.2011 / 13:53
ustedes son puro ocico,cual jale? le llaman jale a robar bicicletas? putos azcacas y linieros P... les falta mucho por eso ya perdieron la plaza. puro PRM controlando puro BORRACHO MEXICANO NOSOTROS SI SOMOS MEXICANOS y ustedes? no tienen bandera BABASOSSSSS.

sls xv ( e-mail: haciendas )
Martes 22.02.2011 / 07:00
ke viva la forntera juaritos asta la muerte pinches 2A mierdas siempre no la an pelado mas el pinche fome de M... inche jeton culero!!! solosxv controlando bachilleres 9 putos!! y ke VIVA JUARITOS!!!!!!!!!!!!!!!

LINEA ( e-mail: LINCES..AZTECAS )
Lunes 21.02.2011 / 21:12
LOS DUEÑOS DE JUARTEZ Y DE LA PLASA QIENES SON PUES LA LINEA..LA FRONTERTA ESTA FIRMADA POR EL JL Y SUS MUCHACHOS....

LA LINEA ( e-mail: COMANDOS LINCES )
Lunes 21.02.2011 / 21:07
AQUI DE NUEVO PUTOS EL COMANDANT R17..REPOTANDO LOS NUEBOS PUNTOS DONDE BAMOS AREBENTAR CHAHUISKLES Q SON LOS Q SE ACEN LLAMAR 2A.PRM.O CHAPOS ES LA MISMA PENDEGADA EL ROLLO ES QUES UN GRUPO DE PENDEGOS............................... COLONIA N´1..MUNISIPIO LIBRE COLONIA N´2..VILLA COLONIAL COLONIA N´3..MORELOS 123 COLONIA N´4..JUAREZ NUEVO COLONIAS ..GRAN PARTE DE LAS TORRES COLONIA N´5..FINCA BONITA COLONIA N´6..JARDINES DEL AEROPUERTO POR LO PRONTO ES LO QUE LES PUDO DESIR LO PUBLICO POR QUE NO QUEREMOS QUE CAIGA JENTE INOCENTE DESPUES DE LAS 9`DE LA NOCHE ENPESARA EL TRABAJO NO SABEMOS EN QUE COLONIA ENPESAREMOS POR ESO LES ESTAMOS ABISANDO POR QUE ANDAREMOS TRABAJANDO EN TOQUE DE QUEDA ....POBRESITOS LOS CONTRAS JAJA QUEDARAN COMO EN EL JALE Q NOS ABENTAMOS EN EL GRANGEREO ...QUE SU JENTE NO PODIA NI PODIA PAPALOTIAR BIEN UN CUERNO JAJAJA SE LES MOBIA PARA TODOS LADOS ...POBRES PENDEGOS JAJA BUENO YA ESTA ABISADA LA CD DE JUAREZ EN QUE COLONIAS ABRA JALES ..ATENTTAMENT LOS

LA LINEA ( e-mail: LA LINEA )
Lunes 21.02.2011 / 19:02
AI LES BA ATODA LA BOLA DE PUTOS Q ANDAN DE CHAPULINES LES BA A CARGAR LA VERGA USTEDES BIEN SABEN COMO JALAMOS ..A TODOS ESOS 2AA..Y PRM.. Q SON UNA BOLA DE MUERTOS DE AMBRE ..TRAISIONARON A SU SIUDADADIA PENDEGOS ..LLENDOSE CON EL PATAS CORTAS..Q LLA SE LES OLBIDO QUIENES LES QUITABAN EL AMBRE A USTEDES Y A SUS FAMILIAS..PENDEGOS..ES MEJOR Q BALOREN SUS VIDAS..AI ESTA MIS COMANDOS DE LINCES QUE NO FALLAN ELLOS TIENEN BIEN CLARO SU OBGETIBO ..SE LES DICE ..NO AI PECASDO DISPAREN MUCHACHOS POR QUE LA BASURA LE ESTORBA A LA ENPRESA...CUNDO CAIGAN LES DEGAN BIEN CLARO PURA PINCHI LIINNEEAA____________RECONOSCO SU ESFUERO Y ENPEÑO MUCHACHOS SON GRANDES PELIANDO EL TERRNO..SOMOS MALDITOS CUANDO SE REQUIERE TAMBIEN SOI AMIGA..MIREN NOMAS AQUI TENGO MI HOMBRO LA MANO DE UN SEÑOR CARRILLO...AQUI ESTAMOS CD JUAREZ LA LINEA ESTA L SEBISIO PARA ATORARLE CON LOS CONTRARIOS..MALA SUERTE PARA LOS EL OBGETIO SE BA DE EST MUNDO LOS TENEMOS EN LA MIRA...NOS SENTIMOS ORGULLOSOS DE LSO COMANDOS DE LINCE

by 'sHAGyOneR ( e-mail: DoBle U eFe unO )
Lunes 21.02.2011 / 10:50
shagy shagy shagy shagy shagy shagy shagy shagy shagy shagy shagy shAgy shagy shagy shagy shagy shagy shagy shagy shagy wf wf wf wf wf wf wf wf wf wf wf wf wf wf wf wf wf wf wf wf wf wf wf wf wf wf wf wf wf wf wf wf wf wf wf wf wf wf wf wf shagy barrio wf1 worlf five one segimos firmes el el rrefuego en tierra new 1 jejeje sobres de rato mis chavos

( e-mail: )
Domingo 20.02.2011 / 12:17
LOS 2AA SON UNOS PINCHI MIERDAS NO SUEÑEN K NOS GANARAN AMI ME BALE BERGA LO K DYGAN Y AGAN SOLO NO SE METAN CON NOSOTROS NO NOS LEBANTAMOS NI NADA PERO NOMAS NO PISEN EN NUESTRO TERRITORIO PORKE LE DAMOS EN LA MADRE AY WEYES QUE TENEMOS EN LA MIRA ASI DE SIEMPLE AI WEYES K SE METEN Y NO ANADAN ACIENDO NADA SOLO ANDAN KAGANDO EL PALO I SIMPLENTE APOYAMOS LA LINIA PORKE AKI NASI ASY ME KREEE AKI ABRI MIS OJOS EN JUAREZ Y ME ARTARON EN K SE KIERAN DUEÑAR LA PLASA ESTO BA PARA SIN NOMBRE Y LINIAA K LA APOYAMOSSS

clavo ( e-mail: )
Viernes 18.02.2011 / 08:34
mis respetos para todo mi juarito x que llo soy de juarez y arriba todos los mexicanos a la vefrga todas las trensudas y los vendidos atte clavo

( e-mail: )
Viernes 18.02.2011 / 07:15
ps ami me vale V... mexicles AA o lo ke sea pro ARRIBA JUARITOS IJOS DE LA VERGA puro pinche juarez la frontera rifaa!! !! slsxv bjlHACIENDAS

BY XEUX ( e-mail: )
Viernes 18.02.2011 / 06:40
PURO MEX SIDE EL SEUS MEXICANOTE PUTO A PERO PARA ACLARAR ESE EMPLUMADO K NO ES PARA MI KIERO ACLARAR LAS COSAS PUTO CD JUAREZ BCL PARA EL CLAVO ATTE EL SEUS SOUTH PARK MEXICANS 100% MEXICANOTE PUTO A Y MAS K TU

tHe bAbY OnE ( e-mail: SOLOS XV SUR 13 )
Viernes 18.02.2011 / 04:27
tHe bebe OnE SOLOS XV ones stilo playero crew graffters grafiteros forever

SHAGYONER ( e-mail: DoBle U eFe unO )
Jueves 17.02.2011 / 17:26
SHAGYONER SHAGYONER SHAGYONER SHAGYONER SHAGYONER SHAGYONER SHAGYONER SHAGYONER SHAGYONER SHAGYONER SHAGYONER SHAGYONER WF1 WF1 WF1 WF1 WF1 WF1 WF1 WF1 WF1 WF1 WF1 WF1 WF1 WF1 WF1 WF1 WF1 WF1WF1 WF1 WF1 WF1 WF1 WF1 WF1 WF1 WF1 WF1 WF1 WF1 WF1 WF1 WF1 WF1 WF1 WF1 WF1 WF1

CLAVO ( e-mail: )
Jueves 17.02.2011 / 14:19
A Y GUACHE ESE EMPLUMADO DEL SEUS MIRA BASURA DISES QUE NOSOTROS LOS MEXICLES PELEAMOS POR SINALOA Y SIMON ES POR SINALOA Y X TODO MI MEXICO X QUE REPRESENTAMOS A TODOS LOS MEXICLES OSES A TODOS LOS PAISAS QUE NO LE DUELE X QUE NOSOTROS SI SOMOS RAZA GUACHA A TUS CHOMPAS PUROS GABACHOS Y CHICANOS QUE ONRAN BANDERAS GABACHAS NOSOTROS SI LEBANTAMOS NUESTRA BANDERA QUE ES EL VERDE BLANCO Y ROJO Y NO VENDEMOS A LA PATRIA CON ROLLOS GABACHOS COMO TU PLACA AZTECA QUE BIENE DEL PASO Y ESTADOS DE TEJAS MI COLOR ES MORENO Y SOY ORGULLOSO DE ESO COMO LA BES TRENSUDA O MALINCHE INVESTIGA A TUS CHOMPAS PERO A LAS DE ARIBBA NO ALOS SONVIS QUE TRAES AORA QUE SE VENDEN X UNOS VEREDS O POR UNAS CURAS Y A LA SIUDADANIA DISCULPEN EL BANO DE SANGRE QUE ESE A BUELTO ESTO PERO TENEMOS QUE SALIRLE X MEXICO Y PARAR A ESTOS VENDIDOS Y LAQUEARLOS O ACOSTARLOS COMO EN EL CHUCO X QUE ESTAN ASIENDO LO MISMO QUE EN EL CHUCO LABANDOLE EL CEREBRO A LOS PAISA PARA USARLOS PARA SIQUEAR A LA JENTE PERO ESO NO SE LOS BA

clavo ( e-mail: )
Jueves 17.02.2011 / 14:00
alfas saludos a los cantineros y me da gusto que esten aleonando todos los borrachos aca en la cantina de satelite estamos bien puestos tambien saludos de los borrachos de chihuas y durango y tamaulipasde parte del esniper o t8clavo

EL GUERO ONER ( e-mail: DOBLEUEF )
Jueves 17.02.2011 / 10:56
KE TRANSA PEROS EI BARRIO DE LOS DOBLEUEF COCHA A TODOS LOS PUTOS CULRROS

GUERO ( e-mail: WFZOTES )
Jueves 17.02.2011 / 10:47
K TRANSA PUTOS AKI LOS WORLD FIVE ONES DE TIERRA NEW DEJANDO EL RAYON SOBRES DE RATO MIS CHAVOS

felipe ( e-mail: )
Miércoles 16.02.2011 / 18:16
saludos para todos mis borrachos de parte de un soldado del prm aca seguimos camellando lla llevamos barias plumas en la bolza y emos borrado barias lineas sigo asiendo mi camello esperando y esto se resuelva rapido x que lla beo serca la vicoria

EL FR ( e-mail: )
Miércoles 16.02.2011 / 11:27
PRM R PURO RATERRO MOCHADO ATTE EL FR -

EL FR ( e-mail: )
Miércoles 16.02.2011 / 11:19
JAJAJAJAJA SI COMO NO PUTO K APOCO ERES EL HM

EL HM ( e-mail: )
Miércoles 16.02.2011 / 10:48
K NADA ASI MEGUSTA PUTOS

EL HM ( e-mail: )
Martes 15.02.2011 / 10:29
ESTE MENSAJE BA PARA LOS DISKE PRM HIJOS DE SU PUTA MADRE SIGAN PONIENDOSE Y ME LOS COMERE VIVOS ANDAMOS TRAS DE USTEDES AAAAAA ATTE EL H M PUTOS WELCOME TO PLAZA LA -

HH MM ( e-mail: )
Martes 15.02.2011 / 09:49
NO ANDEN CON MAMADAZ PUTOS ATTE EL H M DE CD JUAREZ OF CRIME BA PARA TODOS

EL ( e-mail: )
Martes 15.02.2011 / 06:15
EL H M PUTOS

EL H M ( e-mail: )
Martes 15.02.2011 / 06:12
ANDAMOS COMO HUESO PUTOS JAJAJAJA

( e-mail: )
Lunes 14.02.2011 / 06:21
PUES Y TU

prm ( e-mail: )
Lunes 14.02.2011 / 04:31
pendejo

PRM ( e-mail: BORRACHO )
Viernes 11.02.2011 / 07:46
Pues quien esta tu?

123 ( e-mail: 123 )
Viernes 11.02.2011 / 07:32
DISCULPA HAY ESTAMOS

PRM ( e-mail: BORRACHO )
Viernes 11.02.2011 / 04:36
Que lastima que ustedes sean unos poquiteros,por eso perdieron la plaza,por eso dan lastima, por eso y mucho mas ustedes son los que no sirven para nada ya que son la bacteria de Juarez. ustedes son unos P... roba bicicletas.

( e-mail: )
Jueves 10.02.2011 / 15:45
MUY BIEN SABEMOS QUE LOS JARUDO LA RIFAN, POR ESO AHY KE DESASERSE DE UNOS, PERO SABEMOS QUE EL BARRIO 7 y LOS UNIDOS 14, MSF, ACG, AA NO VALIERON VERGA PA NADA. ATTE:____________ EL 54

PRM ( e-mail: BARRACHO )
Jueves 10.02.2011 / 05:36
Que groseros,pues que no les da verguensa tanta majaderia? yo solo quiero saludar a mis carnales de la PRM. puroooo BORRACHOOOOOO......

( e-mail: )
Jueves 10.02.2011 / 04:16
freto C... tu P... madre jajajajajaja

DARYONDEADO ( e-mail: dary8452hotmail.com )
Miércoles 09.02.2011 / 16:38
AKY EL SR DARY TGK BOWE FAK TORETO Y TODA LA CONECYON CD JUAREZ PUROSTYLODANGEROUS PARA TODOS LOS GRAFFYTEROS K XPRESAN AL STYLO LYBRE PUTOS X AKY KUANDO PASESN X LA EVE.TALAMANDARYS SALUB DEN LAS PLAKAS DEL SR DARY TGK

el t o ( e-mail: )
Martes 08.02.2011 / 10:59
m la maman todos los del muro atte el freto putos

PRM ( e-mail: BORRACHO )
Lunes 07.02.2011 / 08:31
Claro que si carnal yo estoy mas que puesto y con gente suficiente para partir madres. ya saven como trabajamos por algo estamos ganando plaza.A SI ES CARNAL PURO PRM REVOLUCIONARIO.

( e-mail: )
Lunes 07.02.2011 / 06:11
ARVIZU ESTAMOS AL PENDIENTE PARA DAR APOYO HABER CUANDO NOS HUBICAMOS PERO LO BEO CABRON HAY PAJAROS EN EL ALAMBRE A LA 123 VIVA MI VILLA TENGO JENTE BIEN PUESTA

PRM ( e-mail: BORRACHO )
Lunes 07.02.2011 / 04:58
Estan ardidos porque ya perdieron la plaza pinches fracasados AZCAAACAAASSS eso son ustedes unas mierdas. ni en juarez pueden hacer algo valen madre fracasados. puro PRM COMPA.

puto ( e-mail: )
Domingo 06.02.2011 / 19:41
vean este video http://www.youtube.com/watch?v=aDxLwvoqLns&feature=fvw

MY DREECK .V* B*T*13 AZTECAS ( e-mail: SOMOS LOS BERDADEROS JAJAJAJJAJAJA )
Domingo 06.02.2011 / 16:41
jajjajjajajjajajajjajajajajajajjajaa pinches sinalos de mierdas ÑAÑÑAÑAÑA SABEN QUE ANDAMOS DESMADRANDOLOS PINCHES PUYALES DE LOS MEXICLES BALE BERGA GUNTO CON SUGENTE DE EL CHAPO Y LOS AA QUIEREN DESCURTISADOS PUYALES JAJAJJAJAJ NO ME AGAN REIR ATTE.MY DREECK COCHON ESTOI EN LA COL.INDEPENDENCIA FIRMES PUTOS PARA LO QUE QUIRAN SOSOSOSOSOMMMMMMMMOOOOOSSSSSS LOS #1 LA_____________________________________________________________________________________________________________-EN JUARITOzZ MANDAMOS NOSOTROS EN JUAREZ NO ENTRAN MARANOS MONTA PERRROS

( e-mail: )
Viernes 04.02.2011 / 14:26
freskooos loookooooos!!!!!!!!!!!

seNor hongoman ( e-mail: )
Viernes 04.02.2011 / 09:50
ey yo tengo hongos de todos coiores a y tanvien tengo mota are o k este es mi fon 2875431 markame o si no ayi m acoplo en el altitu

forever ( e-mail: )
Viernes 04.02.2011 / 09:42
a grasias por tus saludetes werota y aese P... m a la V... el freeone t cocha

aaaaaaaaa ( e-mail: www.wera@.com )
Jueves 03.02.2011 / 08:54
un saludo a mi amorsote el daderouner de los world fives de tierra nueva

PRM ( e-mail: ARVIZU BORRACHO )
Miércoles 02.02.2011 / 08:26
Estodo carnal,me gusta ese animo asi son los REVOLUCIONARIOS y la plaza ya esta ganada pero estos putos grañudas no lo quieren aceptar aunque ya perdieron gente y terreno. asus ordenes carnal. puro PRM.....

MEXICO ( e-mail: PRM )
Miércoles 02.02.2011 / 06:01
VAVA MI JENERAL ESTOY AL PENDIENTE CON MI 9MM PARA DAR APOYO HERMANOS ESPERO LA HORDEN Y YO SALTO BORRACHOTE ASTA LA MUERTE HEMOS PERDIDO HERMANOS PERO LA GUERRA LA ESTAMOS GANANDO

whitch D: ( e-mail: xdarkkookiex@live.com.mx )
Martes 01.02.2011 / 15:32
necezito konekte de hongoz y mota chida¡!

PRM ( e-mail: BORRACHO )
Martes 01.02.2011 / 13:21
Me da mucho gusto sever de mi gente,aqui en mi cantina esta todo machin y gracias carnales por reprecentar la PRM,soy Arvizu y traigo una ostia trabajando y necesito que se reporten diganme y les mando mi directa. puro PRM Razaaaaaaaaaa

( e-mail: )
Martes 01.02.2011 / 09:39
HEY HERMANOS SOY UN SEGUIDOR DE PANCHO VILLA Y SIMON A LA 123 Y NO RETROSEDAN SOY DE JUARITO PA LO K MANDEN Y DAR APOYO

PRM ( e-mail: BORRACHO )
Martes 01.02.2011 / 06:56
Gracias carnal. yo soy Ostion al igual que ZAPATA reprecentando el BORRACHO. me gustaria brindar con usted, digame y la mando mi directa. PRM el ARVIZU.

123 ( e-mail: a 123 )
Martes 01.02.2011 / 06:01
SOY 1 PRM MAS AL PENDIENTE CON MI JENTE UNA 45 Y AK 47 PARA DESMADRAR CHAVALITAS EL 12 CONTROLANDO PLASA EN MOCHIS

PRM ( e-mail: MEXICLES )
Lunes 31.01.2011 / 16:30
Pinches coyones AZCACAS o como se hacen llamar? ni en pricion, ni en la calle se les quita lo ocicon. novalen madre. puro PRM. ya lo comprobaron, o NO ??????

MY DREECK .V* B*T*13 AZTECAS ( e-mail: SOMOS DEL V*B*T* COCHONES .AZTECOTAS )
Lunes 31.01.2011 / 14:57
QUE TRANSA CHAVALAS ÑA SELA SABEN QUIEN MANDA PUTOS EN JUARITOZZ LA GENTE DE LOS AZTECAS Y LA _______________________________________________________________________________________________ ___________________________________________________________________-SIENPRE FIRMES CONTROLANDO LA PLAZA Y LIPIADOLA DE ESCORIAS COMO LA GENTE DE EL CHAPO Y LOS ACHICHINCLES DE LOS AA Y MEXICLES JAJAJAJAJ ATTTE MY DREECK COCHON Y PERYCKOTE MATONES SICARIOTES DE LA COL.INDEPENDENCIA #2 CAIGALE PARA ARASAR CON USTEDES AL PENDIENTE CHAVALAS......AJAJAJJAJAJJAJAJAJAJAJJAJAJAJAJAJAJJAJAJAJAJAJAJJAJAJAJAJAJAJAJJAJJAJAJJAJAJAJAJAJJAJAAJMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMM

PRM ( e-mail: MEXICLES )
Lunes 31.01.2011 / 14:03
SOLO DICES PENDEJEDAS Y ESTAN ARDIDOS POR LO POQUITERO QUE SON, USTEDES NO TIENEN NINGUNA PLAZA SOLO DAN LASTIMA.

MR * DREECK COHON ( e-mail: SOMOS DEL V*B*T* COCHONES .AZTECOTAS )
Lunes 31.01.2011 / 12:25
QUE TRANSA CHAVALAS ÑA SELA SABEN QUIEN MANDA PUTOS EN JUARITOZZ LA GENTE DE LOS AZTECAS Y LA _______________________________________________________________________________________________ ___________________________________________________________________-SIENPRE FIRMES CONTROLANDO LA PLAZA Y LIPIADOLA DE ESCORIAS COMO LA GENTE DE EL CHAPO Y LOS ACHICHINCLES DE LOS AA Y MEXICLES JAJAJAJAJ ATTTE MY DREECK COCHON Y PERYCKOTE MATONES SICARIOTES DE LA COL.INDEPENDENCIA #2 CAIGALE PARA ARASAR CON USTEDES AL PENDIENTE CHAVALAS......AJAJAJJAJAJJAJAJAJAJAJJAJAJAJAJAJAJJAJAJAJAJAJAJJAJAJAJAJAJAJAJJAJJAJAJJAJAJAJAJAJJAJAAJMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMM

PRM ( e-mail: MEXICLES )
Domingo 30.01.2011 / 17:24
Azcacas y los poquiteros de la linea de pendejos,pinches collones.ya todos saven que todos ustedes valen madre y no corren nadaaaaaaaaaaaaa. La PRM manda.

MR * DREECK COHON ( e-mail: SOMOS DEL V*B*T* COCHONES .AZTECOTAS )
Domingo 30.01.2011 / 16:18
QUE TRANSA CHAVALAS ÑA SELA SABEN QUIEN MANDA PUTOS EN JUARITOZZ LA GENTE DE LOS AZTECAS Y LA _______________________________________________________________________________________________ ___________________________________________________________________-SIENPRE FIRMES CONTROLANDO LA PLAZA Y LIPIADOLA DE ESCORIAS COMO LA GENTE DE EL CHAPO Y LOS ACHICHINCLES DE LOS AA Y MEXICLES JAJAJAJAJ ATTTE MY DREECK COCHON Y PERYCKOTE MATONES SICARIOTES DE LA COL.INDEPENDENCIA #2 CAIGALE PARA ARASAR CON USTEDES AL PENDIENTE CHAVALAS......AJAJAJJAJAJJAJAJAJAJAJJAJAJAJAJAJAJJAJAJAJAJAJAJJAJAJAJAJAJAJAJJAJJAJAJJAJAJAJAJAJJAJAAJ

PRM ( e-mail: MEXICLES )
Domingo 30.01.2011 / 04:37
La PRM tambien. puro BORRACHOOOOOOOOO.............

( e-mail: )
Sábado 29.01.2011 / 21:33
los jarudo siguen vivoooosss

Mctrak ( e-mail: Trak_.18@hotmail.com )
Sábado 29.01.2011 / 09:25
Q tranza bola d chavalas el swk d juaritos controla para toda la P... gente chavala nosotros no andamos con P... el osmik el oster ell miek el mc trak y los q le siguen recuerden nosotros no andamos con M... swk controla y rifa putos jajajaja m dan lastima putos

PRM ( e-mail: MEXICLES )
Viernes 28.01.2011 / 10:02
y quien eres tu P... ignorante ? un estupido mas ? orale pues. que putas representas babosoooooo.

BY ZEUZ WUAN ( e-mail: )
Viernes 28.01.2011 / 09:32
EL SEUS DEL B. BCL NS 18

( e-mail: )
Viernes 28.01.2011 / 09:25
PUES M VALE VERGA LO K DIGAS PUTO BORRACHOS DE MIERRDA LOS COCHA EL ZEUZOTE

PRM ( e-mail: BORRACHO )
Jueves 27.01.2011 / 17:01
Pienso que eres culo, ni escribir sabes. estas bien wey y pendejo.

BY XEUXONE ( e-mail: )
Jueves 27.01.2011 / 12:34
BY XEUX BY XEUX BY XEUX BY XEUX BY XEUX BY XEUX BY XEUX BY XEUX BY XEUX BY XEUX BY XEUX BY XEUX BY XEUX BY XEUX BY XEUX BY XEUX BY XEUX BY XEUX BY XEUX BY XEUX BY XEUX BY XEUX BY XEUX BY XEUX BY XEUX BY XEUX BY XEUX BY XEUX BY XEUX BY XEUX BY XEUX BY XEUX BY XEUX BY XEUX BY XEUX BY XEUX BY XEUX BY XEUX BY XEUX BY XEUX BY XEUX BY XEUX BY XEUX BY XEUX BY XEUX BY XEUX BY XEUX BY XEUX BY XEUX BY XEUX BY XEUX BY XEUX BY XEUX BY XEUX BY XEUX BY XEUX BY XEUX BY XEUX BY XEUX BY XEUX

BY XEUXONE ( e-mail: No No no )
Jueves 27.01.2011 / 12:20
WELCOME TO BCL K TRANSA AKI TIRANDO FIRMA PUTOS ATTE EL SEUSONE 420 WHEN YOU SMOKE THE HERD NI REVEALS THE TO YOURSE B OSK NSK BMB 87 LOKOTEZ FOREVER PUTOS. ATTE LA OSK

PRM ( e-mail: BORRACHO )
Miércoles 26.01.2011 / 15:51
Quien? los AZCACAS? Ohhooo¡¡¡ los originales? osea los mas pendejooooosssssss.

MY DREECK .V* B*T*13 AZTECAS ( e-mail: SOMOS LOS BERDADEROS JAJAJAJJAJAJA )
Miércoles 26.01.2011 / 09:08
BYG

gato ( e-mail: )
Domingo 23.01.2011 / 10:29
pinches mariquitas dejence de M... y pongance a trbajar

SIETE ( e-mail: )
Sábado 22.01.2011 / 15:36
estodo mi sego asi debe de ser BARRIO SIETE LOCOS los demas son perillotas.

PRM REVOLUCIONARIO ( e-mail: BORRACHO )
Jueves 20.01.2011 / 10:23
Los AA ? y quienes son la gente del CHAPO? putos azcacassss......

PRM ( e-mail: )
Jueves 20.01.2011 / 10:18
Son culos bola de P... linieros mugrosos ustedes no corren nada son puros poquiteros. NO VALEN MADREEEE.

MY DREECK .V* B*T*13 AZTECAS ( e-mail: SOMOS LOS # 1 EL PERICKOTE .JAJAJAJAJA )
Jueves 20.01.2011 / 09:06
QUE TRASA CHAVALAS SA LUDOS AMIS CAMARADAS DE LA COL, INDEPENDESIA # 2 SOMOS LOS DEL MOBIMIENTO LINPIANDO LA PLASA DE LOS AA Y LA GENTE DE EL CHAPO GUSMAN RESPETEN ALOS QUE LESDIO DE COMER PERROS ATTE LA_____________________________________________________-Y LOS AZTECA SOY EL DREECK MATOOON SICARIOTE

ILIAN ZAMANTHA ( e-mail: ilianzamantha@live.com.mx )
Miércoles 19.01.2011 / 14:55
q pus q m3elo aga chidote

( e-mail: )
Miércoles 19.01.2011 / 12:26
estee meckiyoo del sego de dondee saliooo hahahaahhaahahahah siguees vivoo cucarachaaa jajajajajaaj pinchi chavillo mion BEJOTAELESOTA siempre te ha cochaaa mijooo RPSCREEW

( e-mail: LEYVA@ )
Lunes 17.01.2011 / 07:32
UN SALUDO ATODOS LOS DEL B SIETE LA CUESTA POR SEGIR DE PIE ASIENDO DE AGUA ATODAS LAS NENAS Q RODEAN EL BARRIO

SEGO ( e-mail: LEYVA@ )
Lunes 17.01.2011 / 07:29
VALLANC ALA VERGA TODOS LAS CHAVALAS DEL JARUDO Q NO VALEN VERGA QC METEN EN LAS NAGUAS DELAS INDIAS DE SUS JEFAS ATT EL SEGO DEL BSIETE LA CUESTA

fome ( e-mail: fomeshbs@hotmail.com )
Sábado 15.01.2011 / 23:55
orale esta madre esta chida!!!! saludos ala jente!! de la altavista home boys!! el fome

PRM ( e-mail: )
Viernes 14.01.2011 / 09:45
Puro BORRACHO PRM,viva la PRM putosssss.

( e-mail: )
Jueves 13.01.2011 / 16:57
E E E CH INGEN A TODA SU MADRE ESOS WEYES DEL JARUDO CULONES CHES NENAS C BAN A MORIR TODOS BOLA DE PENDEJOS EEE JAROCHAS MIONAS SOBRES PS ESCRAPAS

LA._______________ ( e-mail: )
Jueves 13.01.2011 / 12:18
pura lineota putos doblados ya no qeda ninguno de ustedes weies no valen V... haha

( e-mail: )
Jueves 13.01.2011 / 12:05
SE IIEVAN A DOS TRES PERO IIEGAN CIENTOS (8) AHAHHA SE LA PELAN BARRIO INFONVAVIT JARUDOOO LOCOOOS SEGUIMOOOS RIFAANDO BOLA DE LOMEROOOS TERRESOS.. BJL

SHAGYOneR ( e-mail: W**F**1 )
Lunes 10.01.2011 / 13:00
K GTRANSA K TRANSA MIS CHAVOS OTRA BES AKI EL SHAGYONER DE LOS WORLD FIVE ONE DE TIERRA NEW AY DE RATO WF1

PRM ( e-mail: )
Sábado 08.01.2011 / 05:45
puro PRM REVOLUCIONARIOOOOOO.

wofe ( e-mail: )
Viernes 07.01.2011 / 20:23
b. j A R U D O . L O K O S . E L . W O F E HAHAAHAHA barrio jarudoo lokoss hahahaa

tok el paso ( e-mail: )
Viernes 07.01.2011 / 20:17
los kee lee isieronn esoo a loss dle jarudoo ess puraa emvidiaa pinchii bolaa dee lomeross sicarioss mugrososs drogadictoss amarrensee un huevo y rompansee laa madree pa putasoss paa kee kon kuetess putoss sii see krenn vienn vergass densee enn laa madree a putasoss kon los del jarudoo esoss weiess del jarudoo noo nesesitan pistolas paa darsee en la madree esoss sonn huevoss de barrioo pinchiss mugrososs piojososs de mierdaa hahahahaahhaah

( e-mail: )
Jueves 06.01.2011 / 14:50
kien escribio esa pendaja k nos ban a matar sy ustedes disen no son los de la linia pendejetes si no saben no hablen porfabor

SEUSONE ( e-mail: LKS )
Jueves 06.01.2011 / 11:27
A FELIZ ANO PUTOS 2011

EL SEUSONEREKER ( e-mail: LKS @ E-MAIL.COM )
Jueves 06.01.2011 / 11:23
K TRANSA COMO ANDAMOS AKI BY SEUSONE TIRANDO FIRMA UN SALUDO PARA JUARITOOZ K NO SE RAJA PURO PARA DELANTE 4.20 LA HORA DE LA KEMA PUTOS NO SE RAJEN. ATTE BY SEUS COMO HUESO

PRM ( e-mail: )
Miércoles 05.01.2011 / 12:32
La PRM presente y dejando huella para que los mexicanos la sigan.puro PRM REVOLUCIONARIO.

bjARUDOl ( e-mail: )
Miércoles 05.01.2011 / 11:58
jajajajaja seguimoos de piee putos! ANIMO

SHAGYONER ( e-mail: W......F......1 )
Miércoles 05.01.2011 / 04:17
ARRE MIS CHAVOS PS AKI EL SHAGYONER DE NEW OK WORLD FIVE ONES W....F...1 DE TIERRA NEW 1 ARRE PS DE RATOO LEBAS

PRM ( e-mail: )
Martes 04.01.2011 / 11:24
Que te duele? pues que no te caen bien los PRM? porque? AAAHHH. ya se porque, porque son los que corren el jale.no te aguites nosotros si los queremos a ustedes los queremos mucho.

( e-mail: )
Domingo 02.01.2011 / 16:41
thee**doblee**a**thee**doblee**a**thee**doblee**a

la_craziitaww ( e-mail: lacrazy_pretty@live.com.mx )
Viernes 31.12.2010 / 16:13
poes ke roiio...tsss la neta yo soy nueva en este lugar poes komo dice mi primitow hay ke hacer deporte y para eso pss yo digo ke la mas divertida es parkour jejeje... bno bye kuidence mis chavoss

el darck ( e-mail: puro parkour )
Viernes 31.12.2010 / 16:09
oygan ai q tomar todo con calma ok si estan estresados ps ay q hacer parkour eso les bajara los nervios ok si no saben q es parkour beanlo en youtube ok los dejo el darck es el q les abla ok

el darck ( e-mail: ska_slipknot@hotmail.com )
Viernes 31.12.2010 / 16:06
el darck es el que manda

LA._______________ ( e-mail: )
Viernes 31.12.2010 / 09:59
al P... qe se kre prm no lo vamoz a meter hijo de su P... madre no mucho pinchi roio pinchi tekatiko P...

el dead ( e-mail: el deader locochon )
Viernes 31.12.2010 / 08:55
EL DEAD DE LA 17 LOCOS M.S.H. LOCOTES E.L. D.E.A.D.ONE MeSeHeeRe.........

PRM ( e-mail: )
Jueves 30.12.2010 / 10:19
REPRECENTO LA PRM Y SOY BORRACHO DE CORAZON PURO REVOLUCIONARIOOOOOO, PURO PRM.

EL DEADER ( e-mail: MSHLOCOCHONES )
Jueves 30.12.2010 / 08:21
EL DEAD DE LA 17 ASIENDOSE PRESENTE PARA TODA LA GENTE PUTOS.E.L D.E.A.D LOCOTE

''SHAGYONER'' ( e-mail: B* ''WF1'' )
Jueves 30.12.2010 / 07:54
K TRANSA K TRANSA WF1 RADIKANDO POR TODO JUAREZ LA BARIEDAD DE PUNTOS MIS CHAVOS JEJE Y PS K COMIENSE LA GERRA WF'' WF'' WF'' WF'' WF'' WF'' WF'' WF'' WF'' WF'' WF'' WF'' WF'' WF'' WF'' WF'' WF'' WF'' WF'' WF'' WF'' WF'' WF'' WF'' WF'' WF'' WF'' WF'' WF'' WF'' WF'' WF'' WF'' WF'' WF'' WF'' WF'' WF'' WF'' WF' WF'' WF'' WF'' WF'' WF'' WF'' WF'' WF'' WF'' WF'' WF'' WF'' WF'' WF'' WF'' WF'' WF'' WF'' ''SHAGYONER''

PRM ( e-mail: )
Jueves 30.12.2010 / 04:09
Que grosero,no te da verguensa decir esas palabras tan feas? La linea? cual linea?AH.La linea de pendejos? o la linea de idiotas o la linea de novatos e ignorantes?

LA._______________ ( e-mail: )
Miércoles 29.12.2010 / 19:21
ha ha ha pinchiz doblados nos pelan la vergaa todoz hijoz de su P... madree

( e-mail: )
Miércoles 29.12.2010 / 15:08
theeedobleea lokozzz pokoos peroo lokos

la linea ( e-mail: )
Miércoles 29.12.2010 / 10:43
att.el pewe Y el qeyko desde el pinchi cereso putos

LA._______________ ( e-mail: )
Miércoles 29.12.2010 / 10:40
ya dejence de M... todos los pinchis barrios jediondos qe aorita no es para estar de choloz x internet pinchis mediokres aorita la guerra apenas esta empezando y no acabara

( e-mail: )
Miércoles 29.12.2010 / 10:35
Y ESTOS BABOSOS DE ABAJO QUIEN SON? PURO VICIOSO Y NACOS APESTOSOS QUE SOLO DAN LASTIMA.

( e-mail: )
Miércoles 29.12.2010 / 09:18
"KWS"CLK"RED""KWS"CLK"RED""KWS"CLK"RED""KWS"CLK"RED""KWS"CLK"RED""KWS"CLK"RED""KWS"CLK"RED""KWS"CLK"RED""KWS"CLK"RED""KWS"CLK"RED""KWS"CLK"RED""KWS"CLK"RED""KWS"CLK"RED""KWS"CLK"RED""KWS"CLK"RED""KWS"CLK"RED""KWS"CLK"RED""KWS"CLK"RED""KWS"CLK"RED""KWS"CLK"RED""KWS"CLK"RED""KWS"CLK"RED""KWS"CLK"RED""KWS"CLK"RED"

Rojo ( e-mail: )
Miércoles 29.12.2010 / 09:08
"K A K O S 90" THE RED KWS INFO TEK! "K A K O S 90" THE RED KWS INFO TEK! "K A K O S 90" THE RED KWS INFO TEK! "K A K O S 90" THE RED KWS INFO TEK! "K A K O S 90" THE RED KWS INFO TEK! "K A K O S 90" THE RED KWS INFO TEK! "K A K O S 90" THE RED KWS INFO TEK! "K A K O S 90" THE RED KWS INFO TEK! "K A K O S 90" THE RED KWS INFO TEK! "K A K O S 90" THE RED KWS INFO TEK! "K A K O S 90" THE RED KWS INFO TEK! "K A K O S 90" THE RED KWS INFO TEK! "K A K O S 90" THE RED KWS INFO TEK! "K A K O S 90" THE RED KWS INFO TEK! "K A K O S 90" THE RED KWS INFO TEK! "K A K O S 90" THE RED KWS INFO TEK!

BORRACHO ( e-mail: )
Martes 28.12.2010 / 16:31
La PRM esta muy superior a cualquier grupo de mocosos novatos robo bicicletas,el nombre lo dice todo.PRM PRM PRM.

LA._______________ ( e-mail: )
Martes 28.12.2010 / 13:16
QE MIS JARUDITOS LES QEBRARON A 3 WEIES JAJA X PENDEJOS X KREIDOZ X MAMA HUEVOS X CHABALAS HAHAHA QEE CULEROO HAHA YA SE LO MERECIAN WEIES ENSEÑENCE A REZPETAR PENDEJOS XK LOZ VAMOZ A SEGIR MATANDO A MAS WEIES AHI Y ALOZ PINCHIZ GREÑUDOZ. POEZ NO QE MUY CHOLOZ Y LA VERGA JAJA PINCHIZ LEPEZ MEDIOKRES NO SABEN EN LOZ QE SE METIERON VAMOZ A SEGUIR ARRASANDO CON USTEDES

BORRACHO ( e-mail: )
Martes 28.12.2010 / 10:47
Eres muy diplomatico y valiente FELISIDADESSS.puro PRM EEESSSSEEEE....

(SAW) ( e-mail: )
Martes 28.12.2010 / 10:39
KE TRANZA PINCHI BOLA DE PENDEJOS SE DEVERIAN UNIR TODAS Y DARLE EN SU MADRE A ESOS KE DICEN KE SON SICARIOS NO SON MAS KE OTRA BOLA DE PENDEJOS IGUAL KE USTEDES A ESOS SON A LOS KE HAY KE MATAR A ESOS KE POR MATAR A UN WEY KE VENDIA PAPELES SE LLEVA A NINOS Y GENTE INOCENTE COMO NO LLEGAN DE FRENTE AVER SI SON TAN V ERGAS NO LO HACEN POR KE NO HAN DE SERVIR NI PA DAR MADRAZOS !!ARRIVA!! JUARITOS Y MIS PELOTAS KE MANDAN

BORRACHO ( e-mail: )
Lunes 27.12.2010 / 15:35
En juarez y todo chihuas la PRM precente y reprecentando al REVOLUCIONARIO. puro PRM COMPAAAAAAAAA.

*kYLOS* ( e-mail: )
Lunes 27.12.2010 / 11:40
KE TRANZA KLIKLA DE JUARITOZ AKI AL 100 PURO PADELANTE KOMPA CHEKY "FCK" EN MEMORIA EL PRIMO CHINO DE "LOS K-90" SEAN "SKC" TAPON LOCO CHIRISCO "TNRS 13" GENTE DE AKELLA DE RATO VAMOS A SEMBRAR EL TERROR

BORRACHO ( e-mail: )
Lunes 27.12.2010 / 11:37
Aqui reprecentando la PRM y dejando huella como siempre.puro PRM razaaaaaa.

k-koko ( e-mail: )
Lunes 27.12.2010 / 11:17
ke tranza pinshis bamberos culos unidos jarudo y los ke le sigan la cuesta es de "los fck"putos bien saben ke kontrolamos pinchibola de cholos culones maman V... soy el -5 en la magoffin y brown "foilersotes"

SHAGYSTER ( e-mail: WFOneS )
Lunes 27.12.2010 / 03:11
K ROIO JENTE PS LOS WF OneS SOMOS BIEN ALEGHRES JEJEJE YA SABEN DE TIERRA NEW 1 AY DE NRATO MIS CHABVOS WF1 WF1 WF1 WF1 WF1 WF1 WF1 WF1 WF1 WF1 WF1 WF1 WF1 WF1 WF1 WF1 WF1 WF1 WF1 WF1 WF1 WF1 WF1 WF1 WF1 WF1 WF1 WF1 WF1 WF1 WF1 WF1 WF1 WF1 WF1 WF1 WF1 WF1 WF1 WF1 WF1 WF1 WF1 WF1 WF1 WF1 WF1 WF1 WF1 WF1 WF1 WF1 WF1 WF1 WF1 WF1 WF1 WF1 WF1 WF1 WF1 WF1 WF1 WF1 WF1 WF1 WF1 WF1 WF1 WF1 WF1 WF1 WF1 WF1 WF1 WF1 WF1 WF1 WF1 WF1 WF1 WF1 WF1 WF1 WF1 WF1 WF1 WF1 WF1

BORRACHO ( e-mail: )
Domingo 26.12.2010 / 12:34
Esos REVOLUCIONARIOS,donde andan? Saludos a todos mis carnales de la PRM y lavanto la BOTELLA para desearles un feliz año nuevo.

EL JIMMY ( e-mail: )
Sábado 25.12.2010 / 18:06
PUES AQUI ESTAMOS JALANDO AL CHINGAZO SALUDOS PARA EL MAYITO Y GARDUÑO PATRONCITOS DE LOS AA Y IGUALMENTE PARA EL PARIENTE Y EL BLABLAZO PATRONCITOS DE LA -------- Y AZTECAS ..AQUI LOS SEGUIMOS SURTIENDO ATTE. EL JIMMY CARTEL DE JEREZ.ZAC

BORRACHO ( e-mail: )
Sábado 25.12.2010 / 08:46
Tranquilo no te enojes se te va a derramar la vilis y es navidad.

( e-mail: )
Viernes 24.12.2010 / 08:04
cHinGeee a zuu madree ustede putto theedobleea

( e-mail: )
Viernes 24.12.2010 / 05:13
chIN GEN A TODA SU MADRE LOS DE LA 2A CULONES BAN A MORIR PERROS

( e-mail: )
Jueves 23.12.2010 / 18:05
pfff nooo mancHeez

kanter ( e-mail: dfa1 )
Jueves 23.12.2010 / 17:56
caca para todos n sta nabida

( e-mail: )
Jueves 23.12.2010 / 16:24
Waaaz uup GeenTee aQuuii andamooz loosdoobleea lkz paara loo Quee zeerse

BORRACHO ( e-mail: )
Jueves 23.12.2010 / 15:22
Que pues raza, estan o no estan con la PRM? no somos nuevos ya tenemos historia.PRM aqui y donde quieran culeros.

( e-mail: )
Jueves 23.12.2010 / 13:11
ooo Tee Qaala Quee thuuu pinshee barrioo se conoskaa nada maaas poor andarr koon loos aztecaas noo mammeez weei hhaahaa theedooblee a pinsheez tepporoochooz pfff de rattoo theedobleea lkkz

( e-mail: )
Jueves 23.12.2010 / 13:07
Tee Qala pinshee triizte puroo doblee a puToo a zii nadaa maaz

ARVIZU ( e-mail: )
Jueves 23.12.2010 / 06:31
puro PRM la autentica familia maxicana en las calles y en pricion controlamos el jale. los azcacas son culos escuincles robo viejitas.

MR*DREECK ( e-mail: BYG.TRISTE 13* )
Jueves 23.12.2010 / 03:46
KE TRANSAAA PINCHES CHAVALAS DE LOS DOBLADOS AQUI MANDA LOS AZTECASS Y LA------------------------------- CONTROLANDO LA PLAZA Y EL CERESO SIENPRE FIRMES ESTAMOS EN LA COLONIA INDEPENDENCIAS #1 Y 2 V*B*T*13 SIENPRE FIRMES SALUDOS ATODAS LAS MAMIS DE LA COL.SANTA MARIA Y AZTECAS ATTE ,.MY DREECKKSOTE MATOOOONNN JAJAJAJAAJAJ

zsi CCC kzs.. ( e-mail: )
Miércoles 22.12.2010 / 14:07
QQE RROEOO GGENTEEH AKKKI EEL ZSIICCCKZS DEEL ZSIICKZS SSZTIILEE GRRRAFFF ..

SHAGYMAN ( e-mail: WFZOTES OneS )
Miércoles 22.12.2010 / 11:27
K ROIO MIS CHAVOS PS AKI EL SHAGY DE LOS WF1 YA SABEN DE DONDE OK Y 2 3 SALU2 AL KANTER DFA CREW

kanter ( e-mail: DFA1crew )
Miércoles 22.12.2010 / 11:15
e aki el grafitero con mas presensia d todos..jaja elkanter de los DFA1crew...saludos a todos...

( e-mail: )
Miércoles 22.12.2010 / 04:51
tatoos 13 el ckloner

[ne[x]y]onerzetha] ( e-mail: nancy-numberone@hotmail.com )
Martes 21.12.2010 / 11:16
k tranzaaa akii la nexyonerzethaa reportandose (H) jojo akuuu,,& k me shagyy esos penches mnsjs k mandelos alaa gaver mejho....!

SHAGYONER ( e-mail: WORLD FIVE ONE )
Martes 21.12.2010 / 10:12
K WEY NI SABES COMO CORRE EL AGUA PRO JEJEJEJE PRO ME PELAN LA VER GA TU Y 2 3 SWORCULON ARRE PS YA SABES DE DONDE LA AGO MI CHAVO

'FLEKONE' ( e-mail: )
Martes 21.12.2010 / 09:31
K TRANSA AKI EL 'FLEK' TIRANDO FIRMA UN SALUDO PARA JUARITOOZ K NO SE RAJA

theedobleea ( e-mail: )
Lunes 20.12.2010 / 13:09
theeedobleea lokos contolando juaritooz le guzte al k le guzte i si noo pudranzee

SWORONER LOS COCHA ( e-mail: DE LOS JAJAJA )
Lunes 20.12.2010 / 10:34
MIRA PINCHY SHAGYONER DE MIERDA ANDAS CAGANDO LA VERGA PUTO MIRA ME VALE VERGA SI ERES DE LA WF1 AKI CON MIGO SE SIENTAN

cholo ( e-mail: )
Domingo 19.12.2010 / 17:37
soy cholo y que me gustan que me la metan los de mi barrio siempre me van a gustar las veergas putoos! jarudotes pa la raza

ARVIZU ( e-mail: )
Domingo 19.12.2010 / 06:35
yo odio alos que odian a los mexicanos.los mexicanos son los H... ones y los que corren el jale puro PRM compaaaaa.

( e-mail: )
Domingo 19.12.2010 / 02:17
odio a los putos mexicano!!!!!!!!!!!!!!!!!!!!!!!!!!!!

sees ( e-mail: )
Sábado 18.12.2010 / 12:55
Vayanse ala V... picnhe vieja que me esho la shota ase 3 semanaas coman pitooooo me voy a a vengaaar ala vergaaaaaa!!!!!!!!!!! las voy a matar C... por pinches chismosas

SHAGYONER* ( e-mail: W F 1 LkS* )
Sábado 18.12.2010 / 03:59
SHAGYONER ASIENDO EL REFUEGOOO EN TIERRA NEW MIS CHAVOS WORLD FIVE ONE

ARVIZU ( e-mail: )
Viernes 17.12.2010 / 15:43
PRM eso carnales vamos con todo.

theedobleea ( e-mail: )
Viernes 17.12.2010 / 10:34
zaluudando a todooz looz doblee a munii y rinconez

theedobleea ( e-mail: )
Viernes 17.12.2010 / 10:29
calllezee putoo no mamen primero aprendan a escriibir pinshees lomeros de M... jajaja apesta a puroo san pancheerro hahaha theedobleea lokooz hohoho

ARVIZU ( e-mail: )
Viernes 17.12.2010 / 10:07
solo la PRM save correr el jale y solo los azcacas saven correr el ocico. ANIMO MIS BORRACHOS puro PRM.

SHAGYONER ( e-mail: b WF1 ** )
Viernes 17.12.2010 / 09:10
BARRIO DOBLE U EFE UNO LOKOS WORLD FIVE ONES SHAGYONER

WF1 ( e-mail: SHAGYONER )
Jueves 16.12.2010 / 10:29
PFF BALEN PARA PURA VERGA JEJEJE 2a de kakas jejeje ni si kiera pones kien eres culon ni de donde son jeje balen pa pura madre jejejeje world five one de tierra new culon jejeje

e---------mail empe ( e-mail: )
Jueves 16.12.2010 / 10:09
AMARENSEN POR K BAMOS CON TUBO 50 JAJAJAJAJAJAJA

LA ------------ ( e-mail: )
Jueves 16.12.2010 / 10:05
SI NO LES GUSTA PONGANSEN PUTOS ALOS K SON MOVILISADO POR EL PATAZ CORTAZ EEEEEEEEEE PERROS

LA ----------- ( e-mail: )
Jueves 16.12.2010 / 10:02
LOS UVICAREMO PERRO CHAPULINES ATTE LA -------- SIGIMOS AREMANGANDO

HTTP ( e-mail: )
Jueves 16.12.2010 / 09:54
ATTE LA ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- K PUTOS

ARVIZU ( e-mail: )
Jueves 16.12.2010 / 06:48
puro PRM BORRACHOS REVOLUCIONARIOS, bola de P... pinches azcacas valen madre jotos verijones. puro PRM razaaaaa.

( e-mail: )
Jueves 16.12.2010 / 05:38
HARUDO LOKONES Y SOMOS BIEN WEED I NO SOMOS NI GUNA MAFIA SOLO SOMO DE BARRIO I TENEMOS LO K KISERAN TENER DE TODO LOKOS JAJA AKI AL CIEN PARA LO K GUSTEN PINCHI CHABALAS RESPETAMOS LO K NO ES DE NOSOTROS PERO NO SE PASEN DE BERGA PORKE BAMOSSS CON COCHILLO EN MANO NO PRESUMIMOS NADA SOLO SOMO BARRIO JARUDO LOKOS .

( e-mail: )
Miércoles 15.12.2010 / 15:08
doooblee aa puutos pinshe wf1 me los pazo por los huevos de seguro an de ser puros pinshe lomeros de mierda

( e-mail: )
Miércoles 15.12.2010 / 14:58
noo mamen pinsheez wf1 pinshee bola de mamadorees nosotros no necesitamos de nada culeroos i shingeen a toda su madree ustedes putoos el doble a vive putoos leez guzte o no les guzte

B J A R U D O L . OKOS ( e-mail: )
Miércoles 15.12.2010 / 12:12
HAHAHAHAHA NO MAMES PINCHIS UNIDOS NETA ESTAN BIEN KAGADOTES JAJAAJ NI PARA MATAR SIRBEN YA KASI LE KITABAN EL KUTE PARA K GUACHE IJOS DE PERRA UN SOLO JARUDO LO ISO DE AGUA I ESO K ERAN TRES Y CON KUETE IJOS DE PERRRA NETA K ABER SI SI SE METEN OTRA BES A JARUDO WEEYES NETA K BAMOS DRECIO PENDEJOS ... COMO NO AI EN LOS UNIDOS ESTA SOLOTE PERO YA NOS ECHARON PITASO DONDE SE JUNTAN NOMAS TRUCHA MIS UNIKUARDOS JAJAJA. JARUDO LOKOS I SIGUE APIE NO LA KAGUEN

SHAGYONER ( e-mail: WF1 )
Miércoles 15.12.2010 / 11:26
K WEYES TIRAN MUCHO ROIO DE K 2A JEJEJE LA NETA NO BALEN BERGA LOS 2A DE TIERRA NUEVA K DODNDE ESTAN LES TEMBLO POR ESO ESTAMOS NOSOTROS EN TODO JEJEJE EL PIOJIYO DONDE ESTA WEYES CON 2 CUETASOTES JEJEJE BALEN DE ATIRO BERGA JEJEJE TODA LA BOLA DELOS 2A CULONES CHIN GEN A SU MADRE PUTOS

AAC ( e-mail: )
Miércoles 15.12.2010 / 05:22
CULO EL WEY NO SEA DOBLE A YA SAVEN HIJOS DE SU PUTA PERRA MADRE SOMOS LOS MEJORES EN JUAREZ

DOS A LOKOS ( e-mail: )
Miércoles 15.12.2010 / 05:18
K TRANZA PUTO YA SAVEN AKA EN EN BARRIO DE LOS DOBLE A POS YA SE LA SAVEN COMO SIEMPRE DESMADRANDO ALOS HIJOS DE SU PERRRA MADRE LOS AZTECAS NO ENTIENDEN LOS PÉNDEJOS K LE VAMOS A GANAR LA PLAZA YA ESTA ABLADO PUTOS CUIDENSE JAJAJAJAJAJ DOBLE A RIFA

( e-mail: )
Martes 14.12.2010 / 15:45
LA RESPUESTA PARA KITAR TODOS NUESTROS MALES, ES CRISTO JESUS SOLO ASEPTALO EN TU CORAZON PERO SIENDO REALMENTE CINCERO Y TU VIDA CAMBIARA PARA BIEN Y AUN MAS SI TUS TALENTOS SE LOS DEDICAS A EL. EL PERDONA TODO PECADO AUN ESE KE ESTAS PENSANDOSE FELIZ NO TE TURVES NI TE AFANES VASTA CADA DIA SU PROPIO MAL.DIOS LES BENDIGA.

omar ( e-mail: electrotama@hotmail.com )
Martes 14.12.2010 / 14:38
byanse a la berga todos puro calle 24 y wsl somos los mejores cabrones

crak ( e-mail: )
Domingo 12.12.2010 / 13:12
no mames cabeza dole u jajajaja a ni sabes k ibentar pendejoo lo k es aser crecer un barrio komo los 2ac k si es barrio no H... aderas komo la tuya mierdaaaaaa doble u hahah pinxes mierds el doble a puthos

conciensia ( e-mail: juarezsocietyfree )
Sábado 11.12.2010 / 15:34
SUPERENLO SANGRE POR SANGRE SI QUE SE TRAUMAN QUE DEFIENDEN TIERRA QUE NI LES PERTENECE POR ESO PASA LO QUE PASA POR ESO ESTAMOS COMO ESTAMOS POR LA FORMA EN LA QUE PIENSAN TODOS VIVEN EN LA MISMA CIUDAD SI SOLO ABRIERAN SUS MENTES UN POCO MAS SE DARIAN CUENTA QUE AL FIN Y ALCABO TODO LO QUE HACEN NO SIRVE PARA NADA ES PURA BASURA A SI QUE RECUERDEN ESO ES LO QUE QUIEREN MEXICANOS CONTRA MEXICANOS VIVA JUAREZ LIBRE

monika!!... ( e-mail: elisa_6868@hotmail.com )
Sábado 11.12.2010 / 11:42
ey k transa!!.na ps aki nadamas djand0 presencia,ia dejen suz pinzhes M... d l0s barri0s neta!.se ven mal ez0 ia paso,pero en fin es zu ped0,sy una m0rra shida d parys ay pa kuand0 le kieran kaer morrit00s tenw0 bariedad d amiwas y n0 es p0r tirar muzha M... pero ps tenem0s stil y estam0s bn buenas jaja!!..ay pa k0t0rrearla ya se la zaben.........trusha,kabrones.

dooblee a ( e-mail: )
Viernes 10.12.2010 / 14:02
vaiazee ala verGa uSteed puTo puro doble a lokos te Guzte o no te Guzte zomo los mejores

b*wf1 ( e-mail: wf ZoTeSones )
Miércoles 08.12.2010 / 14:11
H... en a toda su madre esos weyes dela doblea wf1 c los cocha kuleros y saludenmen a sus jefas

( e-mail: )
Miércoles 08.12.2010 / 13:25
Q traanza jentee aki levantandoo el barrio mazz peesado doblee a lokoz zaludando alooz 2ac munii

( e-mail: )
Miércoles 08.12.2010 / 13:21
ezze pinchee roio k doble u no mamen weiez mamando inventenze otro pinshe barrio putooz doblee a lookotez

SHAGYONER** ( e-mail: DobLe U eFE UnO )
Miércoles 08.12.2010 / 01:08
K TRAMPA PS AKI LOS DOBLE U EFE UNO DE TIERRA NUEVA ASIENDO EL REFUEGO AL 100SOTE NUNKA ULTIMO PRO PRIMERO

perla ( e-mail: )
Martes 07.12.2010 / 10:39
puros unidos los cocha putos y mas al pinchi jarudo mierrda jaja a la berga putos

lluvia marisol ( e-mail: fdhjvfh8gyfmnh. , )
Martes 07.12.2010 / 03:32
cfhfisrujr8gsedikjsgfbs

sHAgyOneR* ( e-mail: wF1 ** )
Martes 07.12.2010 / 01:15
k transa k transa ps aki el shagyoner de los wf 1 de tierra nueva ok los world five somos bien aleegressss putos

antonio dias ( e-mail: elconmander@hotmmail.com )
Sábado 04.12.2010 / 09:29
deseo conbocer chgixcas sexuales

b.unidote 14 ( e-mail: )
Viernes 03.12.2010 / 09:58
el pynchi DUEK de laa MUK putoz

weroner sbc ( e-mail: esebece )
Miércoles 01.12.2010 / 03:35
somos pokos pero lokos en este barrioo hay puro adolecente y en la riña le salimos todo para y alos entrados nos ven pasar y se kedan agachados nos antes pediamos colores para colorear haora pedimos aersosoles para rayar atte weroner sbc fe2chika central

weroner ( e-mail: esebece )
Miércoles 01.12.2010 / 03:30
soy del barrio fe2chika central rifando en la zona de la periferia para lo k seles ofresca el weroner sbc

( e-mail: )
Martes 30.11.2010 / 12:18
el doble a putos

deniisss ( e-mail: )
Martes 30.11.2010 / 10:42
el pinxe ower es pura labia es una M... el wei i su barrio ia ni existe se cree vergas i ni trae nada el wei i thu desasera los doblados jajajajajajajaja no mamaes weeeee a i otra kosas io kreo k ia no ai 2ac pndejo de mierdaaa a i soi una morra k te konose super bn pndjo m kaes en los k no tengo idiotaaaaa ate: denissee mierda jaja gordo

bjl lbp ( e-mail: )
Martes 30.11.2010 / 10:10
k roio px aki kntestando alas k tanto me odian px mejor dicho para las ardidas sea lo k sea fui la primera y seguire siendolo jajajajaj a la verwa las ardidas k me tienen envidia y km io no soe del bajo mundo ps klaro k a perras km tu nunk les boy a ganar xk personas km tu en eso tyenen experiencia bye y siwe ablando de my se k no tienes vida propia

piton ( e-mail: .l. )
Martes 30.11.2010 / 00:23
puro pinchi cholo roñozo y askerozo raya aki pinchis cholos no valen V... P... dan asko a la V... y H... en a su P... madre los malillas .l. A LA VE

HARUDO ( e-mail: )
Lunes 29.11.2010 / 11:59
LA GUERRRA TODABIA NO AKABA HIJOS DE PERRA NO TIRAMOS LABIAAA ESKE NO KALENTAMOSSS EL TERRENO SIMPLEMENTE BERAN LO K SOMOS KAPAS IJOS DE PERRA I POESSSS K LO LEEA SI TE KAI POES BA PARA TY IJOS DE PERRA I SI NO TE KAI POESSSS BEN PARA DARTE MI BERGA BIEN PARA JAJA JARUDO LOKOTESSS BIEN SE LODYGO AKI I EN PERSONA EL PINCHI PUTO KLEEEEEEN

SHAGYONER**** ( e-mail: WFZOTESsssOneS!!! )
Domingo 28.11.2010 / 12:49
K TRAMPA BARRIO WF1 DE TIERRA NUEVA SEGIMOS EN ELL REFUEGGOO SHAGYONER

PBU 14 ( e-mail: )
Domingo 28.11.2010 / 08:49
UNYTED 14 PUTOOZ

CINDY ( e-mail: lachata )
Viernes 26.11.2010 / 21:22
k tranza mi dead k aciendo,k ya no abla x le pegan aok??

PASOS ( e-mail: )
Jueves 25.11.2010 / 16:13
QUE ROLLO AKI HACIENDO PRESENCIA EN NOMBRE DE TODOS "LOS KAKOS 90" DEL INFO TEK AUN PRESENTES AL 100 PURO KWS/CLK THE RED. QUE ROLLO AKI HACIENDO PRESENCIA EN NOMBRE DE TODOS "LOS KAKOS 90" DEL INFO TEK AUN PRESENTES AL 100 PURO KWS/CLK THE RED. QUE ROLLO AKI HACIENDO PRESENCIA EN NOMBRE DE TODOS "LOS KAKOS 90" DEL INFO TEK AUN PRESENTES AL 100 PURO KWS/CLK THE RED. QUE ROLLO AKI HACIENDO PRESENCIA EN NOMBRE DE TODOS "LOS KAKOS 90" DEL INFO TEK AUN PRESENTES AL 100 PURO KWS/CLK THE RED.

EL OWER DE LA GSK ( e-mail: )
Jueves 25.11.2010 / 07:44
MI CASA ES AMARILLA HAY POR LA FELIX CANDELA PREGUNTEN POR EL OWER SU PADRE SANTO ANDAMOS ARMANDO UN COMANDO EN CONTRA DE LOS DOBLADOS Y LINIEROS ANDAMOS BIEN PARADOS CON EL CARTEL DE OBAMA

EL OWER DE LA GSK ( e-mail: )
Jueves 25.11.2010 / 07:41
AQUI EL OWER PRESENTE PURO HORIZONTES LOCOS HASTA LA MUERTE SANGRE POR SANGRE AQUI LOS ESPERAMOS YO Y MI CLICA EL FOWE SEBEK SOWE MINE GSKZOTES TRABAJAMOS EN EL MAQUILON PERO BIEN MENEADOTES Y MEADOTES AL 100 CON EL CIBO MI PIKACHU MEJOR CONOCIDO COMO EL RATON MIGUELITO YA SE LA SABEN

LoRs-HeA ( e-mail: elLORStkocha )
Miércoles 24.11.2010 / 09:31
aki el LORS de la HEA1 RPL 13 RIFANDO PUTOS PURO SUREÑOTE 13 HOMS UNA SALUDO AL WAMPA DE LOS SWS

SHAGYONER*** ( e-mail: WORLD FIVE * WF )
Martes 23.11.2010 / 14:06
EYTALE K ROIO PS AKI LOS WORLD FIVE ONES RADIKANDO POR 2 3 LADOS BARRIO W F 1 DE TIERRA NUEVA SHAGYONER KANAS

( e-mail: dkpcreww )
Lunes 22.11.2010 / 13:24
k rroyoo mis chavosss akii su padree el wykesss dll cuesta lokosss jaja pura dkpsotaaa putoosssss,,dkpcrewww

shagyman ( e-mail: B WF1 BY T.N. )
Lunes 22.11.2010 / 13:11
K ROIO PS AKI BY SHAGYONER WF1 DE TIERRA NEW OK

SUENOKER ( e-mail: SUENOkerone )
Lunes 22.11.2010 / 12:05
ALA VERGA TODOS LOS NORCACAS AKI EL UNICO K RIFA ES EL BARRIO MAS CHINGON SWK DE LA OBRERA 3CE EL SUENOKER PUTOS POCOS PERO LOCOS REYES DEL LADO SUR

CROMO ( e-mail: EGO )
Lunes 22.11.2010 / 08:30
PURA BAMBA 87 NORTEñOTES CROMO SEUS TODO LO VERDE ES VIDAJAJAJAJAJAJ420

SUENOKER ( e-mail: SUENOkerone )
Jueves 18.11.2010 / 10:25
aki esta el suenoker de la SWK DE LA OBRERA putos pocos pero locos ssl

el flow cia crew,,, ( e-mail: )
Jueves 18.11.2010 / 07:35
saludos atodos los grafers de cd juarez carnales echenle ganas suerte con las pintas salu2 el flow cia crew,,, cd juarez,,,,

NOokSeeR ( e-mail: )
Viernes 12.11.2010 / 15:39
DESDE GOMITOS LOKOS EL NOKSER DEJANDO LINEA PRA LS LOKOS DE JUAREZ.MENTES PINTURA STREET N O C K S E R. M P S lokos jajaja shido saken la mota

XXEEUUXX ( e-mail: BAMBA 87 )
Viernes 12.11.2010 / 09:51
K TRANSA PUROS BAMBEROTEZ 87 LA CUESTA LOKONES PUTOS AY ESTAMOS RIFANDO LA COLONIA LA CUESTA OSK EL SEUS DE LA OSK LOKOTEZ. EN MEMORIA DE OSCAR R.I.P Y ARE TODO PARA DELANTE BMB BCL FOWE SOEK SARI KORU WICHO NANI SEUS CROMO CRAF TWUINI PELON SNOOP FASER SOWER ONER NON DISER Y LOS DEMAS PUTOS BCL SEUSONE

( e-mail: )
Jueves 11.11.2010 / 13:49
k pinchis uniditos 14 binieron a balasiarnos pero se la pelaron por k no m mataron aki sigo presente el tomate del barrio jarudo lokos y al rato ba el deskite no mas no se deskuiden putos el barrio jarudo lokos rifa aki el tomate me la pelan

el mero mero ( e-mail: )
Miércoles 10.11.2010 / 08:51
Aqui en juaritos puro stylo matón

BMB ( e-mail: )
Miércoles 10.11.2010 / 06:44
PURA BAMBA 87 SIGUIMOS EN EL RELAJO EL CROMO SEUS AL PENDIENTE CON LA JENTE

ARVIZU ( e-mail: BORRACHO )
Miércoles 10.11.2010 / 06:24
LA PRM ES LA CHINGONA,Y LOS PUTOS AZTECAS NO TRAEN NADA ANDAN CON EL RABO EN LAS VERIJAS Y LAS PATAS MIADAS DE PURO MIEDO Y LA LINEA SI ES LINEA PERO DE PENDEJOSSSS.PURO PRM MEXICLES BORRACHOS FIRMES Y PURO CARTEL SINALOENSE.PRM.

la linea_____. ( e-mail: )
Martes 09.11.2010 / 22:05
LA LINEA NUNCA ACABARA PENDEJOS NOMAS MIRA LAS PRISIONES AZTECAS ASTA LA MUERTE nostros estamos limpiando esta ciudad de ustedes los sinaloenses culos q quieren mas poder del que tienen jaja pero aqui en juarez SE LA PELAN manden mas federales andale calderon sige cubriendo al chapo alrato aver quien te cubre ati

cLik united 14 ( e-mail: )
Martes 09.11.2010 / 13:11
ALAZ VERGAA TODOOZ LOOZ JARUDOOZ Y LOZ PINCHIZ BARRIOZ ENTRADOZ LA PINCHI PBU 14 SEGUIMOZ EN EL PÌNCHI JUEGO PUTOZ HAHAHA

HUMOERONELL ( e-mail: ekid_2ac@hotmail.com )
Lunes 08.11.2010 / 13:17
JAJAJAJA TAN BN MEKOS TODOS TODOS SE LA VUELAN PERO EN PERSONA SON CULOS JAJAJA PINCHES PIRATAAS ESE EL HUMOERONEL PUTOS DE LA ABC

kiikee ( e-mail: )
Viernes 05.11.2010 / 21:37
la barrio kinta sur rifa putos kinterotes lokotes pokos pero lokos

( e-mail: )
Viernes 05.11.2010 / 19:26
eL FFrraaccKK sToM ! sBeCk ! StReF ! lOkEr ! FsT 40sT bPr lOkOtOtOtEs !!! BiEn maRiGuAnO aStA lA mAdRe !!!!

( e-mail: )
Viernes 05.11.2010 / 19:23
eL FFrraaccKK sToM ! sBeCk ! StReF ! lOkEr ! FsT 40sT bPr lOkOtOtOtEs !!!

FFrraaeeccKK ( e-mail: )
Viernes 05.11.2010 / 19:20
eL FFrraaccKK sToM ! sBeCk ! StReF ! lOkEr ! FsT 40sT bPr lOkOtOtOtEs !!!

culo ( e-mail: clos )
Viernes 05.11.2010 / 09:26
que se valla ala V... el pony jaja es culote

( e-mail: )
Viernes 05.11.2010 / 08:11
BARRIO COMPAS DIESICIETE PUTOS.BY EL D.E.A.D.E.R. Y EL K.I.T.SELOS COCHAN PUTOS

DEADERLOCOCHON ( e-mail: MSH )
Viernes 05.11.2010 / 08:07
LA UNO SIETE PUTOS. EL D.E.A.D.MESEEHERE.S.O.U.T.H.S.I.D.E.

( e-mail: )
Jueves 04.11.2010 / 17:14
ASI ES JARUDO LOKOS SE LOS COCHA ATODOS . LOS PINCHIS ENTRADOS BOLA DE KULOSSS EL KLEN BJL

miguel padilla ( e-mail: hormiga_694@hotmail.com )
Jueves 04.11.2010 / 12:44
para los payasos para que gosen con el master flow para quesientan elcocotaso

neyfii ( e-mail: sexycand_21aries@hotmail.com )
Jueves 04.11.2010 / 11:46
k ondaaaaa kiero dar un mensaj3 a un P... k se yama geovani jajaja

daver ( e-mail: dary845@hotmail.com )
Jueves 04.11.2010 / 09:32
k royo putos aky el daver msf y el dary el bowe tgk dando guerra xlos kulytos k rayan kn l kulo

bogar ayala ( e-mail: dary845@hotmail.com )
Jueves 04.11.2010 / 09:26
aky el dary bowe fak tgk south side

( e-mail: )
Miércoles 03.11.2010 / 10:45
HAY ESTAMOS PRM ESTOY LISTO PARA SALIRLE POR MIS BORACHOS

CROMO ( e-mail: CROMO )
Miércoles 03.11.2010 / 10:38
PURA BAMBA 87 NORTEñOTES EL CROMONER SEUSONER RIFANDOSELA

DEADERLOCOCHOM ( e-mail: MSH LOCOS )
Miércoles 03.11.2010 / 08:13
M.S.H LOCOS BY D.E.A.D.E.R.SOUTH SIDE

sKOR BJL ( e-mail: )
Martes 02.11.2010 / 15:28
JAJA SIMON DEAD TU ERES EL KE LA RIEGAA KULERO YO AUSTED NI LO AGO EN EL MUNDO NI ATU BARRIO YA MEJOR AL LIONB KN TIGO WEY

DEADERCOCHON ( e-mail: )
Martes 02.11.2010 / 08:27
ja.ja mira scor megor no empieses a cagar la V... keriendo tirar tu royo por k alultimo los k le andan saliendo porty es tu abuelo y tu tio kana por k tu eres bien chavalota pinchi nina by D.E.A.D

sonek paint street ( e-mail: sonek_ps_crew@hotmail.com )
Martes 02.11.2010 / 08:15
SaludOs para toda la banda de la ack lcg y pa los paint street crew tambienpara los trk bsk para todos los k conosen al sonek da la PS

skoR ( e-mail: B.JARUDO LOKOS )
Lunes 01.11.2010 / 18:31
JAJAA PINCHE DEAD TE LA COMES KULEROO!!!!! K TRANZA AKI NAMAS EL SKORER BARRIO JARUDO LOKOS HACIENDOOTA LOKOS!! LOS DOBLEA SON CULOTES PINCHE SORRA ES DE AGUA Y DRAK LO AGO YORAR JAJAJA JAJARUDOOO

el fixo ( e-mail: )
Lunes 01.11.2010 / 18:13
pinche bola de mocoso chavalas you all nating but wana bs this is a real og from juaritos sur trece jlc levas chapetes x3 gang mexicanos

fixo ( e-mail: )
Lunes 01.11.2010 / 18:03
juaritos como te extrano

( e-mail: tHe bAbYoNe )
Lunes 01.11.2010 / 15:29
SSSSSSSSSSoooooooloooooosss xv

tHe.BaBy.OnE ( e-mail: )
Lunes 01.11.2010 / 15:26
kE RoLlO KuLiToS Pz aK eL BaBy oNe dElO S SoLoTeS Xv sOuTh sIdE LoKoTeS RiFaNdO En hAcIEnDaS uNiVeRcIdAd

( e-mail: )
Lunes 01.11.2010 / 10:26
elstik hijos de putaa jarudo lokosss

( e-mail: )
Lunes 01.11.2010 / 10:19
3 puntos putos

( e-mail: )
Lunes 01.11.2010 / 10:13
jarudooo lokos hijos de putaa

( e-mail: )
Lunes 01.11.2010 / 08:34
scor chnga tu P... madre by dead

SCOR! ONE ( e-mail: JARUDO )
Viernes 29.10.2010 / 07:32
JAJA KE PINCHE DEAD TODAVIA NO ME SUPERAS!!!!!!!!!!!!!! YA SUPERAME WEY NETA KE YO YA NI ME ACORDAVA DE TY NI DE TU BARRIO WEY JAJAJAJAJAJAJJAJAJA

( e-mail: )
Jueves 28.10.2010 / 10:16
todo bien un saludo para mi barrioosea el de la soli 13 homs aqui todo bien cholos sks coox crakens soli rifa cholos spoy de juares chihuahua

adrian ( e-mail: chester69_soli13@hotmail.com )
Jueves 28.10.2010 / 10:11
todo bien todo bien5657 miepa aqui robaron en la soli 13cholos se la aventaqro n van ava ler V... hehehehe putos todos menos los de la soli 13

DEADER LOCOCHON ( e-mail: MSH LOCOS )
Jueves 28.10.2010 / 07:59
NADAMAS PARA ASERME PRESENTE PUTOS EL D.E.A.D. DE LOS MSH LOCOTE.

DEADER LOCOCHON ( e-mail: MSHLOCOS )
Miércoles 27.10.2010 / 08:52
MSH DEGANDO GUEYA POR TODOS LADOS PUTOS NOSOTROS SOMOS LOS INOLVIDABLES PUTOSSSS,MESEHEERE.TODA SU PUTA VIDA BAN ATENER PRESENTE MI BARRIO CANA.BY EL DEAD

EL DEADER LOCOCHON ( e-mail: MSH LOCOS )
Miércoles 27.10.2010 / 08:48
SAVE K PINCHI GUERO CARA DE VERGA BAYASE A CHINGAR TODA SU PUTA MADRE.ANDA MAMANDO A UN CULO COMO EL SCOR K NO BALEN NOMAS K PA PURA VERGA.ASI K MEGOR NI ABLE PUTO Y COMO LOS MSH SE LOS COCHAN PORESO KIERE TIRAR CULON VERDAD PUTO..SABE BIEN K AKI NO SE LA AKABAN BOLA DE PENDEJOS.BY EL D.E.A.D.E.R. L.O.C.O

FUMA MOTA ( e-mail: BCL )
Martes 26.10.2010 / 06:27
LA BAMBA 87 CONTROLANDO EL CROMO SEUS CRAF AL PENDIENTE CON SU JENTE MACLEI VIEN BENIDO

ARVIZU ( e-mail: )
Domingo 24.10.2010 / 06:39
Puro REVOLUCIONARIO PRM,todo tranquilo mis BORRACHOS.puro PRM CABRONESSSSS.

( e-mail: )
Viernes 22.10.2010 / 10:18
BARRIO-JARUDO-LOKOSSSS

( e-mail: )
Viernes 22.10.2010 / 10:11
KE TRANSA HIJOS DE PUTAAA nomas TIRANDO MIERDITAA PINCHESS LOMEROS JEDIONDOSS PINCHES SIETEROS KULOSS ,, Y LOS UNIDOITOSSS KULITOS AKUERDESE MI BLESS COMO SE LE ISO EN LA RUTA KULO NOMAS BAJABA LA MIRADA KULO Y CUANDO LO TRAIAMOS AMADRES I FUE A PEDIR CHICHI CON LOS FEDERALESS HAHAHAHAHAHAHAHAH PINCHESS KULOSSSS JARUDO LOKOSSSSS [

DOBLE.A ( e-mail: CARTEL DE SINALOA )
Jueves 21.10.2010 / 19:34
JAJAJAJA LA LINEA SE ACAVOOO YA NO AY GENTE QUE JALE PARA LA LINEA JUARENZES ESTA HOLA DE VIOLENSIA POR LA DISPUTA DE LA PLAZA YA TERMINO EL CARTEL DE SINALOA YA ESTA EN JUAREZ Y LA LINEA ACAVOO SEGUIRAN ESTRAGOS PERO YA SOLO MORIRAN LOS UNA VES ANTES INCORPORADOS A ESE GRUPO DE LACRAS PERO YA ESTA DISPUTA TERMINO ATTENTAMENTE...EL CARTEL DE SINALO ARTISTAS ASESINOS

ARVIZU ( e-mail: prmarvizuzarazua@hotmail.com )
Jueves 21.10.2010 / 13:06
Como estan mis REVOLUCIONARIOS de la PRM MEXICLES?aca en mi canton todo tranquilo. y ustedes q transa mis BORRACHOS?

cLik united ( e-mail: )
Miércoles 20.10.2010 / 18:58
LOZ QE NO SE LA VA A ACABAR SON USTEDEZ PINCHI JAAROCHITAAZ DE MIERDAA NOO SABEEZ DE LO QE SOMO CAPAZ PUTOOZ EEEEEEEEEEE ASI QEE PONGAANCEE VERGAAAZ CULEROOOZ QEE NOOZ VAAAMOOZ AIIR RIKIIZ HAHAHA Y CUAL PINCHI LEVANTAADOO......PENDEJOOZ NO MAAMEEN Y SI LEVANTARON A ALGUIN NI EZ DE LOZ UNIDOOZ PENDEJOO JAJAJA NETA NO VALEN VERGAAA BAARRIIO UNIDOTEZ 14 LOZ COCHA PENDEJETEZ

LoRs-HeA ( e-mail: el.loko.bcl@hotmail.com )
Lunes 18.10.2010 / 18:50
aki el LORS de la HEA*BCL*4TA tirando el graff pepol ay tamos en el REALOTE y en AMPLIACION pa kuando kieran by:LORS-HEAK-4TA-BCL

( e-mail: )
Domingo 17.10.2010 / 13:13
NO LO ESPERAN K MI BLESS PARA K MANDA A DESIR K BAN A KAER A ESTA SEMAAA AORA SI LO ESPERAREMOS TU KALAKA AKI EN EL BARRIO PUTO . JARUDO LOKOS

bOReK! ( e-mail: KmT!HaCiEnDA )
Sábado 16.10.2010 / 17:48
CKE TrAnZe hOmSs!!!! el BoReK De LoS KmT de HaCiEnDa KE mI GuErO Ya sE La zaVe kE aI AnDaMOS aL tIrO i al 100 PaLoOzZ KonTrAs dArLeS plomOo!!! Ya valiErOn veRgA PInCcHeS uNIDOS aKi en hACiEnDa Ya No KeREmos vErTE pInChE bInEk AuNKe seAs noViO DE la KaRnala De ScOr yA vAlIStEs VeRga POOr SER UNiiIdoss i Ya nO mAmEs TaNtO al SCOR WeY nOmAs Pake No tE PeGeMOS pEnDeJo PiNcHe CuLoNn kMt riFA pUtos ala VerGa cON los uNidoss!! el BoREK!!!

JaRuDOtE!!!!! ( e-mail: GuERO!! )
Sábado 16.10.2010 / 17:43
JAJAJJAJAA EE PUES YA DEJENSE DE MAMADAS NO SE METAN USTEDES NI KIEN LOS PELE PINCHE DEAD YA USTEDES YA PASARON DE MODA YA ESTUVO I NADYE LES BA TIRAR MAMADORA PORKE KIENES SON USTEDES????? PA MAMARLOS TODAVIA FUERA UN BARRIO CHINGON SON PURA PINCHE BOLA DE LOMEROS QUE NI NAVAJAS TIENEN YA USTEDES NETA AKA CHIDA TIREN AL LION!! KE VA VALIR VERGA DESPUES ATTE! EL GUERONE DE HACIENDA UNIVERSIDAD!! BJL

SKOR AND GUERO!BjL HACIENDA ( e-mail: JARUDO HACIENDA UNIVERSIDAD!! )
Sábado 16.10.2010 / 17:39
cKe tRaNZAAA GENTE AKI EL SKORe and gueronEr del barrio jArUdO haciendota!! ay estamos rraza i ala vergaa los pinches entrados y lomeroos cagados!! ee pinches unidos no valen V... pinche bless kieres mas V... mas V... vas a tener!! culeroo!!! acuerdense ke ustedes son unos pinches terrosozz ke se creen narkoos pero no valen verga!!! pork nomas hablan i tiran cuetazoz al aire bola de P... el skoRE LOS COCHA DE HACIENDA UNIVERSIDAD!!!AND GUERONE!!! PUTOS!!!

mr. big blesss ( e-mail: mexican united kriminal )
Viernes 15.10.2010 / 12:13
pinchis jarudas siempre abriendo la mamadora nomas como siempre estan peor ke las putas inventando chismes son matones pero de internet ojala fueran asi en la calle ya saben ke no son de ule P... pero ya saben a ki stoy para cuando kieran venir a cenar plomo de verdad con los united en la calle no por kartitas en la compu como las rukas ke son ke siempre tenemos ke ir de vista por ke les tiembla la donita venir

EL DEADER LOCOCHO ( e-mail: MSH )
Jueves 14.10.2010 / 08:23
M.S.H. LOCOTES LA SEVENTEEN CONTROLANDO PUTOS E.L. D.E.A.D. L.O.C.O.C.H.O.N.

EL DEADER LOCOCHON ( e-mail: MSH )
Jueves 14.10.2010 / 08:17
MSH LOCOTES PUTOS Y NOSOTROS NO MAMAMOS ANADIE YA KISIERAN TENER GENTE ASI COMO NOSOTROS PUTOS. PURA GENTE CHINGONA M.S.H.LOCOTOTES PUTO BY S.U. P.A.P.I. E.L. D.E.A.D. SEVENTEENN LOCOTE

pinchis kulos ( e-mail: )
Miércoles 13.10.2010 / 10:24
que mi uniditos como les kedo los weyes que lebantamos pinchis kulos i disen k no fueron ustedes asi me gustaban llorones i no lo bamos a dejar asi lebantamos a puro longo . pero no que balla pasar mas nomas pongasen trcuha bamos por los chikos pinchis chablas ATTE LOS JARUDOS.

( e-mail: )
Miércoles 13.10.2010 / 10:10
puro pa delante jarudo que lla nos ban a mamar los msh kana

luis ( e-mail: e.luis1@hotmail.com )
Miércoles 13.10.2010 / 10:07
barrio jarudoo loco bjl

EL DEADER LOCOCHON ( e-mail: MSH )
Miércoles 13.10.2010 / 08:17
MSH LOCOTES CANA EL DEAD DE LA UNO SIETE. M.S.H.CONTROLANDO BY SU PAPI EL DEAD

CROMO ( e-mail: CROMO )
Miércoles 13.10.2010 / 04:34
PURA BAMBA 87 EL CROMO SEUS CRAF CONTROLANDO

EL DEADER LOCOCHON ( e-mail: MSH )
Martes 12.10.2010 / 06:23
K TRANSA AKI DE NUEVO NOMAS PARA ASER PRESENTE LOS MSH LOCOTOTES PUTOS EL DEAD.MSH. BCD. D.E.A.D.E.R. L.O.C.O.C.H.O.N. P.U.T.O.S..

Cindy ( e-mail: hola a todos )
Domingo 10.10.2010 / 17:06
Saludos a todos por que creo que si estan a qui es por que son personas interesantes.... Bamos animooo a vivir y a vivir bien.... Gente. No somos unicos somos inigualables.

EL DEADER LOCOCHON ( e-mail: MSH PUTOS )
Sábado 09.10.2010 / 05:13
MSH LOCOTES LA SEVENTEEN COMTROL AKI DEJANDO JUEYA SIN CONTROL PUTOS EL DEAD DE LOS MSH PUTOS..

( e-mail: )
Sábado 09.10.2010 / 05:04
ASI O MASS LOKOSSSS. LOS JARUDO ESTO ES UN MASAKRE PRONTO LO BERANNN .. KLEEN

el dead locochon ( e-mail: )
Viernes 08.10.2010 / 12:01
para k tiran tanto rollo megor dense de bergasos y ya putos para k kieren cuetes k sin cuetes no pueden by el dead.

( e-mail: )
Viernes 08.10.2010 / 10:33
SYGO TIRANDO MI BARRRIO PUTOS JJAJA LA SOPRESITAS JAJA ME BALE BERGA K TENGAN PARO AJAJAJA.. ABER KIEN TIENE MAS JAJAAJ IJOS DE PERRA .. JAJA JARUDO LOKOOOOOSSSSSS DUEÑO DE LA MOTAAAAA 656 LOS ASESINOSSS LOS JARUDO ASI DE SIMPLEEEEE LOS MATONESSS Y LO K MANDAN AKI EN JUARZ.

BARRIO JARUDO LOKOSSS ( e-mail: )
Viernes 08.10.2010 / 10:28
HAHAHA k poes mis unidos kaGADOSSS AJAJA COMO ME DAN RISA IJOS DE PERRA. BUENO MUY EKAPUCHADOSS JAJA SEGUN USTEDES MAMANDO LA BERGA DE LOS MENAADIOSS PERO SABEN UNA KOSAA IJOS DE PERRA NOS BAJAMOS BANDERA ME BALE BERGA K TENGAN UNA 9 WEYESS NOSOTROS LLEGAMOS AUN K NUNCA LO ESPEREN PERO ESTO NO LO DEJAMOS ASI OK PINCHIS MARIKA AMIA ME BA TOKAR CUANDO ME TOKEEEEE ESO NO TENGO MIEDO AKI LOS ESPERO PERO DELES AORA SI ALOS JARUDO JAJAJJAAJ PINCHISS MEKO EL KLEEEN AKI REPRESENTANDO MI BARRRIO I EL SKIT DANDO COMPETENCIA AMI BARRIO IJO DE PERRAAA AJAJA AKI NOSTROS DANDO NUESTRO MAFIA SIN PEDIR HUEBOS A NADIEN NI PAROS AJJAAJ OK EL KLEN SKIT JARUDO LOKOSSS PUTOSSS AJAJAJAJ ASTA LA MUERTE YO KREO ASTA A DIOS LE TIRO MI BARRIO JAJA ..

el deader cochon ( e-mail: )
Viernes 08.10.2010 / 08:30
k transa putos el dead de la seventeen lockos MSH CONTROL

b.unido 14 ( e-mail: )
Jueves 07.10.2010 / 14:14
656 M.U.K LEZ REPRESENTAN PUTOS ESTOS UNIDOZ SON MI ESTILO BARRIO UNIDO AORA PUTOS CON MI ESTILO Y CON LA 9 ZIEMPRE LISTOS ESTAMOZ ENCAPUCHADOZ ARMADOZ EN TU BARRIO

SHAGYMAN ( e-mail: BWF1 )
Jueves 07.10.2010 / 09:23
SHAGY ONER BARRIO WORLD FIVE ONEE DE TIERRA NUEVA OK ARRE DE RATO

EL DEADER COCHON ( e-mail: )
Jueves 07.10.2010 / 08:20
MSH LOCKOTES PUTOS EL DEADSOTE SEVENTEN FOREVER

puRa pincHi pBu k ( e-mail: )
Miércoles 06.10.2010 / 18:36
QE TRANZA HIJOS DE SU PERRA MADRE AKI EL PINCHI BARRIO UNIDOTE REPORTANDOCEE.......

el deader cochon ( e-mail: )
Miércoles 06.10.2010 / 08:49
msh locotes el dead one de la seventeen putos el uniko i orijinal ay nomassss/

gckrew ( e-mail: sicko )
Martes 05.10.2010 / 16:45
UNICKER SER!!!!!!!!!!!!!!!! GECEKA CREW!!

BJL----- ( e-mail: )
Lunes 04.10.2010 / 17:56
Jaaaaaaaaaaaa,,,,,KUIDEZEE MI SPOK....POLE.....BLES VAN A VALIRR VERGAAA....Jaaaaaaaaa,

memo ( e-mail: no tengo )
Lunes 04.10.2010 / 13:55
que transa putos aqui saludando el fluzone de la kfw 18 rifando putoa

unidos X4 ( e-mail: )
Lunes 04.10.2010 / 11:42
jajaja buen rollo mis jarochos de rato les kai la otra llubia de plomo haora va para el pinshi mocoso del klen i sus compiyas y el snaf ia mejor tiro culon pinshi shapetiyo y el putiyo de spek tmb va a valer berga... ai de rato mis shavillos unidet•14

PB7! ( e-mail: )
Domingo 03.10.2010 / 19:13
jajajaja sii wei sigue tirando tu qaqa! si bn sabes qe el BARRIO SIETE siempre te a qoshado ala braba!

( e-mail: )
Domingo 03.10.2010 / 09:13
avver los del siente que pinchi terrosos asquerosos haha nos asecamos ala carretera HAHAHAHAHAHAH simon mi chavillo tirando rol en su barrio tachandoles todos sus murales ( CUALES ) hahhahaha i no la pelan bieen saveen i cuando kieran disque rapersitos BALINES primero limpiese el C... compa ala vrava... i los unidos me dan RISA ni con cuete nos tumban van a wuachar como se asen esos jales sin hablar de rato 255 BARRIO INFONAVIT JARUDO LOCOS DE PIES AORA Y SIEMPRE NO LA PELAN TODOS LOS ENTRADOS I MAS LOS UNIDOS I LOS DEL SIENTE PUES NI EN CUENTA IA SON CLIENTES ( PERIYOTAS ) BJLOSCOCHAN

( e-mail: cacajunior@rocketmail.com )
Domingo 03.10.2010 / 08:33
biba la pinche ciudad mas H... ona de mexico ciudad juares i un dalido atoda la rasa en ciudad juares al barrio 68 en juares son los mas H... ones atte el sombra

sees-tyle ( e-mail: )
Domingo 03.10.2010 / 07:55
SeeS-tyle graffiteando con stylo.

westone ( e-mail: Leo.alba01@ hotmail.com )
Viernes 01.10.2010 / 22:13
ke pedo putos al tiro con el west cabrones tu me odias x ke las ninas se saben esta cancion man e saludos al sone swkmo chido maricas y viva la spk sota loka

( e-mail: )
Viernes 01.10.2010 / 16:35
un saludo para todas las jainas grifas de parte del iserk ...ups... kno

( e-mail: )
Viernes 01.10.2010 / 16:32
k transa aki bien firmes el iserk el kroef keno mandando saludos alos ups y sbi

SHAGY ONER ( e-mail: BARRIO WF1 )
Viernes 01.10.2010 / 14:01
WORLD FIVE ONES SEGIMOS FIRMES

UNITED 14 ( e-mail: )
Jueves 30.09.2010 / 13:39
QEE TRAANZA JAROCHITAAZ DE MIERDA COMOO LEEZ CAYOO LAA PINCHII BALACIADA DE AYER HAAAAA BARRIO UNIDOTEZ 656 LOZ PINCHIS DUEÑOZ DE LAZ YEKAZ Y SEGUIMOZ EN EL PINCHI JUEGOO

duEEqKK ( e-mail: )
Jueves 30.09.2010 / 13:35
SEGUIMOZ EN EL PINCHI JUEGO A TODOZ EZAZ PINCHII LEEVAAZ

SHAGY B*WF1 ( e-mail: B*WF1lks T.N )
Martes 28.09.2010 / 11:06
BY SHAGYMAN BARRIO WF1 DE TIERRA NUEVA 1 SEGIMOS EN EL MAPA COMO SIEMPRE

DRAKONERSOTE ( e-mail: BJARUDOLOKOS )
Lunes 27.09.2010 / 16:46
A LA VERGA PINCHES LOMEROS KULOS EL DRAK DEL LADO BAJO PELIGROSO SE LOS COCHA B·JARUDO·LOKOS UN SALUDO PA EL LADO BAJO BJL EL DRAKONERSOTE

AXERONE HELIO TONY FIONER 727 ( e-mail: RIP SERAFIN !! )
Domingo 26.09.2010 / 18:26
EL BARRIO SIETE IN MEMORY OF SERAFIN!!! ERAS LA VERGA QABRON!

( e-mail: )
Sábado 25.09.2010 / 23:39
727 la cuesta lokos los del 727 los kocha a todos los mugrosos de esta pagina

the axerone in memory of seraf ( e-mail: axerone727@hotmail.com )
Sábado 25.09.2010 / 23:26
ke royo mis chavos aki el axersote y el toni de la barrio siete lokos de la kuesta rifando y cantando improvisando a todos esos weyes estoi callando y tambien para akellos ke solo stan ablando komo los jarudos ke siempre la eestan celestineando pinchi s cahvos tecatos el el axer del bbario 727 les dice P... para ke nomes noa blesn de mas saben ke el 727 los cocha chavos nadaams ke ustedes cuando viene al siet bueno ala carretera no les hacemos nada xk son puros chavillos despues los matan y ahi andan diciendo sus jefas ke eran estudiantes jaja ate axerone y el tonione de la swk lokos de la melchor

JARUDO LOKOS ( e-mail: EL KLEN SE LOS COHA MARIKAS )
Viernes 24.09.2010 / 12:52
ASI DE SIMPLE I SENCILLO LOS JARUDO . LOKOSS. EL KLEEEN UN SALUDOTE AMI AMOR LA MISSS . A MIRIAM . III ALA FIKI AMI COMPAAA. AI TAMOS MIJASS.

SHAGYONER ( e-mail: )
Jueves 23.09.2010 / 17:03
EYEYEYEYEYE K ROIO PS AKI LOS WORLD FIVE ONE DE TIERRA NEW 1 CEGIMOS FIRMES

( e-mail: )
Jueves 23.09.2010 / 11:18
SAKEN EL ARTE DEL GRAFFITI PAN CON LECHE 725 PCL CREW YSTO

( e-mail: )
Jueves 23.09.2010 / 11:15
YSTO YSTO YSTO YSTO YSTO YSTO YSTO YSTO YSTO YSTO YSTO YSTO YSTO PAN CON LECHE CREW GRAFF

( e-mail: )
Jueves 23.09.2010 / 11:10
what sup homies de los pcl les saluda desde aki e utep el ysto derrato les caigo para aplicar el estilo del arte del graff only for art !!!!!!!!!!!!!!!725 crew breat witch milk

the kraz1 ( e-mail: )
Jueves 23.09.2010 / 06:37
zaludz a toda la chole 14 rekuerden k c les kiere machin i hechenle ganas!!!! la chole rifa putz by:iop

jasibella ( e-mail: jasibella@hotmail.com )
Martes 21.09.2010 / 13:34
te odio tanto, espero que nos encontremos pronto en el infierno maldito infeliz, me alegro que te estes pudriendo inbecil

nokserone ( e-mail: )
Lunes 20.09.2010 / 15:59
rap solo putos desde gomitos lokos dando arte MENTES EN PINTURA STREET lokos

lUPE ( e-mail: lupe love 1108@ AIM.com )
Domingo 19.09.2010 / 10:24


LUPE ( e-mail: lupelove1108@AIM.com )
Domingo 19.09.2010 / 10:01
ke tranza saludos atodos los de la guadalajara derecha en especial al kuate ,ray kb y al chikle de su kompa la lupe los extra......o putitos cd juarez es lo mejor

( e-mail: )
Sábado 18.09.2010 / 08:10
K ONDA KIERO saLUDar A MiS Kamaradas DEsDE SILAO GTO PARA EL JOVEN EL TOÑO EL GIL DE PARTE DEL PAJARO DE LOS PACHUKOS

CINDY ( e-mail: CINDY la chata!!! )
Viernes 17.09.2010 / 20:41
K TRANKZAAAAA K RROZZZZZZKYY!! NADAMAS AKI ESTOY PA MANDARLES UNOS SALUDOTES A LOS MSH X7 EN ESPECIAL AL DRACK,DENS,DEAD,DECKER,FLIP y pa pedirle disculpas al Dens.BUENO hay les caigo de rrato.

PRM 36 ( e-mail: )
Jueves 16.09.2010 / 17:40
PRM 36 LOCOS MEXICLES LOCOS PUTOS DE MIERDA

LOS CANCHEROS 46 ( e-mail: )
Jueves 16.09.2010 / 17:37
LOS CANCHEROS 46 DE CHIWAS CAPITAL PARAMOS BOLA PUTOS KOMO LA VEN

SeeS ( e-mail: )
Miércoles 15.09.2010 / 10:43
aqii el sees reportandose! juarez para mii es como un pizarron manchado de sangree!

'BY SEUSONE' ( e-mail: )
Miércoles 15.09.2010 / 05:13
BY CEUXONE BCL 87 UN SALUDO A MIS GERILLEROS LOKOS K ANDAN VIEN ONDIADOS LOKONES AL TIRO PUTO K AYI ANDAMOS VIEN ENFIERADOS POR TODO C.D JUAREZ LOKOS VIEN ONDIADOS NOS GUSTA MATAR PARA DAR LEBANTONES SOMOS LOS MEJORES COMO PANCHO VILLA PUTOS 420 SAKALA BY SEUS...............................................................................................................................................

WF 1lKs ( e-mail: WORLD FIVE ONE s )
Lunes 13.09.2010 / 17:16
WORLD FIVE ONE DE TIERRA NUEVA 1 SEGIMOS FIRMES

Chatero2 ( e-mail: chatitos@yoyo.com )
Jueves 09.09.2010 / 20:17
a href=www.otrochat.comOtro Chat/a

Chatero ( e-mail: chatitos@yo.com )
Jueves 09.09.2010 / 20:14
Chat Chat http://www.losmx.com

SHAGYONER ( e-mail: SHAGYMAN WF1 )
Jueves 09.09.2010 / 12:00
ARRE AKI EL SHAGYO NER DE LOS WF1 DE TIOERRA NEW OK Ç PRO EL DESMADER NO C AKABA

( e-mail: )
Jueves 09.09.2010 / 09:28
LOS MENTES CRIMINALES 62.K PUTOS DEE JUARES NUEVO ASTA EL GRANJERO AI ANDAMOS PUTOS

( e-mail: )
Jueves 09.09.2010 / 05:32
XEUX XEUX XEUX XEUX XEUX XEUX XEUX XEUX XEUX XEUX XEUX XEUX XEUX XEUX XEUX XEU XEUX XEUX XEUX XEUX XEUX XEUX XEUX XEUX XEUX XEUX XEUX XEUX XEUX BAMBA 87 BCL PUTOS ATTE XE UX OESKEYSOTALOKOTES

( e-mail: )
Jueves 09.09.2010 / 05:27
ME LA MAMAN PERAS ATTE BY XEUX NSK JAJAJAJAJA..............................................................................................

betle ( e-mail: )
Martes 07.09.2010 / 17:44
jajaja perros

MR.WEB** ( e-mail: IN MEMORY OF: )
Martes 07.09.2010 / 12:04
RIP....!!*SEBE * DENO * CHUTE * DEL * EAS * NENAS * POLY * MOY * RATA * PÍS * OWEK * COSS * CUATE * POLY * ******* PURO PINCHI VERGOTAS DE LOS MSH 17 !!DESCANSEN EN PAZ LOKOTES!! NO MAS PA K VEAN EL COLOR. DE LA SEVENTEENST.

MR.WEBER!! ( e-mail: *MSH*KINGS*XVII )
Martes 07.09.2010 / 11:58
*BARRIO*COMPAS*DIECISIETE* *CONTROLANDO TODO EL MAPA!!!

( e-mail: )
Martes 07.09.2010 / 03:58
tatuados de arte viva mexico ..caaa........sss

PAJA ( e-mail: )
Lunes 06.09.2010 / 15:35
UN SALUDO PARA TODOS LOS MAMADITOS DEL STEEL GYM GOMITOS LOKOS JAJAJA

LOS BCL ( e-mail: )
Lunes 06.09.2010 / 05:01
K PUTOS PURO NSK LA BAMBA OSK .............................................................................................................

XEUX BCL ( e-mail: )
Lunes 06.09.2010 / 04:38
K TRANSA UN SALUDO PARA MI GATYLLEROS DE BCL RIFAN LA CUESTA LOKOS OSK C BY SEUS

M exican R ight S tyle ( e-mail: MRS c )
Domingo 05.09.2010 / 16:24
viva el arte del graff...........................................................................................................................................................................................................................................................................................................................................................MmmmmmmmmmmmmmmmmmmmmEeeeeeeeeeeeeeeeeXxxxxxxxxxxxxxxxxxxIiiiiiiiiiiiiCccccccccccccccO00000000000000000000,,,,,,,,,,,,,,,,,,,,,paz en ciudad juarez.en los corazones de cada cabroon

REVOLUCIONARTE ( e-mail: ReVoLUci0N aRt3 )
Domingo 05.09.2010 / 09:43
esta suave sigan con esas pintas todo por juarez.

adn ( e-mail: )
Sábado 04.09.2010 / 18:19
akii no0mazz levantado0 el barrio0 puro0 adn ko0mo0 lo0 diice aho0ra do0minamo0s no0zo0tro0s a zii qe pxx ni pedo0

( e-mail: )
Sábado 04.09.2010 / 09:34
UN SALUDO AKEYOS HOMIS K ESTAN EN KADA ESKINA ALOS JARUDO K SIEMPRE TRAIN EL KUETE FAJADO COMO LOS EXTRAÑO PUTOS DESDE KALIFAS

SHAGYMAN ( e-mail: )
Viernes 03.09.2010 / 14:53
ARRE K ROIO PS AKI ESTA EL SHAGY DE LOS DOBLE U EFE UNO WF1 DE TIERRA YORK JEJEJEJE OK AY DE RATO

XEUX ( e-mail: )
Viernes 03.09.2010 / 05:27
UN SALUDOTE PARA LA MISSONE K T.Q.M LOVE B LA BAMBA OSK BCL EL PYRUS XEUX CRAF

CROMO 87 ( e-mail: CROMO NS )
Viernes 03.09.2010 / 05:07
CROMOCROMOCROMOCROMOCROMOCROMOCROMOCROMOCROMOCROMONSNSNSNSNSNSNSNSNSNSNSNSNSNSNSNSNSNSNSNSNSNSNSNSNS4204204LA BAMBA 87 FOWE CRAF SEUS EGO FIKI

froz ( e-mail: prodigy@net.mx )
Jueves 02.09.2010 / 12:28
soy el froz de la ska de juarez un rapero de juarez

XEUSGUAN@hom.com ( e-mail: )
Jueves 02.09.2010 / 06:27
XEUS XEUS XEUS XEUS XEUS XEUS XEUS XEUS XEUS XEUS XEUS XEUS XEUS XEUS XEUS XEUS XEUS XEUS XEUS XEUS XEUS XEUS XEUS XEUS XEUS XEUS XEUS XEUS XEUS XEUS XEUS XEUS XEUS XEUS XEUS XEUS OSK OSK OSK OSK OSK OSK OSK OSK OSK OSK OSK OSK OSK OSK OSK OSKOSK OSK OSK OSK OSK OSK OSK OSK OSK

swk sone ( e-mail: SWKZONE@HOTMAIL.COM )
Miércoles 01.09.2010 / 09:50
SAKEN LA PINTA UN SALUDO PA LOS TRS DEL SONE DELOS SWK MSR CREW DE LA MELCHOR BARREAL LES KEDARON CHINGONAS EAS LINEAS KE PUSIERON EN LA VICENTE GERRERO ANTES DE LLEGAR AL PARKE BORUNDA

XEUS ( e-mail: )
Miércoles 01.09.2010 / 05:21
K PUTO BCL SEUS

XEUSONE ( e-mail: )
Miércoles 01.09.2010 / 05:14
K TRANSA PURO JUARITOZ PUTOS MEXICO SIDE LOKOS B LA BAMBA87 OSK-SEUSGUAN-WALKER-CROMO-CRAF-BCL RIFAN LA CUESTA

REVOLUCION ARTE ( e-mail: rev.mexicana puestotes )
Martes 31.08.2010 / 18:07
QU ONDA,,,,, GRAFITEROS CAMBIANDO ARTE POR TRANQUILIDAD EN JUAREZ

BY SEUS ( e-mail: )
Martes 31.08.2010 / 11:02
K TRANSA SAKEN EL POMO PARA FUMAR PUTOS ATTE BY SEUSONE DE LA OSK COCHA A KI RIFANDO NOMAS LA PINCHY CUESTOTAAAAA NO PISEN DONDE NO DEVEN DE PISAR ATTE LA CUESTA LOKOS 87 RIFAN SOEK FICK DISER KORU DEREK CRAF TWINY LORRO SEUS CROMO PIOLIN PELON FOWE SICKO CLON DIEZ NON MOKO SNOOP SOWER FASER SMOW NEXT SARI ONER WICHO BOKA MUDO PACHEKO B OSKC

CROMO ( e-mail: CROMO )
Martes 31.08.2010 / 05:06
UN SALUDO PARA TODA MI JENTE DE LA BAMBA 87 NS

nice ( e-mail: NICE )
Martes 31.08.2010 / 05:03
evitando problemas y mas problemas paz por juarez tranquilidad en juarez viva juarez arriba chihuahua como MEXICO NO HAY DOS.. Y si le seguimos no acabamos chid0 chid0

( e-mail: )
Lunes 30.08.2010 / 18:25
apoyando....................la gente PAZ POR JUAREZ

( e-mail: )
Lunes 30.08.2010 / 18:22
estamos con el arte paz por juarez

E L E ( e-mail: KM´´ 14 unidos 14 )
Lunes 30.08.2010 / 18:18
TIRANDO LINEAS POR LAS AVENIDAS, BUSCANDO ADRENALINA EN LA CIMA ,COYOTEANDO A LOS TIRAS QUE CUIDAN,SIEMPRE Y CUANDO SEA APOYANDO VIVA LA FAMILIA..ESTE UNA ROLA DEL CABRON DE oFa ..ESTA CHINGONA BUSQUEN EN YOU TUBE oFa...........esta rola habla de un movimiento H... on que surge en agosto del 2010 en cd.juarez chihuahua..por un cambio en nuestra vidas y las de nuestr familias los UNIDOTES 14de colinas de juarez putos XXXXXXXXXXXXXX Los mores trece de lomas de san jose ..que H... ones somos saludos a mi compa el izo la letra y musica ..y este guey le gusta la tambora dele mi diyey.. in memory of el compa AROON

isaac ( e-mail: )
Lunes 30.08.2010 / 15:27
mandando el saludo desde gomitoz lokos para juaritoz shido cn su roio se estan iemdo en grande spero q nadie culee todo sea x paz y x amor al arte... zone saludos a t primo el sima departe del isaac el cuñado de negro... sobres ps sigan aventando esos bombones vien marihuanos jajaja¡PAZ POR JUAREZ!

closet ( e-mail: )
Lunes 30.08.2010 / 11:43
QUE YO GRAFFITEO Y ME GUSTAN LOS VATOS Y LAS MORRAS QUE A NADIE DE AQUI QUE GRAFFITEA LES GUSTA LA VERGA?

sees ( e-mail: )
Lunes 30.08.2010 / 11:28
YA WACHE EL MURAL POR LA SANTIAGO TRONCOSO DE N JUAREZ VIVO LES QUEDO BIEN VERGAS

( e-mail: )
Lunes 30.08.2010 / 05:26
los apoyo, vivo por belair y si se noto, oy nuevo en este portal me gusta el graff. lower valley first.Mr. play saludos a los graf´s de juaritoz apoyense los grafs estuvieron por la alameda y ya los andan borrando las maquinas.

( e-mail: )
Domingo 29.08.2010 / 06:46
que onda me tope unos paisa tirando graf y les dije que pedo eso pr que lo ponian y me dijeron que es una forma de expresarse por la violencia que se vive en mi pais MEXICO y esta chido estos chaboss tenian buen tramo y le dije a mi familia que si me llebaba aber .ellos me dijron de este portal.la neta estan ca..nes se distinguio la av. pues siempre echan arena para qe no se vea,la neta chidos no se si los conozcan pero me hablaron muy chi...zote,de lo que es su reclamo.......saludos atodos los paisanos de MEXICO , sobre todo a todos los de chiwas.naci en el D.F pero me crie en cd.JUAREZ.una ciudad bien H... ona saludos gracias pero ahora estoy indocumentado aca saludos a los espaldas mojadas ......viva cd.JUAREZ CHIHUAHUA MEXICO..GRACIAS POR TODO EXTRANO MIS RAIZES MI GENTE MI FAMILIA..OTRA GRACIAS A MI FAMILIA QUE CONFIA EN MI..todos por juarez con tranquilidad.

serone ( e-mail: middas.camarena14@gmail.com )
Sábado 28.08.2010 / 23:58
ke tranza homies les mando un saludo desde la chavena en juaritos para mis homies ofak aki los kalmo en la 24 st

SWK SONE ( e-mail: SWKZONE@HOTMAIL.COM )
Sábado 28.08.2010 / 18:25
SAKEN LA PINTA PA PEGARLE AKA POR LAS AVENIDAS AKI EL SONE 2 AY TENGO UNOS BOTES NO MAS DIGAN CUANDO ESTE ES MI MSG SWKZONE@HOTMAIL.COM

swk sone ( e-mail: SWKZONE@HOTMAIL.COM )
Sábado 28.08.2010 / 18:14
KE TRANSA GENTE SAKEN LA PINTA ABER CUANDO NOS ABENTAMOS UN MURAL CHIDA PAZ POR JUAREZ AKI EL SONE DE LA SWK MSR CREW MELCHOR BARREAL.....................................................................

C B S c ( e-mail: d e c k onE )
Sábado 28.08.2010 / 17:51
cant be stoping CBS c que transa aca andamos por el valle bajo en el paso tx. tirando lineas de krylon paz por juarez .tranquilidad por juarez pues aya unos putos andan de ojetes que no izieron paro pues les tiembla vamos dejando linea aca desde el puente zaragoza i vamos asta el sta.fe por la av. alameda asi vamos a seguir y al que no le parezca (noesamenazanipleitocomodijoeseweyesloqeestamosevitando)ya saben donde encontrarnos este pedo es viajado y vamos a continuar, toda la gente paz por juarez...tranquilidad por juarez...............................................................Mr..DeCk...............CbS.

WF1****SHaGY ( e-mail: )
Sábado 28.08.2010 / 11:52
K ROIO PS AKI ESTA EL SHAGY DE LOS WORLD FIVE ONE DE TIERRA NUEBA 1 OK AY DE RATO GERY* PORO *TIO * SHAGY*

BCL ( e-mail: E-MAIL )
Viernes 27.08.2010 / 11:46
K TRANSA K TRANSA UN SALUDO PARA LOS BCL BAMBA 87 OSK JAJAJAJAJA RIFAN PUTO K

graff art ( e-mail: )
Viernes 27.08.2010 / 06:30
acoplen un crew ! cantoneando x las torres agregen sees_artstyle@hotmail.com

graff art ( e-mail: )
Viernes 27.08.2010 / 06:26
el graff no muere solo raya el que de veras quiere! sees 20I0

thre ( e-mail: paz por JUAREZ )
Jueves 26.08.2010 / 15:14
saludos al compa zone dale estoy chavo pero no me tiembla ando aca por la altavista poniendo tranquilidad en juarez y tambien paz po juarez todos me tiran rollo que caga palos y que esas M... que pero ni pedo todo sea por tratar de cambiar este pedo unas morritas se acoplaron a patrocinar unas latas y dandole aver que pedo con es guey que le dejaron las nalgotas incadas tmbien eso siguele..el thre sin crew mi barrio solo paz por juarez..saludas a las morritas del arroyo colorado que patrocinaron las latas .miss wendy.missdream.missmagick.hai esta

SWK SONE ( e-mail: SWKZONE@HOTMAIL.COM )
Jueves 26.08.2010 / 10:28
AKI EL SONE DE LA SWK MSR CREW DE LA MELCHOR BARREAL SEMBRANDO EL PANICO POR DONDE CAIGA

FLOW ( e-mail: MSK )
Miércoles 25.08.2010 / 18:11
que transza atodos los graf´s de la ciudad que rifensela un rato aunque sea un mezquite a estos batos cbs ofa ms swk kakos 90 ylc otk yck fws btp lo rz rivers tnuevas anapras el 27 centro central san antonio satelite zaragoza el valle casetas drs mps den ska tko vg ass ot pre tuw vbn infosol infoca infotec xxx db sed zol hio un pqm pml al ofas pl a todos apoyen este pedo para que pare pues despues no habra regreso mejor vamos asiendolo en paz y no arrepentirnos ..CUANDO YA NOSE PUEDA RESOLVER NADA By FlOw MsK.....eljuarez de siempre..................tranquilidad en juarez...

ISSAC ( e-mail: )
Miércoles 25.08.2010 / 15:13
K ROIO MI SONE SOI EL AXIS DE LA SAN ANTONIO GENTE DEL NAIS DESDE GOMEZ PALACIO LAVANTANDO EL 795 SHIDO CN T ROIO DEL GRAFF...

nokser ( e-mail: )
Miércoles 25.08.2010 / 14:44
shido x juarez doblados q el graff vaia p riva saludandolos desde gomez pal. para swk departe del nais y el nokser de MPSK de gomez aki apoiandolos. aki dejando linea jaja. M P S K

*****SHAGYMAN***WF1 ( e-mail: )
Miércoles 25.08.2010 / 10:32
ARRE KK ROIOP PS AKI ESTA EL SHAGYMAN WORLD FIVE LOCOS DE TIERRA NEW OK NAMAS PA K WACHEN PRO PS AY DE RATO LOS Y SALUDOS AL DREX BJL

ARVIZU ( e-mail: prmarvizuzarazua@ )
Miércoles 25.08.2010 / 07:58
PURO PRM MEXICLES U UN SALDO PARA MIS HOMIES DE AAC Y ANIMO MI GENTE VAMOS X TODO.

UN PUTO ( e-mail: OJETE )
Miércoles 25.08.2010 / 07:57
QUE LE PUSIERON A ESE GUEY UNOS REGLASOS EN LAS NALGAS QUE CULERO PERO QE CHINGON POR QUE LO HIZO Y EL OTRO GAY NISE MIRO QE ZONE SIEMPRE NO

( e-mail: )
Miércoles 25.08.2010 / 07:53
orale pues que les temblo sigan cabrones ustedes que saben poner arte apoyense

FLOW ( e-mail: MSK )
Miércoles 25.08.2010 / 07:50
SALUDOS ESTE PEDO SE OYE EN TODO JUAREZ CABRON Y SI UNOS DOS TRES ANDAN ACIENDOLO POR NOSOTROS NO VAMOS ASEGUIR DANDOLE NOSOTROS KN INSIGNIAS DE PAZ Y NO CON ARMAS ...TODO QUEDE EN UN BUEN VIAJE YO TAMBIEN UN vs CON QUIEN QUIERA ENTRARLE ESE PINCJIE YEYA ES COMPA Y LE PUSIERON UNA CHINGA LOS FEDERALE POR QUE PLAQUIO DOS TANQUETAS CHINGONAS Y LE DIJO ELGUEY TA BIEN PERO NO MAMES ESTA MADRE YO LA TRAIGO PUTO LE PUSIERON UNOS PUTASOS Y APENAS ANDA CAMINANDO LE DIERON COMO EN LA ESCUELA UNOS REGLASOS EN LAS NALGAS PERO NO HAY PEDO YEYA TE SIGO APOYANDO SABES DONDE ESTAMOS NO COMO ESTOS PINCHIES NINITOS QUE LES TIEMBLA..................................................................................................que mi zone SWK salele a ver le dijiste a este guei y se dejo cae hay por la paseo tiunfo..flow MSK c

N R 2 ( e-mail: B U F O N E S c )
Miércoles 25.08.2010 / 07:41
QUE TRANSA MI GENTE DL GRAF SALUDOS VAMOS POR MAS CONQISTA ASI QUE PAZ X JUAREZ .....PAZ X JUARZE ...PAZ X JUAREZ ...PAZ X JUAREZ....MUY BUENA IDEA LO ANDO PONIENDO EN PRACTICA ..TRANQUILIDAD N JUAREZ...TRANQUILIDAD NJUAREZ..TRANQUILIDAD N JUAREZ...TRANQUILIDAD N JUAREZ..QUE CHINGON YA ME DIJO UNPRIMO QUE ESTA EN MONTERREY QUE MIRO LAS NOTICIAS Y QUE QUIERE TAMBIEN ESTO By eNrEdosBUfones laJILOTEPEC PUESTOTA APOYANDO EL ARTE EN JUAREZ............

ARVIZU ( e-mail: prmarvizuzarazua@ )
Miércoles 25.08.2010 / 07:27
Animo mi raza mezcalera puro PRM esos pinches trensudos no traen nada putos azcacas jotos.

AAC ( e-mail: )
Martes 24.08.2010 / 15:36
K ROLLO GENTE COMO ANDAMOS UN SALUDO PA TODOS LOS 2AC K COMO SIEMPRE ANDAMOS RIFANDO EN JUARITOZ NO MAS PA K GUACHEN LOS AZTEKILLAS DE MIERDA HORA K NO PUEDEN GANARNOS LA PLAZA Y NO LO ARAN HORA PUES HAY DE RATO

SHAGY WF1**** ( e-mail: )
Martes 24.08.2010 / 11:19
ARRE PS AKI KOMO SIEMPRE DEJANDO LA MARKA DE LOS WORLD FIVE ONE DE TIERRA NUEVA 1 YA SABEN Y AY MAS EN LA GOMES MORIN EN LA JILO Y RIVERAS 9 NAMAS PARA K GUACHEN SHAGYONER WF1 DONDE KIERA

ARVIZU ( e-mail: prmarvizuzarazua@hotmail.com )
Martes 24.08.2010 / 07:49
Viva la revolucion viva la PRM MEXICLES puro MEZCAL mi raza.

el jabies ( e-mail: tierra nueva 2 )
Martes 24.08.2010 / 06:07
neta que si wei este wei trai raya chida aca tambien eandan rayando eso tranquilidad en mi ciuadad y paz por juarez ta chidosigan con esste pedo ya los pinchis sicarios se pasaron de lansas que bueno que se miro la otra ocasion en las noticias que un cabron tubo uns hhhhhhuuuueeeeebbbbbb......................ssssss.para hacer eso y tambien me di cuenta que icieron un buen grafyty en la pgr y lo pintaron pa qe no se supiera salgan sigan el jabies tierra nueva 2 lokos rifan

grillothine ( e-mail: k2t@live.com.mx )
Lunes 23.08.2010 / 20:56
que roio cabrones ya hace rato que no ando rayando por las calles la verdad no entiendo mucho k pedo kon sus barrios pero poes igual io me fui mas por el royo de los teams jeje solo le kiero decir al cabron k rayo eso de kiero mi cd en paz k komo raya vergas y no ando mamando ni mucho menos pero cabron pokos en esta cd komo tu wey jeje no digo k no traiga estilo pero la verdad es k hay k saber reconocer kuando alguien raya H... on la neta sigan asi esas son buenas pintas cabrones. hay k dar de k hablar en las noticias pero no por P... de los narcos!! si no por kosas komo estas!! grillothine kapirotea2 team

chuco 13 ( e-mail: silencio inf.solidaridad )
Lunes 23.08.2010 / 19:10
DEMUESTRANOS CABRON QUE NO TE CULIASTE Y QUE VAS A ASER ARTE ABER HIJO DE LA CHINGADA DALE HAY POR TU AVENIDA O TE DA MIEDO SALIR POR LO QUE ESCUPÌSTE BASTARDO.....ESTO NOES DE chistesitos mi ninita si quieres RESPETO ULERO GANATELO TU Y TUS PINCHIS HEDIONDOS DE TU BARRIO AS GRFITY POR la tecnologico vamos haber tus medias o TUS UNAS KN QUE VAS A DARLE CON lipstick JAJAJAJAJAJ DALE KULITO CUANDO PASES POR ACA MIRARAS LO QUE PUSE.........ARRE GENTE LOS APOYO TRANQUILIDAD EN MI CIUDAD..JUAREZ PAZ...un cholo cualquiera QUE ONDA ZONE SWK SIGUELE BATO TE APOYAMOS QUIERES ESQUINA TE LA DAMOS TU QUE TRAES MAS ESTILO GRAF .YO ESTILO CHOLO PERO TE TIENES ESQUINA

chuco 13 ( e-mail: silencio inf.solidaridad )
Lunes 23.08.2010 / 19:02
DEMUESTRANOS CABRON QUE NO TE CULIASTE Y QUE VAS A ASER ARTE ABER HIJO DE LA CHINGADA DALE HAY POR TU AVENIDA O TE DA MIEDO SALIR POR LO QUE ESCUPÌSTE BASTARDO.....ESTO NOES DE chistesitos mi ninita si quieres REPETO ULERO GANATELO TU Y TUS PINCHIS HEDIONDOS DE TU BARRIO AS GRFITY POR la tecnologico vamos haber tus medias o TUS UNAS KN QUE VAS A DARLE CON lipstick JAJAJAJAJAJ DALE KULITO CUANDO PASES POR ACA MIRARAS LO QUE PUSE.........ARRE GENTE LOS APOYO TRANQUILIDAD EN MI CIUDAD..JUAREZ PAZ...un cholo cualquiera

chuco 13 ( e-mail: silencio inf.solidaridad )
Lunes 23.08.2010 / 18:55
QUE MIJA TE DIO MIEDO TE SENTISTE TRIZTE POR LO QUE LE PASO A TU PICADOR E,E ,EE.PUES NO QUE MUY CHINGONES Y QUE SE BURLAN DE LO QUE PASA EN MI CIUDAD.MI CIUDAD JUAREZ CHIHUAHUA MEXICO. Mierdititas orale putos no que te da risa de los muertitos (QUE DIOS LOS TENGA EN GLORIA QUE NO SE POR NI QUIERO SABER PERO QUE DUELE QUE TANTAS FAMILIAS ESTEN DE LUTO Y NO PODER HACER NADA Y QUE TAL VEZ CON EXPRESION DE ARTE TODOS NOS UNAMOS PORLA TRANQUILIDAD, QUE EL , ESTE , AQUEL QUEREMOS))CHUCO SILENCIO INF.SOLIDARIDAD TRECE

( e-mail: )
Lunes 23.08.2010 / 13:08
JAJAJA SIMON ...!!! HOMS NOS NOS BURLAMOS SOLAMENTE USTES KIEREN UN RESPETO TA BIEEN PORKE NOSOTROS SABEMOS KE ROLLO I SABES COMO ES ESTO NO NOS BURLAMOS SOLO DESIMOS K ALA BERGA SI NO ESTAN TACHANDO ESE PINCHI MOKOS K BA BALIR BERGA PORKE NADIEN LO ASE AL MUNDO II AKA BAJO K KIERE SE KIERE ASER FAMA SOLO POR DESIR JARUDO KULOS JAJA SIMON WE DI LO K KIERAS YA NO BAMOS A HABLAR SOLO DESIR YA UBO UN REGAÑO OKKKK .... JARUDO NOMAS _-

chuco 13 ( e-mail: silencio inf.solidaridad )
Lunes 23.08.2010 / 04:39
que paso con los que segun son los matones del jarudo ya se acabo de matones a fosas ahora quieren que los entierren...jajjajajajajajajajaja pues no que muy matones que se rien de los muerttos de juarez .putos ya comense a grafitear por las calles paz por mi ciudad y queremos tranquilidad en mi cidad. y la nete to si soy cholo a mi gente del infonavit solidaridad puest0tes gente.que onda sigan homs con esto que onda zone como la llevas no he visto tus pintas el chuco trece del info sol

homosexual pasivo ( e-mail: .COMONEGRA )
Domingo 22.08.2010 / 18:12
ESTOS GRAYFITEROS PINTENME A MI UNA BIEN GRANDE AQI.SI ERES SOLTERO BUSCAME Y CONTECTAME YO 18ANOS VOY A CUMPLIR 19ANOS VIVO POR EL PARQUE CENTRAL EN LA ENTRADA DEL CHAPARRAL DE VALLES ANDO BUSCANDO QUIEN ME CONSIENTA Y ME DE POR MAS CARINO MI DIRECCION NOLA DEJO ME PUEDEN CONTACTAR AQUI TODA LA MANANA ESTOY EN LA CASA ME SALI DE LA ESCUELA ESTE SEMESTRE.YO TE CONTACTO DEJA TU CEL. LA COLONIA SE LLAMA JARUDO POR UN PARQE Y AI NOS PODREMOS ENCONTRAR NO GORDO NI FLACO NO ESPINILLUDO NI PELUDO BONITAS PIERNAS Y BONITA CARA.YO PASIVO

( e-mail: )
Domingo 22.08.2010 / 08:10
WS42NDFAMILIA CRIMINAL,PRIMERA FAMILIA CRIMINAL13 SOLDADOS SUREÑOS RIFANDO. FSLC13

JUAREZ CHIHUAHUA ( e-mail: M E X I C O )
Domingo 22.08.2010 / 05:43
(((((((((((((((((((((((((((((((((((((((((((((((((((((((((SALUDOS A TODOS LOS CHAVALONE QUE CONTINUAN CON ESTA PROPUESTA CONTINUEN..POR UN JUAREZ DIFERENTE.... por el juarez de siempre))))))))))))))))))))))))))))))))))))))))))))) HEY SI ERES GRAFITERO SAL A LAS AVENIDAS EXPRESA LO QUE SIENTES POR JUAREZ.. Attecjm 0 CJM

JUAREZ CHIHUAHUA ( e-mail: M E X I C O )
Domingo 22.08.2010 / 05:34
HEY ESTE CHAVITO DISQUE DE LOS JARUDOS QUE MUY VALIENTES Y VIOLAN Y QUE SE RIEN DE LOS CAIDOS ,(POR MOTIVOS QUE NO ME INCUMBEN EN PAZ ESTEN EN SU GLORIA).......PERO MIRA PINCHI MOCOSO PENDEJO SI TODOS LOS MUCHACHOS QUE TREAN ARTE , ESTILO ,ESTAN EN BUSCA DE CAMBIAR ESTO.ESTA VIOLENCIA... Y TU MEKETREFE DE MIER... SIGUES DE KAGA PA.... TE VOY A ENCONTRAR...NO..NO..NO..NOO NO NO TE VOY A DEGOLLAR NI A CASTRARTE MUCHO MENOS TEVOY A MOCHAR LA LENGUA Y TE VOY A METER AT KU........POR QUE ESTO ES LO QUE ESTAMOS EVITANDO MAS VIOLENCIA..PERO UNA KOSA SI ESTOY MUY SEGURO AQUI DICE el muro de los graf JUAREZ. AQI NO DICE QUIEN LE GUSTE RAYAR DICE GRAFITY ..POR LO TANTO TU NO ERES DIGNO DE CONTINUAR CON LO QUE HACES Y SI TE BURLAS DE LOS CAIDOS DE CD.jUAREZ IMAGINATE QUE PENSARAS DE TU P...A MAMACITA QUE ANDUBO DE GUILA CUANDO TU TE DISTE CUENTA Y YA SABES CON QUIEN NO NECESITO DECIRTELO..ASI QUE PUNETILLAS TEKALMAS O TE LO IDGO ENTU KARA DE LANTE DE P..TA MAMACITA .....(((

$TAR ( e-mail: )
Sábado 21.08.2010 / 21:08
porque piensan que es malo que la gente este pidiendo un alto a la violencia? mejor educate porque el pobre eres tu porque no sabes deletrear meaning you suck dumbass quick to talk to shit because you are probably one of those lowlife scumbags fucking up mexico you are a fucking piece of shit die slow bitch

( e-mail: )
Sábado 21.08.2010 / 07:17
LOS KS SE LOS COCHAN A TODOS LEBANTADOTES POR TODA LA CIUDAD PUTOS REYES DEL STILOOOOOOOO

( e-mail: )
Viernes 20.08.2010 / 10:32
k CHINGADOS KERER PAZZZ AJAJAJ ALA BERGA JARUDO LOKOSS YA DEJA TU MAMADASSS I NOS ANDAS TACHANDO SONICK JAJAJA BAS A BALIR BERGA NOMAS KUIDESE PINCHI MEKO BJL TE COCHA BAS A ABER BAN APONER TU APODO EN LA PARED RIP PINCHI MOKOSO TONTO

W O L F ( e-mail: ONLY FOR ART )
Miércoles 18.08.2010 / 10:15
Que onda raza saludos para todos los que quieren cd.juarez diferente saludos de parte del WOLF.by oNLY fOR aRT .....ESTE A DE SER UN PINCHIE EXTRATERRESTRE QUE DE SEGURO SU pinchy FAMILIA NO LO QUIZO PUES POR LO TANTO LO DEJO POR ESO ESTA ARDIDO DEL CUX.SIGUAN PINTANDO PAZ POR MI CIUDAD PAZ PAZ PAZ PAZ PAZ PAZ PAZ PAZ PAZ PAZ PAZ PAZP A Z.CONTINUEN NO DEJEN QUE UN EXTRANO NOS INTIMIDEN COMIENZEN ESTO NO ES DE BARRIO CRUE O PANDILLA ES ALGO QUE TENEMOS QUE BUSCAR COMO MANIFESTARN OS TRANQUILIDAD EN CD.JUAREZ POR CLEMENCIA.SIGAN POR LAS AVENIDAS PRINCIPALES QUE SE VEA EL ARTE by..wolf OFAK

VERDAD ( e-mail: A SI ES )
Miércoles 18.08.2010 / 10:03
AVER SI ES CIERTO PINCHIS CULEROS RAYENSE LAS PINCHIS NALGAS AVER COMO SE LAS MIRO Y LES DOY PUNTUACION PINCHIS MUERTOS DE HAMBRE MEJOR TRAGEN FRIJOLES DE ANDAR RAYANDO PINCHIS CULEROS TRAGEN Y TU Y ESE PENDEJO QUE RAYO QE NO QIERO MAS VIOLENCIA EN MI CIUDAD VAYAN A PINCHAR SU MADRE PINCHIS MOCOSOS PINCHURRIENTOS SU PINCHIE PADRE PINCHIES PUTOS MARICONES PINCHIES

ARVIZU ( e-mail: prmarvizuzarazua@ )
Lunes 16.08.2010 / 16:07
Q paso mis BORRACHOS? un saludo a todos mis mexcaleros y puro PRM MEXICLES.

R3D ( e-mail: )
Lunes 16.08.2010 / 07:16
KE ROYO AKI EL ROJO DE LOS KAKOS 90'S CLK=YCK=KWS

( e-mail: )
Domingo 15.08.2010 / 06:45
pinchi shagy de la swk esta todo pinto como michael jacson ajja pinchi ruko kulero

SWKSONE ( e-mail: SWKZONE@HOTMAIL.COM )
Sábado 14.08.2010 / 09:55
AKI ESTA MI CORREO SWKZONE@HOTMAIL.COM NICK PA KE ME CONTACTES WUE Y ABENTARNOS UNAS LINEAS VERGERAS AY TENGO UNOS BOTESILLOS Y UNOS CAMARADAS KE KIEREN PINTAR

OFA ( e-mail: NI CK )
Viernes 13.08.2010 / 12:40
saludos al compa ZONESWK Sabes esta a toda madre este viaje tuyo y del yeya nadamas que tucorreo no puedoentrar pero te apoyo dale cuerda por todas las principales YEYA ONTAS sblenle diganle que ye salio agan arte BY...NICK

OFA ( e-mail: NICK )
Viernes 13.08.2010 / 12:35
SALUDOS SE VIO BIEN CHINGON EN LA T.V . DE QUE NO QUEREMOS MAS VIOLENCIA EN NUESTRA CIUDAD BUSQUENLO ESTO SALIO EN TELEVISA JUAREZ CONTINUEN CONTINUEN TAL VEZ ASI PODRAN VER QUE ES REAL NOMAS VIOLENCIA EN CD.JUAREZ .CHIHUAHUA. MMMMMMMMMEEEEEEEEXXXXXXXXXXXXXIIIIIIICCCCCCCC000.ESTOY BAJO PROCESO JURIDICO POR LESIONES ASI CONTINUEN....para los grafiteros que empiezan aver si es cierto demuestren que quieren un nombre..NO NADAMAS SE OLLE CHIDA YO SOY,YA ME LO PUSE,MI COMPA ES , YA LOBAUTISE.aversiesciertodemuestrensuartenonadamasdepinchiskaguenguesmueretevetealaver..nomamenaxionenputitasdemuestrenquequierenestaciudadconartenoconmamadassoyelgaydelocochadoslesvoyamamarsuvergaYQUE CREEN QUE ASUSTAN NO MAMEN DAN RISA INVITO A TODOS LOS ARTISTAS A QUE APOYEN A ESTOS BATOS CREO SON swk,cbs,srm.by´nick first 0NLI FOR ACTIO

SPUNKY* WFlks ( e-mail: SPUNKY ONE )
Viernes 13.08.2010 / 05:15
EYEYEYE K ROIO AKI ESTA ELO SPUNKY DE LOS WF DE TIERRA SUELTA JEJEJEJEJE NOMAS DEJANDO EL LA MARKA

OFA ( e-mail: NICK )
Jueves 12.08.2010 / 18:56
SALIO EN TV. LO DE LA PINTA CONTINUEN

I WANT PEACE IN MY CITY ( e-mail: )
Jueves 12.08.2010 / 12:39
YA NO QUIERO VIOLENCIA EN MI CIUDAD!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!! QUIERO PAZ!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!! POR EL AMOR DE DIOS YA PAREN CON TODA ESTA VIOLENCIA!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!

BY FACERONE ( e-mail: FACE------ACI-CREW )
Miércoles 11.08.2010 / 09:35
PS A KI ESTA EL FACER ONE ACI CREW OK DEKORANDO PAREDES Y LO K C ATRABIESE OK FACER*MICRO*DEIM*RELEK

OSK ( e-mail: )
Miércoles 11.08.2010 / 05:41
BCL OSK- SNOOP FASER SOEK CRAF TWINI CROMO SARI FOWE ONER MICK FIK JAJAJA

SECK ( e-mail: BCL )
Miércoles 11.08.2010 / 05:36
BCL 87K K TRANSA AKI EL SEUS REPORTANDOSE CON LA GENTE BY SEUSONE LOS COCHA

SECK ( e-mail: )
Miércoles 11.08.2010 / 05:26
K TRANZA PAYSAS COMO ANDAN WELCOME TO BARRIO

CROMO ( e-mail: CROMO )
Miércoles 11.08.2010 / 05:20
EL CROMONER SEUSONER BAMBA 87 TODO LO VERDE ES VIDA 420

OFA ( e-mail: NICK )
Martes 10.08.2010 / 17:23
HEY ESTOY EN TUCSON AZ. Y ME DA GUSTO QUE CONTINUEN POR ESTE CAMBIO CON ARTE ME METI POR CASUALIDAD HACE UNOS 40 DIAS Y ME ENTERE QUE HAN ESTADO EN CONTACTO DOS QUE TRES ARTISTAS DE MI TIEMPO ASY QUE CONTINUEN SE QUE LO VAMOS A LOGRAR AQUI TAMBIEN HAY UN DESASTER POR LA LEY NUEVA CONTRA PAISANOS ASI QUE ME DAN GANAS DE EMPEZAR TAMBIEN AQUI. SOY DE LOMAS DEL REY POR LA JILOTEPEC Y PANAMERICANA LOS EXTRANO PRONTO ME MANDARAN PARA HAYA. CONTINUEN TODO SEA POR CAMBIAR TIDO POR LA PAZ.....BY´´NICK only for art.

face-----one--aci ( e-mail: FACERONER--------- )
Martes 10.08.2010 / 08:49
orale ps aki esta the face------one----aci crew ok adekorar la ciudad ok todas las crews de juaritos city

SWK SONE ( e-mail: SWKZONE@HOTMAIL.COM )
Lunes 09.08.2010 / 07:54
E YEYA PONTE EN CONTACTO CONMIGO PA LO DE LA PINTA ESTE ES MY EMAIL SWKZONE@HOTMAIL.COM

SWK ( e-mail: YEYA )
Lunes 09.08.2010 / 05:36
SOAROUND WON.T KRYLON HEY ME PUSE EN CONTACTO CON LOS DE EL PASO Y LOS ANGELES CA.DICEN QUE UN SOLO DIA PARA HACER LA FIESTA POR UN A PRINCIPAL AV. DICE EL DECK DE LOS ANGELES CA. QUE TAMBIEN HACE UN PARO PUES EXTRANA JUARITOS ORALE TODAS LAS ARTES CREO QUE SE ESTA JUNTANDO SALUDOS PARA EL SEARCH DE CANT BE STOPING CBS AYI ESTA JUAREZ PAZ JUAREZ PAZ JUAREZ PAZ JUAREZ PAZ JUARZ PAZ JUAREZ PAZ JUAREZ PAZ JUAREZ PAZ JUAREZ PAZ JUAREZ PAZ BY..YEYAYEYAYEYAYEYAYEYAYEYAYEYAYEYAYEYAYEYAYEYAYEYAYEYAYEYAYEYAYEYAYEYAYEYAYEYAYEYAYEYAYEAYEY

FACER ( e-mail: FACERONE--------- )
Domingo 08.08.2010 / 13:34
K ROIOP PS AKI ESTA EL FACER ONE ACI CREW DEKORANDO PAREDES OK DE RATO JEJEJEJEJE PRO TAG

YO ( e-mail: )
Domingo 08.08.2010 / 08:38
JARUDO LOCOOOSS . AHAAAAM :)

( e-mail: KLEEEEEN BJL )
Sábado 07.08.2010 / 12:40
K ROLLOS HOMSS ESTO BA PARA LO PEDEJITOS K SE KIEREN LUCIR CON EL BARRRIO JARUDO SI SABEN K NO LA KUAJAN ESTO SE ESTA BOLBIENDO OTRA KOSAAA. JARUDO LOKOS SE LOS COCHA ALOS ENTRADOSSSS EL KLEEEEN PUTOSSS.

( e-mail: )
Sábado 07.08.2010 / 07:10
V.FSLOSCRIMINALES ,V.PRIMERA FAMILIA CRIMINAL13,PURO SUREÑOS CONTROLANDO.ITS A CRIMINAL SHOW..

( e-mail: )
Sábado 07.08.2010 / 07:06
BIG WS.SS42LOS CRIMINALES GANGOTA.V.PRIMERAFAMILIA CRIMINAL13,PUROSOLDADO DEL SUR RIFANDO EN JALISCO, TIJUAS,D.F,WSFSLC13 L.A..

SWK SONE ( e-mail: )
Viernes 06.08.2010 / 16:35
AQUI EL SONE DE LA SWK MELCHOR BARREAL SEMBRANDO EL PANICO POR DONDE KIERA

SWK SONE ( e-mail: SWKZONE@HOTMAIL.COM )
Viernes 06.08.2010 / 16:31
SAKEN LA PINTA DONDE CAIGA ILEGAL O LEGAL

bone ( e-mail: fer_lowrider@hotmail.com )
Viernes 06.08.2010 / 11:11
EL BONE CANAS SAKEN LAS LATAS KE TENGO GANAS DE TIRAR LINEAL EH 4:20 MENS

SHAGY WF1 ( e-mail: shagi_wf@hotmail.com )
Viernes 06.08.2010 / 05:53
arre we mejor para torikear chida we ai esta mi msg agregame y para ber como korre el agua sone y ponernos de akuerdo ok de rato

SWK SONE ( e-mail: SWKZONE )
Jueves 05.08.2010 / 13:08
ARRE PUES MY SHAGY ESTAMOS PENDIENTES CON ESAS LINEAS TAMBIEN TENGO UNAS LATAS QUE SON EXPRESARTE NITRO2X ASI SE LLAMAN TIENE UN CHINGO DE PRESION YA TENGO RATO COMPRANDOLAS ME ENTONAN POR SU PRESION CUANDO NOS ABIENTEMOS ESAS LINEAS SACO UNA Y UNA TAPA CHIDA Y NOS AVENTAMOS UNAS LINEAS BERGERAS PONTE EN CONTACTO CON EL DIE Y EL DRASE TU QUE LOS CONOSES MAS PA QUE LES DIGAS DE LAS LINEAS QUE NOS BAMOS AVENTAR O SI QUIERES UNOS MURALES ALCABO YO SE DONDE NOS PUEDEN DAR PERMISO ES EN EL PARQUE BORUNDA Y AY POR EL ALREDEDOR YO YA E PINTADO POR AI O SI NO DIME EN QUE DIA Y PARTE Y AQUE ORAS NOS PODEMOS BER PA DESIRTE QUE TAMBIEN PODEMOS PONER UNAS LINEAS AY POR MI BARRIO LA SWK MELCHOR AL CABO NO HAY PEDO CON EL BARRIO QUE TE PARESE UN SABADO DE ESTOS QUE DESPUES BIENEN CHIDO MY SHAGY ESPERO QUE LEAS ESTO ATTE EL SONE SWK MSR CREW MELCHOR BARREAL

SHAGYMAN ( e-mail: )
Jueves 05.08.2010 / 12:27
ORALE PS AKI ESTA EL SALUDO DEL SHAGY PA EL SONE SWK OK DE RATO NOS PONEMOS EN CONTACTO Y AUN ESTAMOS OK DE RATO LOKO

FACER ACI CREW ( e-mail: )
Jueves 05.08.2010 / 12:04
AKI DE NEW LOS ACI CERW BAMOS CONKISTANDO LAS COLONIAS Y BAMOS POR MAS OK SALUDOS A TODAS LAS CREWS DE JUARITOS DE PARTE DEL FACE YYA SABEN DE DONDE OK ARRE APINTAR PAREDES

SWK SONE ( e-mail: SWKZONE )
Jueves 05.08.2010 / 11:04
UN SALUDOTE DE PARTE DEL SONE DE LA SWK MSR MELCHOR BARREAL. PA LOS MSF DIE.DRASE TAMBIEN PA EL SHAGI DE LOS WF Y TAMBIEN A TODOS LOS SWK DE JUARITOS POCOS PERO LOCOS .-{

SWK SONE ( e-mail: SWKZONE )
Jueves 05.08.2010 / 10:52
AQUI EL SONE DE LA SWK MSR MELCHOR BARREAL NOMAS PA DESIRLE A TODA LA GENTE SSL PA RIBOTA NUNCA AY QUE RENDIRNOS GENTE POCOS PERO LOCOS ONERSOTES DONT FUCK MY STYLE

SWK SONE ( e-mail: SWKZONE )
Jueves 05.08.2010 / 10:45
SONE SWK MSR CREW MELCHOR BARREAL DONT FUCK MY STILE SOUTH WEST KIILAS LEVANTADOTES SONE.STOK.DEFECK.WAZU.SEOL.BLIND.SECK.BRONX.JORS.TOXIK.DOSR.DARE.FORZE.FESK.MAKIKO.BIGER.BOKAL...REST IN PEACE WACKI1.WICKED OLD WEST.VOLTIO ONERSOTES

SHAGYMaN ( e-mail: )
Jueves 05.08.2010 / 09:13
WORLD FIVE LOKOS WF1 TIERRA NEW OK ARRE NAMAS DEJANDO EL RAYON OK SHAGYMAN

SWK SONE ( e-mail: SWKZONE@HOTMAIL.COM )
Jueves 05.08.2010 / 08:33
NOMAS TE QUERIA DESIR MI YEYA QUE TAMBIEN YO CONOSCO UNO LUGARES DONDE TAMBIEN NOS PUEDEN DAR QUEBRADA ES POR EL PARQUE BORUNDA ALCABO YO TAMBIEN E PINTADO POR AI O TAMBIEN EN DONDE DISES TU . YO SOY DE LOS SWK DE LA MELCHOR BARREAL NOMAS QUE YA NO CANTONEO AI AHORA ESTOY CANTONEANDO PARA LA JILOTEPEK TAMBIEEN AY EN MY BARRIO NOS PUEDEN DAR QUEBRADA AY UN CHINGO DE CALLEJONES DONDE PODEMOS PINTAR QUE TE PARESE SI NOS BEMOS EN EL BASAR TONY EN EL CENTRO PARA PLANEAR LO DE LA PINTA NOMAS DI EN QUE DIA Y AQUE ORAS CHIDO MY YEYA

swk sone ( e-mail: swkzone@hotmail.com )
Jueves 05.08.2010 / 08:19
que transa my yeya soy el sone de la swk melchor barreal si bes esto nomas escribe cuando quieres ir a pintar y enque lugar tambien dime en donde nos podemos ber pa planear lo de la pinta alcabo yo tambien tengo unos botesillos chido.........

SW ( e-mail: YEYA )
Miércoles 04.08.2010 / 18:11
JUAREZ PAZ JUAREZPAZ JUAREZ PAZ JUAREZ PAZ JUAREZ PAZ INVITO A TODOS LOS ARTISTAS A QUE LO HAGAN SOLAMENTE ARTE oooooooooooooooooooooo miciudad sin violencia de acuerdo y si no tienen para latas vamos aciendolas pero para que no siga esta crueldad vamos a rebelarnos con arte como lo sabemos acer te espero YEYAYEYAYEYAYEYAYEYAYEYAYEYAYEYAYEYAYEYAYEYAYEYAYEYAYEYAYEYAYEYAYEYAYEYAYEYAYEYA

SWK ( e-mail: YEYA )
Miércoles 04.08.2010 / 18:06
tengo 15 anos sin hacer arte saludos al wild ´´shore´´ de lo ylc al compa duelo yck o kakos 90 del tec. mis respetos .......OTK......... que onda te pongo 70 puntos en una noche sin pleito y sin problemas solamente vamos a darle sin mentarlos la madre arre PERO QUE DIGA JUAREZ PAZ ...JUAREZ PAZ....JUAREZ PAZ. arre notificalo antes del 8 de agosto YEYA,,SWK.

swk ( e-mail: yeya )
Miércoles 04.08.2010 / 17:59
hey SWK sorounnd wont krylon de los mores trece gente km 14 no mientas si eres swk me sobra una caja de crylon vamos a darle escoge la tecnologico ola casas grandes pero sin crue vamos a poner arte como la vez le entras o te quedas fuera

2ac ( e-mail: )
Miércoles 04.08.2010 / 16:35
K ROLLO ESA MIO JENTE DXE LA DOBLE ESPERO Y ANDEN AL 100 SALE PUES HAY DE RATO CULOS LOS DE LA LINEA YA SAVEN NO LA PELAN

FACERONE ( e-mail: )
Miércoles 04.08.2010 / 06:00
ACI CREW CONKISTANDO LAS FRONTERAS OK ARTE CALLEJERO ILEGAL CREW ******* FACFER *RELEK*MICRO*DEIM*

world five one wf1 ( e-mail: )
Martes 03.08.2010 / 15:54
aki los wf1 de tierra nueba ok dejando huella somos bien alegres jejeje

SWK SONE ( e-mail: SWKZONE@HOTMAIL.COM )
Martes 03.08.2010 / 10:20
QUE TRANSA EL SONE DE LA SWK.MSR CREW MELCHOR BARREAL LEVANTANDONOS POR DONDE QIERA

foztheroner ( e-mail: dnselosdefrente@hotmail.com )
Martes 03.08.2010 / 08:10
ee weyes denselos de frente ii no ande de mamones escribiiendosee sii tan hombrezz son denselos dee frente pinzhiss vatos puñetass!!!!!!

mr.fozther ( e-mail: a chinguen asu madre )
Martes 03.08.2010 / 08:06
qee tranzaa aqii el foztheronerr homiss de la ck4 rifando todo el mundoo pa toda la bola de naqeettes puñetass H... uen asuu madree

BY FACE ( e-mail: )
Martes 03.08.2010 / 06:14
ARRE AKI EL FACERONE ACI CREW DESTASANDO PAREDES DONDE SEA DEJANDO TAGS OK DE RATO BOY ASIA CONTIGO Y MAS AYA OK ARTE CALLEJERO ILEGAL CREW FACER * MICRO * DEIM * RELEK*

SHAGYMAN ( e-mail: )
Lunes 02.08.2010 / 17:27
ARRE PS AKI ESTA ELL SHAGYMAN B*WFSOTEZONES WF1 DE TIERRA NUEBA 1 OK DEJANDO MARKA

SWK SONE ( e-mail: SWKZONE@HOTMAIL.COM )
Lunes 02.08.2010 / 11:18
SWK.MELCHOR BARREAL EL SONE.STOK.SEOL.SECK.BLIND.DEFECK.FLAME.BRONX.TOXIK.RIMA.FORZE.DARE.DOSR.FESK.REKUR.MAKIKO.RELAX.SEINER.DIKAE...REST IN PEACE WAKI1.WIKED OLD WEST.VOLTIO SOUTH WEST KIILAS DONT FUCK MY STYLE ONERSOTES.........................

CROMO ( e-mail: CROMO )
Lunes 02.08.2010 / 06:27
IN MEMORI OF EL FOWE TARTA DESCANSEN EN PAZ 38 HPS# LA BAMBA 87 EL CROMOTE SEUSONE

FACER ( e-mail: )
Domingo 01.08.2010 / 18:47
AKI BY FACER ARTE CALLEJERO ILEGAL CREW AKABANDO LAS COLONIAS Y BAMOS POR MAS OK ACI CREW FACER * MIKRO * DEIM* RELEK*

( e-mail: )
Domingo 01.08.2010 / 18:44
Y CUANDO KIERAN ALGO DIGANCELO DE FRENTE PUTOS PARA K C AGA EL DESMADRE SI NO NI C BOLTIEN A BER PAR DE CULONES PINCHI BOLA DE NIÑAS SI ASI SON DE CULONES CON EL DE UNO TIENEN

( e-mail: )
Domingo 01.08.2010 / 18:37
COMO TIRAN ROYO LOS DOS WEYES K BARIO 7 K BARIO JARUDO AGAN ECHOS PUTOS PURAS PÀLABRITAS ESO ES DE NIÑAS WEYES SON REKULONES LOS DOS WEYES PICHIS BARRIOS LOMEROS BALEN PURA BER..

HeLio!pb7! ( e-mail: )
Domingo 01.08.2010 / 18:26
jaja les digo qomo nos MAMAN sigan levantando el barrio pinshis JAROSHOS! BARRIO SIETE QOSHA!

pb7! ( e-mail: )
Domingo 01.08.2010 / 13:06
SOOOMOOS PUUTOOS CULOS MUERTOOS DE HAMBRE Y NOS GUSTAN LOS BATOS DE JARUDO

pb7! ( e-mail: )
Domingo 01.08.2010 / 12:53
SOOOMOOOOSS UNOOSS OJOOS CULONNESSS.!!!

BARRIO JARUDO LOCOS ( e-mail: )
Domingo 01.08.2010 / 10:03
USTEDES KE PINCHE SIETEROS, PURAS MAMADAS DICEN, NETA KE NO MAMEN, CHINGA TU MADRE HELIO ESTAS BIEN CAGADO WEY, NETA E, NO SE A KE LE TIRAS MEKO, PA KE WACHE CUANDO CHINGADOS LE CAEN BOLA DE CULOS, PARA KE VERDAD SI NO LA CUAJAN, BOLA DE KULOS, NETA AKI NO SON NADA, BARRIO JARUDO LOCOS TE MATA CABRON. 255. LBP CREW LOS COCHAN

HeLio! pb7! ( e-mail: )
Sábado 31.07.2010 / 18:12
sigan mamandonos weiies :D BARRIO SIETE LOQOS!

Barrio7 ( e-mail: )
Sábado 31.07.2010 / 16:45
SOOMMOOOS UNOS PUTOS MARIKONES Y NOS GUSTA MAMAR LA VERGA TOODOO EL DIA Y MAS SI SON A LOS DEL JARUDOO EA SOMOS PUUTOOSSSSS Y NO VALEMOS MADREE OOK

ariel ( e-mail: carmenlavonita@hotmail.com )
Sábado 31.07.2010 / 15:07
hey canvienn por que hay personas a suss alrededores que los ha tratado de ayudarles haganlo canvien canvien por que estoy cercaaaaaa hijs mios hagan caso dejen las malas amistades lean alal bivlia leanla acerquesense a dios jehova dice ayuta que y te ayudare

jose ( e-mail: jose2123@hotmail.com )
Sábado 31.07.2010 / 15:03
hola juarensess que como estan canvien sus vidas por que dios esta cerca de ustedes y va a llegar su dia de juicio contra el canvien sus vidas haganlo por sus familias estoy muy cerca de ustedes haganlo busquen ayuda espiritual

KLEEEN BJL ( e-mail: )
Sábado 31.07.2010 / 12:00
NO POES TA BIEEEN .... JARUDO LOKOONES AI DE SIEMPREEE EEEL KLEEEN AKI CON MI COMPOTAA EL DREXXXX CHIDOTA MI BIEJO SE ME KUIDAAA YA SE LA SABE JARUDO LOKOOOOS ASTA EL OLLLO OK HOMS YY TODOS LOS K NOS HABLAN POR LA ESPALDA NO LAAAA ASEN NO TIENEN LOS HUEBOS DE DESIRNOLO EN FREEEEEN PINCHI MARIKASSS . .

FACER ( e-mail: )
Viernes 30.07.2010 / 18:19
BY FACER ACI CREW DEIM MICRO ARTE CALLEJERO ILEGAL

SHAGYSOTE ( e-mail: )
Viernes 30.07.2010 / 18:11
WORLD FIVE ONE TIERRA NEW 1 SHAGYONER WF1 KANGRI * SPUNKY * FOBYA * FOWEK * TACHO * SIMSON * GIL * PORIYO * PORO * CHIKANO * BOSTER *

SWK SONE ( e-mail: SWKZONEERICK )
Viernes 30.07.2010 / 15:47
un saludote pa los msf y los wf de parte del sone dela swk msr crew melchor barreal y pa todos los grafers de juaritoz city

SWK SONE ( e-mail: SWKZONEERICK )
Viernes 30.07.2010 / 15:43
cual pinche fama P... el sone de la swk msr crew melchor barreal te cocha puto...............

BJL KLEEN ( e-mail: )
Viernes 30.07.2010 / 11:36
HAHAHAHAHHAHAHA K LES KALLO EL SAKO JAJAJA NO POES NI PEDDDO AUSTED LE KALLO MULETA JAJA NO POES NI PEDO EL KLEN DE JARUDO YY GRACIAS POR DARNOS MAS FAMA JAJA KLEEEN BJL

SWK SONE ( e-mail: SWKZONEERICK )
Viernes 30.07.2010 / 10:53
PINCHES JARUDOS DE MIERDA COMO SIEMPRE CAGANDOLA PENDEJOS DE MIERDA..............

cnccruu!! ( e-mail: )
Viernes 30.07.2010 / 07:35
saludos a toda la bola de graffiteros de juaritos yeeeppaaa a esa gente q se la rifa por las alturas falta mas taggs i bombones x la cityy ai andamos CRIMINALCAPS.... CNC CREW FRESHK!JOWER-nert:P chido banda:)

BJL KLEENS ( e-mail: )
Viernes 30.07.2010 / 06:38
NO SE BE K NO LOS MAMAN JAJAJAAJAJA NO POES TA BIEEEN I BIEN RIKO JJAJA JARUDO LOKOOOTEEESSSS SE LOS COCHA ATODOS LOS ENTRADOS IJOS DE PERRRA I KIEN IJO K EL KLEN ESTABA MUERTO SUEÑAN JARUDO LOKOOOS EL KLEEEEN PUTTTTTTTTTTTTO I BIEEEEEN SABEN K SE LA RIFA CON LOS ENTRADOOOOOOSSS

SHAGY ( e-mail: )
Viernes 30.07.2010 / 04:57
ARRE PS AKI ESTA EL SHAGYMAN DE LOS WF1 DE TIERRA NUEBA OK AY DE RATO

SWK SONE ( e-mail: SWKZONEERICK )
Jueves 29.07.2010 / 19:13
SONE SWK MSR CREW.MELCHOR BARREAl saludote pa los msf al die.drase y atoda su gente cuando nos vayamos aventar esas lineas en la jilotepek tachamos alos pinches ks crew porke esos putos me ensimaron y tambien cuado vayan por el puenta del desnivel rumbo para yr al centro tuersan unas lineas que tacharon los pinches sc . fijense elos dos lados del puente asi estamos apuntados swk sone.bokal.defk chido................

SWK SONE ( e-mail: SWKZONEERICK )
Jueves 29.07.2010 / 18:59
UN SALUDO PA LOS MSF DE PARTE DEL SONE DE LA SWK.MSR CREW.MELCHOR BARREAL ..TAMBIEN QUERIA DESIRLE AL DIE.DRASE DE LOS MSF QUE CUANDO NOS AVENTAMOS UNAS LINEAS EN LA JILOTEPEK NO MAS DIGAN CUADO Y ENKE PARTE. A Y TAMBIEN FIJENSE QUE CUADO AGARREN LA RUTA 1A O 1B CUANDO VAYAN POR LA NIÑOS HEROES O LA COSTARICA O SINO PREGUNTENLE AL RUTERO CUALES SON ESAS CALLES Y TUERSAN MYS LINEAS TAMBIEN EN LA CALLE COSTARICA Y REBSAMEN PANAMA NOS JUNTAMOS ALCABO YO ESTOY CANTONEANDO PALA JILOTEPEK Y TAMBIEN PREGUNTELE AL RUTERO ONDE QEDAN ESAS CALLES ES LA COLONIA MELCHOR OCAMPO AY POR ESAS CALLES TORSERAN MYS LINEAS Y UNOS MURALES QUE TENGO POR AY CHIDO MYS MSF................................

sone swk ( e-mail: SWKZONEERICK )
Jueves 29.07.2010 / 18:42
SONE SWK SOUTH SIDE .MSR CREW MELCHOR BARREAL UN SALUDOTE PA TODOS LOS SWK DE JUAREZ Y TAMBIEN PA TODOS LOS CREWS..............

sone swk ( e-mail: swkzoneerick )
Jueves 29.07.2010 / 18:37
un saludo pA LOS ACI CREW DE PARTE DEL SONE SWK MSR CREW .MELCHOR BARREAL ABER CUANDO NOS AVENTAMOS UNAS PINTAS CHINGONAS NOMAS DIGAN EL LUGAR................

FACER ( e-mail: )
Jueves 29.07.2010 / 10:10
ACI CREW

( e-mail: )
Jueves 29.07.2010 / 07:06
RYP KLEEN DESKANZA ENPAZZZZ. JARUDO LOKOSS !!!

SWK SONE ( e-mail: SWKZONEERICK@HOTMAIL .COM )
Miércoles 28.07.2010 / 15:16
REST IN PEACE WACKI1 .WICKED OLD WEST MSR SWK 2A MELCHOR BARREAL PUTOS..............................EL DEFECK .STOK.BOKAL.BLIND.SECK.SONE.SEOL.JORS.BRONX.RIMA.DARE.DOSR.FORZE.FESK.MAKIKO.TOXIK.

SONE SWK ( e-mail: SWKZONEERICK@HOTMAIL.COM )
Miércoles 28.07.2010 / 15:06
QUE TRANSA PUTOS EL SONE MSR SWK MELCHOR BARREAL LOS VAGOS1 SON BIEN CULONES IGUALES QUE LOS KMT Y VBT Y ESTO ES PA TODOS LOS BARRIOS ENTRADOS .Y TAMBIEN TENEMOS CON QUE PUTOS .YTAMBIEN TRAEMOS MEJOR LINEA QUE OTROS PUTOS DONDE QIERA ESTAMOS LEVANTADOS .SOUTH WEST KIILAS. MSR SWK 2A MELCHOR BARREAL.......................

sone swk ( e-mail: swk zoneerick@hotmail .com )
Miércoles 28.07.2010 / 14:58
QUE TRANSA PUTOS PURO SWK MELCHOR BARREAL PUTOS SOUTH WEST KIILOTAS PUTOS MSR CREW PUTOS LOS VAGOS UNO SON BIEN CULONES PINCHES CHABALAS IGUAL QUE LOS PICHE VBT YLOS KMT SONE ONERSOTEEE TRAEMOS MEJOR LINEA PUTOS ODE QIERA ESTAMOS LEVANTADOS.

( e-mail: )
Miércoles 28.07.2010 / 08:29
crooomoo seuuzz.. 87 rifan

the fiky ( e-mail: FiiQky )
Miércoles 28.07.2010 / 08:12
in memory of foowee.. tartaa dee loz 38 aqii ztamozz pa lo qe seaa homyss ooraa adeoozz 87 riifa ...

The FiQkyOner ( e-mail: FiiQky )
Miércoles 28.07.2010 / 08:09
qe tranzaa ppzzz aqii laa FiiQky, Qeezhhyy, miiss, CrooomoO ,Seeuuss,Foowee,Kooruu,87 mihoozz..9829

SHAGYONER ( e-mail: )
Martes 27.07.2010 / 10:23
ARRE WORLD FIVE ONE TIERRA NUEBA 1

KLEEN BJL ( e-mail: )
Lunes 26.07.2010 / 08:14
SIMON LO K TU KIERAS NO NOS CONOSES PINCHI MEKO GRACIAS POR HABLAR DE NOSOTROS OK HOMS EL KLEEEEEN TE COCHA ATY Y ATU JEFAAAAA PINCHI MEKO

CROMO ( e-mail: SEUS )
Lunes 26.07.2010 / 05:18
EN MEMORIA DE LOWE DE LOS 38 DESCANSE EN PAZ BAMBA 87 LOKOS

( e-mail: )
Domingo 25.07.2010 / 14:37
H... uen a su P... madre pinches jarudos o mejor jarochos jajajaja seguro son puros pinches tierrosos dan verguenza se deven de llamar jarochos mejor jajajaja P...

sckot ( e-mail: )
Domingo 25.07.2010 / 12:49
aki el sckot rifando komo siempre de los 725 crew ft m.e saludos a todos los pcl lokos del roma el sckot rrrrrrrrrrrriiiiiiiiiiiiiiifffffffffffffaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa

SHAGYONER ( e-mail: )
Sábado 24.07.2010 / 09:38
ARRE PS AKI ESTA EL SHAGYONER DE LOS WF1 DE TIERRA NEW OK YA SABEN DE DONDE JEJEJE Y 2 3 SALUDOS AL DREX Y SU JENTE BJL YA SABEN JJEJEJE

fose ( e-mail: elfose@gmail.com )
Viernes 23.07.2010 / 06:47
el fose*cope-snak*grove*kause*cabe*skyw*gogo*chorizo*jaico* y todos los que faltan *b/dukesotes30/ws. rip mocko*cebollas* dukes30 firman

fose ( e-mail: )
Viernes 23.07.2010 / 06:43
un saludo para todos los lokos de los dukes 30 ws el fose rifa

SHAGYMAN ( e-mail: )
Viernes 23.07.2010 / 05:07
JAJAJAJA K ROIO MY DREXTER COMO BE ALOS DEMAS GUEYES K TIRAN ROYO NA BALEN V... CANA TIRELOS ALION PARA K PELIAR CON NIÑAS JEJEJEJE ARRE AY ESTA UN SALUDO DEL SHAGYMAN KANA YA SABE DE DONDE WF1-BJL AL RATO ASEMOS UN DESMADRE WE

( e-mail: )
Jueves 22.07.2010 / 16:03
jajajajaja que risa dan los doblados lesva cargar la V... putos jajajaja tambien pa ustedes tenemos V... putos ahora si venimos con todo esta es nuestra sona los vamos a desapareser jajajajaaajculooooooooossss

KLEEN BJ L ( e-mail: )
Jueves 22.07.2010 / 13:51
ES TODO MI DREX YGUAL USTED JARUDO POR SIEMPRE LOKO II AI TAMOS ALA BERGA LOS PINCHIS ABLADORES DE MIERDA JARUDO Y ASTA AI EL KLEN HOMS ....

CROMO ( e-mail: BAMBA 87 )
Jueves 22.07.2010 / 05:13
EL CROMO FIKI QeChI PURO JENTE NORTEñOTA LA BAMBA 87 RIFA

drex ( e-mail: jarudotezz )
Miércoles 21.07.2010 / 12:20
jaja q rollo mi jente del barrio un saludo pa mi carnal klen.. y ai tamos mi yesk ...arres mi wf1 de tierra new ai tamos mi shagi conectandola are jarudollks bjlbp el drex see los cosha a esos pinshis entrados q estan bien cahados neta x q tiran tanto rollo si bien sabes como corre el agua con los d jarduo nosotros no estamos para mamaditas como ustedes neta q son pura perdida d tiempo bueno sigas de abladores culitos de M... jaja ... bario jarduo lokos y nomas

( e-mail: )
Miércoles 21.07.2010 / 04:52
BCL 87 NS OSKEYSOTA LA BAMBA BY SEUSONE LA CUESTA FOWE OWER SOEK KORU RIFAN

by fobya ( e-mail: )
Martes 20.07.2010 / 20:05
arre JENTE EL FOBYA DE LOS WF1 JEJEJEJE SOMOS BIEN ALEGRES

( e-mail: )
Martes 20.07.2010 / 12:11
JARUDO LOKOS EN LA KUESTA YA OTRO JARUDO EN LAS TORRESSS VIRRELLES OASIS ACIENDAS KUATRO EN TODOS LADO AI MAS AA I EN FINKA BONITA AY OTROA JARUDO POKO APOKO BAMOS ACIENDO MAS COMO ORIMGAS SOMOS JENTE

185 ( e-mail: )
Martes 20.07.2010 / 06:31
BARRIO CUESTA LOKOS OSK 87K LA BAMBA LOKOTOTEZ ARIBA JUARITOS

PRM ( e-mail: MEXICLES )
Martes 20.07.2010 / 06:26
UN SALUDO A TODOS LA JENTE PRM MEXICLES RIFA Y COMTROLA HECHO EN MEXICO

LA CUESTA ( e-mail: XXX )
Martes 20.07.2010 / 06:16
BARRIO LA BAMBA 87 PURO LADO NORTE SITIO LA CUESTA BY CROMO SEUS CRAF

( e-mail: )
Lunes 19.07.2010 / 13:18
JARUDO LOKOOOTES ALA BERGA EL KLEN NOMAS HABLAN Y TAN KULOS SON K NO PONEN SU APODO K DISKE LOS JARUDO BAMOS BERGUENSA SI ES LO K MAS SE ELLE AJRUDO LOKOOTES EL KLEEEEEEEN

""""""""""" ( e-mail: )
Lunes 19.07.2010 / 06:48
WORLD FIVE LOCOTOTES

yo ( e-mail: )
Domingo 18.07.2010 / 08:32
son culos todosss el duet de jarudo sholos

( e-mail: )
Sábado 17.07.2010 / 16:23
ESTO VA PARA EL MENTADO K LE DICEN EL 35 DE LA LINEA K YA LO TORCIERON VAS AVER PUTO TE VA CARGAR LA VERGA Y A ESE PINCHE MOCOSO K LE DICEN EL CHOLO K ES EL K PONE LAS AMENASAS EN LAS PAREDES YA LO TENEMOS SECTOREADO AL PUTO NOMAS AMARRENSE EEE YA SAVEN LOS ARTISTAS ASESINOS CRIMINALES O DOBLADOS COMO NOS CONOSCAN TAMOS RIFANDO EN JUARITOS PUTOS

( e-mail: )
Sábado 17.07.2010 / 16:19
K ROLO PUTOS OTRAVES YO YA SAVEN PURO DOBLE A CUIDENSE ESOS PINCHES MOCOSOS K ANDAN CAGANDO LA VERGA SE LES VA CAER EL CANTO Y VAN A ESTAR DE SHAVALAS ESOS PENDEJOS DE LOS AZTECAS OLA LINEA MEJOR AMARRENSE PERROS POR K NOS VAMOS IR RESIO TRAS DE TODOS NOMAS ACUERDENSE EEEEE

( e-mail: )
Sábado 17.07.2010 / 12:41
H... uen a su P... madre pinches jarudos pinche barrio cagado dan verguensa a ustds quien los conose solo su P... madre jajajaja pinches tierrosos dan verguensa que sean de juarez nos queman a todo juaritos cambien de nombre P... jarochos

( e-mail: )
Viernes 16.07.2010 / 21:20
BARRRRRRRRIO JARUDO LOOOOOOKOOOOOOOOTES HOMS EL KLEN

FACE ( e-mail: )
Viernes 16.07.2010 / 18:21
AFK NO ES BARRIO WEY ES PURO GRAFITI PENDEJO NAMAS PARA K SEPA CULERO

FACE ( e-mail: )
Viernes 16.07.2010 / 18:09
CHINGE A TODA SU MADRE ESE WEY K SE DICE CER EL PADRE DE TODOS PINCHE VATO MIERDA CULERO NO ERES PADRE DE NADIE WEY AFK CULERO Y TE BOY A RAYAR LAS NALGAS A TI PENDEJO YA SABES DE KIEN PUTO

El Padre de Todos ( e-mail: )
Viernes 16.07.2010 / 17:40
pinches grafiteros C... cholos pedorros! Rayense las nalgas mejor putos! Que andar rayando ahi pinches letras pendejas. Ponganse a escribir mejor el abecedario! Pinches mermas!

FAMA FAMOSO ( e-mail: )
Jueves 15.07.2010 / 10:00
EJAEJA PS OTRA BES LOS AFK DEJANDOO LO DE SIEMPRE JEJEJE BY FAMA YA SABEN K ROIO

WORLD FIVE WF1 ( e-mail: )
Jueves 15.07.2010 / 09:49
AARE PS NAMA PARA K WACHEN UN SALUDO AL SHAGY YA SABEN DE DONDE JUNTO CON EL SPUNKI Y DOS TRES DEL BARRIO YA SABEN WF1 DE TIERRA NUEBA

( e-mail: )
Jueves 15.07.2010 / 05:39
AI AI NOMAS JARUDO LOKOOOTES. RIFANDO DONDE SEA LBPKreeew. UN SALUDO AMI DREX .. AI TAMOS LOKOTES Y PARA EL YESK

SHAGY ( e-mail: )
Miércoles 14.07.2010 / 18:54
KKK ROIO PS AKI EL SHAGY DE LOS WF1 DE TIERRA NUEBA 1 LOS ENTRADOS YA SE LASABENN WORLD FIVE ONEE

FAMOSO ( e-mail: )
Miércoles 14.07.2010 / 18:45
EYEYEYEYE K ROIO PS AKI EL FAMA DEJANDO MARKA NAMAS PARA K WACHEN AFK CONKISTADO LAS FRONTERAS OKOKOK JEJEJEJEJE

( e-mail: )
Miércoles 14.07.2010 / 14:30
pinche bola de kulos x ke no se lo dicen en la cara x ke en puras letriyas ya no la mamen ya densen en la madre no valen V... putos

pokerONE ( e-mail: poker19972010@hotmail.com )
Miércoles 14.07.2010 / 10:17
barrio pelones uno rifa putos elo snokeroner y el pokeroner rifan putos toda la citi la colosio rifa

xxxxxxxxxxx ( e-mail: xxxxxxxxxxxxxxxxxx )
Miércoles 14.07.2010 / 08:16
PURO PRM RIFA

KLEEN LOKO BJL ( e-mail: )
Martes 13.07.2010 / 13:23
JAJAJAJJAJA KALMATE PINCHI KULO WE NETA K NO ERES NADIEN . PINCHI MOKOSO KULO EL KLEN TE COCHA WE KUANTAS BESES TE EECHO KORRER DIME YY ATODO SU BARRIO YY EECHEME EL WE K SEA .. I ESO K ESTOY MORRILLO ME PELAN LA BERGA TODO SU PINCHI BARRIO KaGADO DEL SIETE MEJOR NI HABLES HELLIO PORKE NETA NI LE SALES DE TU BARRIO .. WE NUNCA TE EEE GUAACHADO EN LA RIÑA WE MMM NO MAMES EL KLEN DE AJRUDO LOKOS . .. en su barrio COMO SI NADA EEE ENTRO ASTA APARA YY USTES LO K NUNCA BAN A PODRER ASER JAJJA.. SI SE METEN ASTA SE LEBANTAN TEMPRANITO PARA PLANIAR COMO METERSE A JARUDO JAJAJJA PINCHI MEKOS Y SIEMPRE CONTTROLAMOS SU BARRIO

HeliO! ( e-mail: PB7 )
Martes 13.07.2010 / 11:44
jajaja qomo ME MAMAAN weies neta iia sta esqriben qosas x mii jaja asi siganLe weies :D qomo saben qe siempre an sido de aguuota! jaja me la peeLan! Helio PB7!

jarudos ( e-mail: )
Martes 13.07.2010 / 11:01
arres arres simon tiren su rollo cagado .. tu k elio estas bien cagadot neta q das bergunsa neta tu q we acien shingas bas andar aciendo de awa si asta tu solo t das risa we jaj esmas sigas de ablador tu bien sabes q tu barrio es de awota siempre los traemos del C... en su propio barrio y no lo nieges we jaja jarudote lks bjlbprpsck se los coshan el dreex

bjl ( e-mail: )
Martes 13.07.2010 / 10:24
ahahaha somooss mui famosos los cangrii . TU ENVIDIAAA NOSS DA FAMAAA IAA BAMOS EN LAS ALTURAAAA. SIGAAN TIRANDOMIERDAAA QE NOVES QE NOSS ASEEN GRANDES. PFF.

helio PB7 ( e-mail: )
Martes 13.07.2010 / 10:16
KE ROYO PINCHE NARIZ DE CIRUELAA PELADAA , PINCHE PLOGUDOO ASKEROSOO PRIMERO LIMPIESEE LA CARA Y LUEGO KAGUE EL PALOO SI A TY TEDIGOO SPEK ESTAS BN CAGADO YDAS ASCO EN RIO GRANDE TE ISE DE AGUAA ME DAS LASTIMAA KARA DE TUNAA ROJAA ATTE.. HELLIO BARRIO SIETOTEE 727 RIFAA KULO

( e-mail: )
Lunes 12.07.2010 / 04:21
sstk surenos dela zaragoza rifando komo siempre

( e-mail: )
Domingo 11.07.2010 / 11:33
KE TRANZA GENTE LOKA, PUES AKI PARA K WACHES KE EL BARRIO JARUDO ES LA VERGA, SALUDOS A ESOS WEYES DEL LBP UNA KREW DEL JARUDO, USTEDES SABEN LOS KE RIFAN, saludos al pinche Gun y al Klen

oscar ( e-mail: )
Sábado 10.07.2010 / 09:19
que rollo a todos los cholos papasotes ps aka dejo mi mns para que me agregen : estoe guapo y mamado. arre un cholito guapo agrege pose_jabawockee@hotmail.com

SeEs ( e-mail: )
Sábado 10.07.2010 / 09:13
qe pedo rasa a quien le gusta el graffiti y el break dance agrege pd: no agregan nomas por mamar Eh! graffin_city@hotmail.com

trane ( e-mail: )
Viernes 09.07.2010 / 12:04
mi barrio es el k rifa bsp

FOSE ( e-mail: ELFOSE@GMAIL.COM )
Viernes 09.07.2010 / 06:53
EL FOSE DE LOS DUKESOTES 30 WS COCHA

FOSE ( e-mail: ELFOSE@GMAI´L.COM )
Viernes 09.07.2010 / 06:44
B DUKESOTES30 EL FOSE RIFA

PBS! ( e-mail: )
Jueves 08.07.2010 / 17:28
BARRIO'SIETE!

jenni y amigas ( e-mail: mera clase )
Jueves 08.07.2010 / 15:34
rip rapto de mera clase neta rapiavas bien chido ya no es lo mismo sinti ke empazz descanses de rato nos vemos rip raaptoo mera clasee rip adriann

ldye ( e-mail: bodyshop )
Miércoles 07.07.2010 / 04:21
apoyanos motoclub amigos cuando nos mires puedes pararnos para que te tomes unas fotos .puedes unirte teniendo tomo moto club amigos vamos por el 5 aniversario esta pendiente en nuestra pagina www.amigosmotoclub.com.mx....cd.juarez.esta interesante asi que si te gusta la adrenalina en dos ruedas unete y contactanos ,,,shopper´s,deportiva,mini´s,extravagantes,echisas,performance, acompananos proximamente en toda la ciudad apoyando la paz por juarez QUINTO ANIVERSARIO pitanos saludanos continuaremos hermitaños del asfalto AMIGOSCLUB BY´´VICTOR ORGULLO JUARENZE

PBS! ( e-mail: )
Martes 06.07.2010 / 11:45
BARRIO'SIETE!

( e-mail: )
Martes 06.07.2010 / 11:22
JARUDO LOKOS ASTA EL OYO HOMS VIVIMOS KADA DIA K NO SABEMOS CUANDO BORIREMOS PERO NUNCA BAJAMOS BANDERA LOKO ESO TENGALO GRABADO .. LBPKreeew APOKO NO MI JENTE BJL

( e-mail: )
Martes 06.07.2010 / 10:57
BLKS Y MC AI ANDAMOS EN JUAREZ NEW ASTA EL GRANJERO

SAL2 ( e-mail: SAL2.COM )
Lunes 05.07.2010 / 18:18
SALUDOS A LA GENTE DE ZOCORRO TX.USA...........A LA COLONIA HIDALGO ANTES LA COYOTERA SALUDOS PARA LA IGLESIA SAN FELIPE DE JESUS EN CD.JUAREZ.CHIH.COMO QUE NO A LOS MORES TRECE KM.14 PURA GENTE BUENA CON ARTE EN SU SANGRE PASA EL MENSAJE VAMOS A CAMBIAR ESTA TRISTEZA DE MI CIUDAD VAMOS A TRANSFORMARLA EN ALEGRIA VAMOS A AYUDANDO AL VECINO CONVIVIR CON NUESTRA FAMILIA....,,,,, HEY PERO NO LO DEJES PASAR ESTA OPPORTUNIDAD PASA EL MENSAJE QUEREMOS TRANQUILIDAD EN MICASA CD.JUAREZ SI TE GUSTA EL ARTE ELARTEDELGRAFF.MRS´C. MEXICAN RIGHT STYLE.C HORALE PONLE GANAS Y A SALIR ADELANTE NO TEME ACHICOPALES HAY MUCHA VIDA QUE SEGUIR MUCHAS COSAS BUENAS POR DESCUBRIR ESTA VIDA ES MUY LINDA ASI QUE APROVECHALA NO TE PONGAS CON QUE MI NOVIOA ME DEJO HAY CHUCHOA NO ME HABLA YA MEVOY AMORIR MISPAAPAS ME REGANARON YA NO LOS QUIERO YA ME VOY DE LA CASA NNNNNNN00000000000. MIREN TODO HAY QUE TOMARLO CON CALMA UN ENOJO CORAJE PASA PERO LA VIDA UNA UNA UNA UNA UNA UNA UNA UNA UNA UNA UNA UNA UNA UNA U

demas ( e-mail: demas@hotmail.com )
Lunes 05.07.2010 / 18:02
ECHENLEN GANAS A SU ESCUELA

demas ( e-mail: demas@hotmail.com )
Lunes 05.07.2010 / 17:59
que pues les comento que el gobierno nuevo nos dara la oportunidad de hacer arte pues los que gusten estan invitados a participar ONLY FOR ART.

snoof oonee ( e-mail: )
Lunes 05.07.2010 / 09:54
.eeL snoof oonE.!b.jaaruudoo lookoos riifaan

( e-mail: )
Lunes 05.07.2010 / 09:42
saludos atodos los de juaritos des de laredo ttexas sstk rifando

demas ( e-mail: demas@hotmail.com )
Lunes 05.07.2010 / 06:46
OUT FOR ACTION KING´S QUE ONDA LO RECUERDAN TRUCHAS PORTENSEN BIEN NO ENTORPEZKAN EL TRABAJO DE LAS AUTORIDADES DEJEN QUE SIGAN TRABAJANDO NO SE METAN EN LIOS DE PANDILLAS ESTAN VIENDO LA TEMPESTAD Y NO PIDEN PERDON AL DIOS PADRE TODO PODEROSO.NO TE PIDO QUE TE HAGAS UN MONAGUILLO NI QUE CORRAS AL TEMPLO A DARTE GOLPES DE PECHO SIMPLEMENTE PON UN GRANITO DE ARENA NO DESTRUYAS MAS MI CASA MI FRONTERA DEJA QUE SE MATE QIEN TENGA QUE MATARSE TU NO ARRIESGES TU VIDA VIVA EL ARTE ELARTEDELGRAFF saludos MRS´c OFA´c´

( e-mail: )
Domingo 04.07.2010 / 07:36
BARRRIO JARUDO LOKOS HOMS

( e-mail: )
Viernes 02.07.2010 / 18:40
JARUDO LOKOSSSS HOMS

( e-mail: )
Viernes 02.07.2010 / 06:39
el nox puso eso de abajo pff pinche caca tu solo no eres nada pinche presumido

( e-mail: )
Jueves 01.07.2010 / 12:16
JARUDO LOKOS I NOMAS NADAMAS .. DISEN K ESTAMOS LOKOS POES SI NO KRES KAIGALA AMI BARRIO SE LOS COCHA ATODO ARRE MIS JARUDO LOKOS .. SIEMPRE EN LA ZONA ROJA

( e-mail: )
Jueves 01.07.2010 / 07:58
VARRIOOO VEIINTII TREESS PRESENTEE PUTOSS NORTEÑOSS LOKOS EL TOÑOO 23......

( e-mail: )
Jueves 01.07.2010 / 07:54
saludoss pal varrio penkiss pero loss longoss puroo choloss piratass i H... en su madre los del 4 nunca la icieronn con nosotross pinchess culoss,nomass guachaban los cuetazozz i salian corriendo pa su pinche barriecillo cagadoo...SABEN QE RAZA LOS DEL BARRIO CUATROO SON BIEN CULOTESS NETE ASI QE NO LOS TOMEN EN CUENTA A ESOS WUEYESS POR KE ESO SI SON BIEN MAMADORESS LOS CULOSS...SE LOS DISEE UN VATO DE 35 AÑOSS KE TYRABA Y TYRA VARRIO P3NKISS...SALUDOSS RAZA .:P33NK11SSS:.

??? ( e-mail: swk )
Miércoles 30.06.2010 / 18:50
ala V... kn los de la obrera pura MONTERREY X3 PUTO SWKEROTES komo la ves

( e-mail: )
Miércoles 30.06.2010 / 11:39
arriba el el barrio. veinty tresss 23 controlandoo los ceross de la colonia felipe angeless... puro nort3ño loco aki en el barrio jodido peroo bien locotess y bien truchotass puro 23 homiess pa qe guachenn el colorrr.. atentamentee el TOÑO DEL VARRIO..VEINTY TREESS V23 SALUDOSS GENTEEE....!!!!

bjl ( e-mail: )
Miércoles 30.06.2010 / 09:37
A LA BRABA KE A LOS CANGRY NADIE LOS KIERE, NADAMAS KEMAN AL BARRIO PINCHES OJETES CULEROS PURO RATON. KON RAZON TODOS LOS DESAFANAN, LOS UNIKOS KE SE ACOPLAN KON USTEDES SON LOS TAPIAS A LA BRABA Y ESO XK SE MAMAN LOS 2.

???? ( e-mail: !!!!!! )
Martes 29.06.2010 / 12:45
en memoria del señor SERGIO VEGA "EL SHAKA" que fue asesinado el pasado domingo en la ciudad de obregon sonora.... mi mas sentidi pesame a la familia del señor y que descanse en paz

( e-mail: )
Martes 29.06.2010 / 09:07
AJAJA OYES TU PATO FEO K WE TE KRES LA GRAN BERGA OKE NETA DE BE DE ASER UN PENDEJE DE K DEBE DE ESTAR ENAMORADO DE NOSOTROS POR ESO DISE ESO ESE PINCHI MEKO SABES K MEJOR BETE A MTERTE LOS DEDOS Y DAME TU JEFA PARA K ME LA MAME WE PORKE PARA COCHARMELA NO WE PINCHI GORDA JAJAJA NETA EL JARUDO TE COCHA EL KLEN MAS PARA KUANDO KIERAS KALARTE BENTE WE

( e-mail: )
Lunes 28.06.2010 / 16:38
jejejeje TU KE PATO.... YO ATY TE PATO TU MADRE JEJEJEJEJEJEE...!!! MUI BERGASS SEGUN TU TU TAMBIENN ERESS YGUAL O MASS PENDEGO PORR METERTE A LEEER LO QE SE PONE EN ESTA PAGINA...I KADA KIEN ASE CON SU BIDA LO QE LE PLASCA ENTYENDESS IDIOTA.... SEGUN TU MUI MADUROO NO MAMESS OKUPATE DE TUSS COSASS PINCHEE TRABESTY IGNORANTEE Y SABESS KE METETE EL DEDO EN EL CULOO WEIII....

pato ( e-mail: )
Lunes 28.06.2010 / 14:54
lo qee me da un H... o de risa es qee siempre estan aqui los mismos weyes qee nunca salen de sus casas o ke no maaaameeeen jaja y nunca se dicen las cosas de frente malditos maricones jaja ni caminar agusto han de poder por qee diske se sienten importantes y segun ustedes muy hombresitos jaja no no ustedes si qee dan risa y luego simpre son los mismos pendejitos desde el 2007 el klen el skor el gatick los bjl y otros pendejitos jaja lo qe no es tener vida social enfermos ignorantes jaja qee los penetren por niñas si fueran muy H... ones estarian muertitos pero ps la compu los atonta

chino ( e-mail: jimmy_brian_16.@hotmail .com )
Lunes 28.06.2010 / 11:44
putos

( e-mail: )
Lunes 28.06.2010 / 08:57
puro barrio veinti tress norteñoss controlando toda la felipe angeless gentee trucha con el toño d la 23 awueboo .........!!!!!!

martha ( e-mail: )
Lunes 28.06.2010 / 06:15
No puedo decirte el coraje q siento, me ha dolido mucho lo q hiciste, eres lo peor q conoci en mi vida, y me vengare q no te quepa la menor duda, pronto borrare esa estupida sonrisita de tu cara.

( e-mail: )
Sábado 26.06.2010 / 04:48
sshingen asu madre ESTUPIDOS MEKOS!*

( e-mail: )
Sábado 26.06.2010 / 03:35
YO NO SOY EL DISA PERO ESTOY DEACUERDO LOS KANGRI SE CREEN MUY VERGAS NOMAS PORQUE SON LAS PUTAS DE LOS TAPIAS EN LA CANGRI AY PURA CHAVALA PURA BOLA DE CULOS QUE NO SE DAN UN TIRO DE A CHOLE NO YA SESIGNESEN PINCHES CANGRI YA SU MOMENTO YA PASO NADIE EN EL JARUDO LOS KIERE POR CAGADOS

LBPK ( e-mail: )
Viernes 25.06.2010 / 14:48
YA DEJESEN DE SU PINCHIA MADAS ESOS PINCHI ROLLO K PUTOS PARSEN NIÑOS CHIKITOS YA PUTOS NO LES DYGO WEYES POR ESO ESTAMOS TODOS DIBIDOS .. EN EL BARRIO PERO SEGUIMOS ACIENDO JARUDO LOKOS I SIEMPRE SEREMOS LA GRAN BERGA Y NUMERO WUAN .. EL KLEN SE LOS COCHA ATODOS LOS ENTRADOS.

´TARARARARARAAR ( e-mail: )
Jueves 24.06.2010 / 08:32
BSPLOCKO RIFANDO PUTOS

( e-mail: )
Miércoles 23.06.2010 / 15:22
nort sidee genteee ai tamosssss 23 lokossss norteñosss.........!!!!!!!!!!!!! el chato 23 veinti tress norte de la felipe angeless...saludoss pa todoss loss del varrio pendientesss... v23

( e-mail: )
Miércoles 23.06.2010 / 15:15
EL CHATO DEL VARRIO VEINTI TRESS GENTE AKI ESTAMOSS EN LA FELIPE ANGELESS PA LO KE GUSTENN ..... AKI SI ESTAMOSS LOCOSSS PUTOOSSS V23 NO0 SE LESS OLBIDEE GENTE SALUDOSS PA TODOSS LOSS CHOLOSS NORTEÑOTESSS... AWUEEVOO VEITI TRESS V23 NORT SIDE NORTEÑOSSS

( e-mail: )
Miércoles 23.06.2010 / 15:08
ke royo mi gente del barrio veiti tress de la colonia felipe angelesss....la 23 cocha chabalitoss ke no se less olbidee atte el chatoo del v23

( e-mail: )
Miércoles 23.06.2010 / 14:55
BARIOO ALTOO CONTROLA PINCHESS MOKOSOSSS CALENTURIENTOSSS COMO TYRANN ROYOO NETA,BARRIO ALTO TA CONTROLA PESELE AKIEN LE PESEE....!!!

bjl ( e-mail: )
Miércoles 23.06.2010 / 12:52
jajajaj esos welles de abjo q estan bien cagadotes jaja q mui mafiosos jaja no mamen ya tumbense ese rollo q unidos mafiosos jjajaaj ... la neta jarudo es mafia ustedes bien lo sabes nosotros no ablamos .. nosotros actuamos jarudo,maffia pa pa k guashe bjlokotes ..o k kieres q qede otro wei de ustedes tirado en su mismos barrio jajaja buno sigan tirand su rollo cagado d mafiosos jajajaa jarduo mafia protegido por los grandes y nomas

cangri ( e-mail: )
Miércoles 23.06.2010 / 06:23
SI DISA TUMBESE EL ROIO USTED ES EL JEDIONDO WE DISKE NARKO CHERO KAGADO WE TIRE SU ROIO SABE BIEN KE LOS KANGRI LO SKOCHANA TODOS EN EL JARUDO WE I SIGA TIRANDO SU ROIO WE PA PATIRLE SU MADRE OTRA VES WE SI NOS TIENS N SHNGI DE MIEDO WE TE CRES BIEN VERGAS POR TRAER TU PINCHI EXPEDITION TODA JEDIONDA WE NO0 MMSS WEEE PINCHI MUGRERO TIRAS UN SHINGGO DE ROLLO PERO E EL BARRIO ERES OTRA PERSONA NI SIKIERA NOS VOLTEAS A VER WE EL EVIL CUANTAS VECES NO TE ISO MIERDA WE TE ISO DE AGUA UN SHINGO DE VECES WE SI ERES BIEN VERGAS VAIA I PARECE AI EN LOS TAPAS WE PA DARLE EN SU MDRE WE PINCHI MUGROSO KULERO

buudaUNO ( e-mail: )
Martes 22.06.2010 / 18:50
buudaaUNO weed squuad creeww eLc

( e-mail: )
Martes 22.06.2010 / 16:59
que onda batos nomas quiero mandar un saludo alos del barrio de la once galeana y dales mi lamentable pesame adios soy el nyssy deciudad juarez

EL FLOW CIA CREW.. ( e-mail: )
Lunes 21.06.2010 / 12:53
VIVA EL GRAFF EN CD JUAREZ... UN SALUDO A TODOS LOS CREW DE JUARITOS ATTEE.. EL FLOW DE LA CIA CREW... 656 REPRECENTANDO ALA FRONTERA CD JUAREZ.. EL COLECTIVO REZIZTE... ARTE URBANO...

EL FLOW CIA CREW.. ( e-mail: )
Lunes 21.06.2010 / 12:47
QUE TRANSA CANAS EEEEE OIGAN DE PURA CASUALIDAD NO SE SABEN LA PAGINA DE LOS GRAFFITIS DE LOS OFA ESQ NO DOI CON ESA PAJINA AI SI SABEN AGANLO SABER SIMON SALUDOS AL RUFFO DE PARTE DEL FLOW DE LA CIA CREW...

( e-mail: )
Lunes 21.06.2010 / 07:50
sstk sur rifa

demas ( e-mail: demas@hotmail.com )
Domingo 20.06.2010 / 22:09
tengo crias baras de american pyttbulls atras del motel del rey pregunten por el de los pitbulls blancos

GRAFFTY ( e-mail: MRS@R13 )
Domingo 20.06.2010 / 22:05
QUE ONDA SEARCH COMO ESTAS TENGO APROX CASI 10 ANOS QUE NO TE VEO QUE HAS HECO HABER CUANDO LE CAEMOS AL DISCKJOCKEY PARA AVENTARNOS UN DANCE DERREPENTE C CONECTO LA GENTE BONITA DE LOMAS DE SAN JOSE SALUDOS ACA ANDO VIVIENDO POR ATRAS DEL CHAPARRAL DE VALLE A 2CUADRAS DE DONDE VIVIA AKI PREGUNTA POR QUE ONDA CON EL FAT TODA VIA TIENE LOS AMERICAN PYTTBULLS BANCOS CHIN...S

demas@hotmail.com ( e-mail: demas@hotmail.com )
Domingo 20.06.2010 / 21:57
fijate entre por casualidad andaba buscando otra informacion y que me topo con tigo que onda . MEXICAN RIGHT STYLE. lo recuerdas hace algunos anos lo hicimos en pomona y los angeles calif.cuando llegamos a el paso.tx. eramos familia de OFA. ONLY FOR ART.que coinsidencia mores trece del fraccionamiento lomas de san JOSE que tiempos haber si un dia paso por la casa de tus papis para saludarte ya tengo mi familia y me daria gusto que la conocieras te veo o nos escribimos..MRS'c'

SERCH FIRST ( e-mail: MRS/13 )
Domingo 20.06.2010 / 21:47
SALUDOS!!!! A TODOS SI SABEN QUIEN ES MI COMPA EL QUE ESCRIBE QUE TIREN KONTROL?Es un cuate que le gusta el arte del graffty,pero no lo expresa danando la barda del vecino ni la iglesia a este cuate le gustaba subirse a los anuncios de a50 60mts de altura que condo latas de krylon hace un buen diseno y baja y le toma fotos no se droga ni consume lcohol mucha gente loconoce de la cuesta hasta lomas de san jose pero no le gusta meterse en lios de ninas solamente cuando hay que..el estudio en al 15 ahora este compa le gusta dar buenos consejos.soy del barrio MORES 13 en san.JOSE. MR.SEARCH !1!

GRAFFTY ( e-mail: MRS@R13 )
Domingo 20.06.2010 / 21:35
UN CONSEJO BUENO SIN DANAR A ALGUIEN DESDE LA TEOFILO BORUNDA HASTA EL BLVD.ZARAGOSA,PANAMERIHUANA,BLVD.OSCAR FLORES SANCHEZ.SOMOS LOS MISMOS VAMOS A CUIDARNOS LAS ESPALDAS.NO HAY QUE MOLESTARNOS ENTRE SI.SIEMPRE EL RESPETO.recuerda que si yo cambio todo ami alrededor cambia. suerte echenle ganas a la escuela.KM.14 san.JOSE

demas ( e-mail: demas@hotmail.com )
Domingo 20.06.2010 / 21:27
mejor en vez de poner tantas mmmdas por que mejor no inventan algo para que esto cambie en cd.juarez atras de los vitrales km14san.JOSE.SIN OFENDER A NADIE....me gusta el arte nosotros ganamos el concurso de graff.frente al 128..

( e-mail: )
Domingo 20.06.2010 / 10:23
J A R U D O !*

( e-mail: )
Sábado 19.06.2010 / 15:48
B.LKS MC.K rifan

( e-mail: )
Sábado 19.06.2010 / 05:50
j a r u d o

( e-mail: )
Viernes 18.06.2010 / 11:05
YO! TAMBIEN SSHOLA(L)

( ( e-mail: )
Viernes 18.06.2010 / 11:04
ssssssssssssssholoTEAMO

( e-mail: )
Viernes 18.06.2010 / 11:01
un saludo para la MIIIISSSSSSS(K)

( e-mail: )
Jueves 17.06.2010 / 15:41
na vallase a la V... culero

( e-mail: )
Jueves 17.06.2010 / 11:09
desen a konocer kon eshos mekos! nopor INTERNET! aeesta el EJEMPLO: el JARUDO!+_

( e-mail: )
Miércoles 16.06.2010 / 14:35
na nadie rifa solamente el cindicato criminal putos

( e-mail: )
Miércoles 16.06.2010 / 13:12
los piinches b.lks riifan ii controlan lokotes mc. puuthos

( e-mail: )
Miércoles 16.06.2010 / 12:52
yoooo soi lalo la leonaa i rifoooooo

( e-mail: )
Miércoles 16.06.2010 / 07:35
los JARUDOLOKONES!

( e-mail: )
Miércoles 16.06.2010 / 07:32
los KSG LOKOTESS

( e-mail: )
Martes 15.06.2010 / 22:13
na ya se deverian ir a la V... todos pelienc a putasos no a palabras pinchi chavalas sindicato criminal rifa y controla putos north side locos 18 altavistota putos

( e-mail: )
Martes 15.06.2010 / 16:52
doblee a

( e-mail: )
Martes 15.06.2010 / 14:51
doble a doble a doble a doble a doble a doble a doble a doble a doble a doble a doble a doble a doble a doble a doble a doble a doble a doble a doble a doble a doble a doble a doble a doble a doble a doble a doble a doble a doble a doble a doble a doble a doble a doble a doble a doble a doble a doble a doble a doble a doble a doble a doble a doble a doble a doble a doble a doble a doble a doble a doble a doble a doble a doble a doble a doble a doble a doble a doble a doble a

thee dooblee a ( e-mail: )
Martes 15.06.2010 / 14:18
thee dooblee a lokos

( e-mail: )
Martes 15.06.2010 / 11:26
2ac

( e-mail: )
Martes 15.06.2010 / 10:27
dooobleeee aaaaaaaaaaaaaaaaaaaaaaa

thee doblee a ( e-mail: )
Martes 15.06.2010 / 09:55
Riip*soow*tiibu*ikeeer*chooree*hulk* doooblee a viiivee putoos

( e-mail: )
Martes 15.06.2010 / 09:47
doooblee a

skoR! JARUDO LOKOS! ( e-mail: )
Martes 15.06.2010 / 06:40
JAJJA LOS UNIDOS KE??? ESOS WEYES SE KREN MUY VERGAS KE MAFIA UNIDA KIENSABE KE MAAS!! I ANDAN!! KUETIANDO KN PISTOLAS DE PINTURA AKA KN BALITAS DE PINTURA JAJAJAJAJAJAJAJA PINCHES MOKOSOS GANENLE ALA VERGA AKUERDENSE KUANDO ENFIERRE AL BLESS JAJA YA MEJOR CHISPENLE IGUAL AL PINCHE PEKOSO DEL DIFOOO GANENLE ALA VERGA PUTOOOS! JARUDO LOKOS HACIENDAAS!!

thee dooblee a ( e-mail: )
Lunes 14.06.2010 / 17:59
loos dooblee a puutoos

( e-mail: )
Lunes 14.06.2010 / 11:01
somos puros north side locotes putos a la vrga los surenos pura chavala

skin ( e-mail: el skinsote )
Lunes 14.06.2010 / 10:52
que transa putos un saludo a todos los del barrio sindicato criminal rifa putos y que se ballan a la V... todos los entrados C... nosotros rifamos putos a la V... los de la quinta lomo pura pinchi chavala

( e-mail: )
Domingo 13.06.2010 / 22:31
QiubooLee qe pinchi tRannzaa aki laa pincHi MAFIA UNIDA KRIMINAL reportandoocee y aLa vergaa koon looz pinchiiz jarochooz dee mieRdaa qe no vaaLen veeRgaa

( e-mail: )
Domingo 13.06.2010 / 22:21
meebaaboosHaa teeAMOO comoo noo tee looo imaagiinaaz kuaantoo eRez el amoR de mi viidaa teeAMOO nunkaa lo olvideez

cecilia y juan k ( e-mail: cecilia_salinas40 )
Domingo 13.06.2010 / 14:42
no pzz aki estrenando pa ver k onda kiss a to2

carlos ( e-mail: )
Domingo 13.06.2010 / 11:34
sueno te amo me acuerdo de todo lo k emos paasado juntos eers lo mejoor tee amoo kiero esstar coon tijoo ya desiidete amor

( e-mail: )
Domingo 13.06.2010 / 06:12
pues lavd! nomas la P... rpscreww! le sale por el pinchi jarudo! unok otro dela lbp!

EL FLOW ( e-mail: )
Sábado 12.06.2010 / 22:22
RGN MUSIK PUTOS EL flo0w REPRESENTANDO EL NUEVO ESTILO D CALLE PUTOSSSSSS!!!!!!!!!!!!!!! EL FLOW LOS COCHA PINCHES CHAVALA!!!!!!! ASKC SKC ASK CUESTA LOKS 87 RIFANNNNNNN!!!!! POKOS PERO LOKOS CYENS RABIK NISEK DAEK NIGA SLIKER WEKSOTES DEL KILOMETRO 18 LA EMO LA CECY LA NANCY PURAMORRA D DESMADRE MIS RESPETOS PA STAS MORRILLAS AL 100 EL CHINO DE LOS TRISTES 21 POCHE OMAR BORReGO AL nino FALCONS 13 EL MUNEKA el MENNY EL LALO EL NAZY SALUDOTES PÜTOS EL FLOW CROSSSSSSSS FORKKKKKK SEAN DANNY PITUFO BERSO AL NAVE SONA LOS KOCHA AI EL EL CARA JAJAJA AMI KOMPA EL LEOS AL SKROM K ESTA ANEXADOS LOS PNDEJOS POR ROBAR MONOSDE PELUCHE JJAJAJa PALA MOTa DE LOS KFW DEL 18TE ASKC ASK SKC TRISTE 21 falcons 13 KFW WEKSOTES 18te

( e-mail: )
Sábado 12.06.2010 / 21:36
Y SIGEN LOS CANGRI MAMANDO JEJEJE ´PINCHES JEDIONDOS TEKATOS MEJOR SIGAN MAMANDOLE LA RIATA AL FOUR Y A TODOA LOS TAPIAS 13 JEJEJE LOS CANGRI SE CREEN LOS DUEÑOS DEL BARRIO PERO NI SIQUIERA LA ARMAN USTEDES PINCHE BOLAS DE FANTOCHES SE DEDICAN A MAMARLE LA VERGA ALOS TAPIAS 13 Y TODO ELBARRIO SABE QUE USTEDES SON UNA BOLA DE MAMA PITOS QUE NOMAS ANDAN BUSCANDO QUEN LES REGALA UNAS BIRRIA NOMAS LASTIMA DAN LOS CANGRI SE CREN MENIADOS AL IGUAL QUE LOS TAPIAS JEJEJE MAS FANTOCHES SON USTEDES PINCHE BOLA DE CULOS QUE NOMAS LASTIMA DAN Y PREGUNTELENLE AL DIENTE QUE OMAS NADA MAMANDO RIATA POR DONDE SEA PINCHE BATO CULO PERO PARA QUE LE SIGO SI BIEN SABEN QUE TODOS LOS CANGRI SON LAS PU...TAS DE LOS TAPIAS ASI QUE YA DEJENSE DE MAMADAS PINCHES JEDIONDOS Y MEJOR SIGAN MENDIGANDO ROPA QUE NI PARA ESO TIENEN Y LE DISEN A LOS DEL 7 LOMEROS MAS LOMEROS SON USTEDES QUE LA PINCHE ROPA QUE USAN NISIQUIERA ES DE USTEDES PINCHES MUERTOS DE HAMBRE CULEROS

( e-mail: )
Sábado 12.06.2010 / 10:35
fuck the facking jarudos hahahaha fuckings pussys im the @cme one mex side kings fuckers forever and 4 life the @cme 4 ever msk galeana

EL FLOW ( e-mail: )
Sábado 12.06.2010 / 10:30
EL FLOW DE LOS SKC ASK ASKC TRISTE 21 FALCONS 13 WEK 18 KFW

( e-mail: )
Sábado 12.06.2010 / 10:24
unidotez 14 hijoz de su P... madre pinchiz jarochaaz komo tiran kaka neta weyez dan verguenzaa pinchi boLaa de jarochaz mejor pongance acer aLgo x la patRiaa weyez netaa noz peLan la veRgaa weYeez jaja Kulonez son tan kuLoz qe ni entRan a nueztRo baaRRioo x saben biien qee si entRan loz vamoz adeztrozar a cuetazoz Pinchi bola de maRikonez MAFIA UNIDA KRIMINAL 656 ASESINOS PEBEU 14

( e-mail: mafiajarudo )
Viernes 11.06.2010 / 14:23
BARRIO JARUDOTE LOKOS.

sckot ( e-mail: )
Viernes 11.06.2010 / 14:12
aki el sckot para todos pclcrew q rifan en el roma y en la divi el sckot kocha

dwocker ( e-mail: )
Viernes 11.06.2010 / 10:12
ke rollo les mandan saludos a todos los graffiteros d parte d los mtvk

Gloria ( e-mail: )
Viernes 11.06.2010 / 05:37
Y bien, ya el tiempo esta pasando, tengo q segui soportandote, anoche tuve q ceder y fue asqueroso, no sabes q asco me das ya, parece mentira e un dia te ame mas q a nada en el mundo...le doy gracias a dios por ya no sentir nada por ti...eres de lo peor...

r3d ( e-mail: )
Jueves 10.06.2010 / 15:30
ke rollote aki reportandose el RED de los CLK 90'S PURO INFO TEK LOS KAKOTES............

( e-mail: )
Jueves 10.06.2010 / 11:26
jarudo LOKOS EN LA CUESTA PINCHIS MARIKAS PARA LO K GUSTEN ok .....

( e-mail: )
Miércoles 09.06.2010 / 20:10
EL SU3ÑO ES CULO A LA ORA DE LOS PUTASOOSS SALE CORRIENDO J3J3J3 PINCHESS SWK SON DE AGUA PINCHESS JOTOSS DE MIERDA NOMASS SIRBEN PA RAYARR... ATORENLE A LOSS PUTASOSS ABER SI ES SIERTO KE MUI BERGASS...!!!!

( e-mail: )
Miércoles 09.06.2010 / 20:04
barrioo 23 cocha....!!

( e-mail: )
Miércoles 09.06.2010 / 19:41
SALUDOSS PA LOSS HOMIESS DEL VARRIO 23 DE LA COLONIA FELIPE ANGELESS AKI SI ESTAMOSS BIEN LOKOTESS PA LO KE GUSSTEN CHABOSS,,23 RIFA PA KE LO SEPAN TODOSS (23)NORT SIDE LOKOSSS......AKI SI SOMOSS UN CHINGOO Y BIEENN LOKOOSS PURRO HOMIEE PIRATONN SI NO ME LA CREEN CAIGANLE AL BARRIO Y CALENCEE CHABALASS... SALUDOSS PAL TONYY DEL VARRIO MAS CHINGOON Y LOCO DE JUARITOSSS AWUEEBOO DE LA VEINTI TRESS NORTEÑOSS.. 23 CONTROLA....!

( e-mail: )
Miércoles 09.06.2010 / 19:34
PUROOO BARRIO VEINTI TREESS 23 NORTEÑOTESS AKA DE LA FELIPE ANGELESS,RIFA Y CONTROLA CHABALASS,AKI ESTAMOSS PA KE LE CAIGANNN PINCHESS ABLADORESS 23 SE LOS COCHA...!!!! PURO VARRIO 23

TAPIAS13 cangry ( e-mail: )
Lunes 07.06.2010 / 21:06
AMARRECE PINCHI DISA AVER KIENES SON LOS KANGRY PINCHI MOKOSO FANTOCHE WE KUENTELES KUANTAS VECES LE EMOS PUESTO SU SHINGA WE IA ENTIENDAA USTED I LOS PITEKOS NO LAPELAN PINCHI GORDO JEDIONDO AMARRECE NOMAS AVER SI ES SIERTO WE A USTED EN EL JARUDO NI LO ASEN EN KUENTA KULERONO TIRE SU ROIO EL DISA ESTA BIEN KAGADOALA BRAVA ASTA LOS DE SU BARRIO LE PEGAN ATE.BASIK TPS 13

( e-mail: )
Lunes 07.06.2010 / 18:38
CHINGUEN ASU MADRE TOD0OS PUTHOS AKI NI UN APUTHA PLAZA VALE VERGA JUAREZ YA NO VALE VERGA NADA VALE VERGA

( e-mail: )
Lunes 07.06.2010 / 18:32
II LOSPINXES JARUDOS K PIENSAN JAJA PINXE BARRIO MEKO

SISMO ( e-mail: )
Lunes 07.06.2010 / 18:24
PA ES0OS QE DICEN SER AZTEKAS JAJA DESEGUR0O NI ENCUENTAN LOS TOMAN PERO AI ANDAN ABRIIENDO EL OSIKOTE DE PUTA QE TIENENHAHA NETHA PINXES MOKOSOS DE SEC.. NO SABEN N AKE LE TIREN MEJOR PONHGANSE A ALIMPIARSE BN EL KULO K DESEGURO NI EESO SABENN AMI M PELAN LA VERGA ESOS ABLADORES ASI KOMO ABLAN DEVOLADA SIERRAN EL OSIIKO KUANDO TIENES E ENFRENTE ATU KONTRARIO KOMO SIEMPREE PA' MI K ESOS K AKI ANDAN I DICEN SER MUI AZTEKAS AN DE SER DE ESOS K LKOS MANDAN AKOMPRAR LOZ CIGARRILLOS K NA MAS PA ESO CIRVEN I OTRA KOSA AM SI DIICEN SER DE AKI DE JUAREZ NO SE DEJEN KITAR LA PUTHA PLAZA YA VEN KOMO ES PURA BLA BLA KN USTEDES EN VDD SEPAN AK L ATINAN P0OR QE SI NO LOS VA AKARGAR LA VERGA HAHA POR OSIKONES HIJOS DE L AVERGA JAJAJ NETHA LEPES INJENUOS KULONES DE MIERDA HAHA

elpinchecobra ( e-mail: )
Domingo 06.06.2010 / 10:59
que tranza putos saken un toque el `pinche cobra de los greenside cocha putos splch*

STOP ( e-mail: )
Domingo 06.06.2010 / 10:56
EL Stooop viejo bjl jarudo loko el cobra yel mago y la pipol arre jarudo loko cocha

MR.DRECK.COCHON .PARA KE RESPE ( e-mail: BYG TRISTE.13 )
Sábado 05.06.2010 / 15:35
AZTECAS DE LA COL.INDEPENDENCIA #2COCHAMOS JAJAJAJAJAJAJAAJAJ.V*B*T*13 SUREÑOS13

BJLOKOS ( e-mail: )
Viernes 04.06.2010 / 10:35
jarudo LOKOS HIJOS DE PERRA nomas hablan y hablan aki estamos EN LA KUESTA LOS JARUDO LBPKREEW PARA LO K GUSTEN OK HOMS..

Taylem ( e-mail: taylem_80@hotmail.com )
Jueves 03.06.2010 / 15:06
DaaiiLy uNiiKoTaa miiJJas

( e-mail: )
Jueves 03.06.2010 / 12:59
jaja pos chido solo qiero desir qee thee amo0 mucho0 karin y syy piensas qee soyy perla pues te ekivokas mucho0 soyy tu novia denizz posdata thee amo0 muxooo no lo olvidezz

( e-mail: )
Jueves 03.06.2010 / 12:54
mv,mv,c,,

( e-mail: )
Miércoles 02.06.2010 / 12:45
" sofeker "

( e-mail: )
Miércoles 02.06.2010 / 12:38
sofeker and lamyoner

( e-mail: )
Miércoles 02.06.2010 / 11:05
TU K KIERES AXER K KIERES K TE DYGA TODO LO K SE EN EL SIETE MIRA MIERDA EL FIONER YA NI ESTA AY SE FUE PARA EL PASO EL WOFE NI VIVE AY NI EL SEGO .. ESS WEYES YA N IAY NADIEN YTU AXER VIVES POR EL BCHAI ASTA ABAJO .. PARA K GUACHES K UN WE SU BARRIO NOS DYGA .. TODO AJAJAJA NO MAMES NETA JARUDO LOKOS CUANDO KIEREMOS LOS ASEMOS MIERDA CONTROLAMOS TODA LA PINCHI CUESTA PARA K VIEJOS OK J A R U D O T E S

the axerone 727 ( e-mail: axerone727@hotmail.com )
Miércoles 02.06.2010 / 10:27
ke rollo aki el axerone del barrio siete de la cuesta dejando un saludo a los vale V... de los jarudos ke el sabado nos pelaaron la V... aunke le andubieran mamando los huevos a los dandis hay hay bien chavalotas barrio jarudo dandis 30 jajajajaja no mamen weyes neta ke son de awua aunke se unan kon kien se unan nomas ke ustedes ya nos tienen asta la V... ya asata aburren ya nadie les hace caso pinchis mokosos de 12 anos no valen V... neta

sckot ( e-mail: )
Miércoles 02.06.2010 / 09:36
aki dejando saludos para los pclokos el esckot rifa 725crew kontrol y el ysto sigue graffitiando y al snopy kuidese karnal

( e-mail: )
Miércoles 02.06.2010 / 07:18
U.U k gacho RPSCREWW! JARUDOTE

( e-mail: )
Miércoles 02.06.2010 / 06:57
LOS CANGRI QUE ESOS WEYES NOMAS LE ESTAN MAMANDO LA RIATA ALOS TAPIAS SE CREEN LOS DUEÑOS DEL BARRIO JAJAJAJA BOLA DE PENDEJOS MAMA PITOS ASTA VERGUENZA LES DEVERIA DE DAR CULEROS YA SABEN QUIENES SOMOS PINCHES CHUPA VER..GAS LOS CANGRI LE MAMAN LA VER...GA A TODOS LOS TAPIAS

( e-mail: jarudo! )
Miércoles 02.06.2010 / 03:47
puro BLABLABLA! &nada de acccionn JAJA! pinnchimediokres nommas saben lebantar su barrio porestaa PAGINA! ono? jajajaaj! pinnchis estupidosss osikoness noosotros si estamos en kualkierr LADO enkualkier LUGAR! &noes mentiraa. & algunos iasaben. komosomos MARRANITOS! kaiganle al barrrio ABE5RSI ESVD KE LAKUAJAN!

world ( e-mail: )
Martes 01.06.2010 / 16:22
ke lastima me da ver en lo ke se comvirtio mi crew ask despues de catorse abriles el plan era de puro graffiti y no de una pandilla ya estoy grande y tengo hijos pero si pudiera regresar el tiempo no aria ask crew atte. world y el nerf

( e-mail: )
Martes 01.06.2010 / 12:07
KIEN CHINGADOSS TA DISIENDO KE LOS JARUDO SOMOS SUREÑOSS PENDEJOSS...YO EL DISSA SOI SUREÑO I KE...??? LEAA BIEN LO KE PUSE WEI NO MAME USTEDD...

( e-mail: )
Martes 01.06.2010 / 07:47
MIRA PENDEGO PRIMERO APRENDE A ESCRIBIR BIEN DE SEGURO ALLA EN LA SIERRA DONDE VIVES NO ESCUELA NI AGUA XRESO AN DESER UNA BOLO DE LOMEROS MONTA PERROS JAJAJAJAJAJAJAJAJA Y DESEGURO SELA MAMAS AL OTRO PENDEGO XR TODO SU PINCHI BARRIO CAGADO SON UNA BOLA DE CULOS ATT EL SUEÑOSTE 316 SWK PBO 3CE SOUTH SIDE LOCOTES

LA CANGRI ESKUELA ( e-mail: )
Martes 01.06.2010 / 07:42
KUALES PINCHIS SUREñOS NOSOTROS NO SOMOS SURENIOS NO MAME NOSOTROS SOMOS JARUDIO LOKOS I SE SHINGO LA CANGRI JARUDO LOKOS TAPIAS 13

( e-mail: )
Martes 01.06.2010 / 03:45
jajaja BETE LA BERGA EL DE ABAJO ASI ES MI DISA JARUDO LOKOS .. PUTOS NOS PELAN LA BERGA ASY DE SIMPLE . K KIERE ESE PEDEJO DE ABAJO NO SABE COMO CORRE EL MAARRANITO AKI . WE CUANDO BENGAS NI BAS A DIFURTA POKO DE ESTAR AKI EN JUAREZ PORKE EL JARUDO TE BA ASER K NO LA MAMES A TODOS .. PINCHI MARIKA DE MIERA EL KLEN TE COCHA AI TAMOS MI DISA

( e-mail: )
Lunes 31.05.2010 / 18:11
MIRA PINCHI DISSA NO ESTARE EN JUAREZ `PERO DERATO LE BOY A CAER Y ORASI BAS A CONOSER A ESTE MOCOSO K DESEGURO EL MOCOSO ERESTU K NI EL CULO SEADESEBER LIMPIAR JAJAJAJAJA Y ANDAS CAGANDO EL PALO PURO SOUTH SIDE LOCOTES SWK PBO 3CE DE X VIDA 316 Y ESTE ES MI CORREO EN MY SPACE MREGALADO07@YAHOO.COM

( e-mail: )
Lunes 31.05.2010 / 15:50
NO ESTES CAGANDO EL PALO PUTOO LEPE SEGUN TU MUI CHINGON PERO PS NI ESTAS EN JUAREZ,ERES DE AGUA SUEÑO ME LA PELASS PUTO EL DISSA X3 JARUDO LOCOSS SUREÑO 13 I EL SUREÑO SOI YO NOMASS EN MI BARRIO PERO CON MIGO TYENESS PA KE TE CAGESS DE MIEDO PINCHE MOKOSO ABLADORR,VALESS VERGA PUTO CHAKETEROO... I LOS SWK SON 5 TECATOSS LABACARROS ESE ES TU PINCHE BARRIO,PFF NO MAMES WEII EL DIA KE BENGAS A JUAREZZY BEAS LO KE KEDA DE TU BARRIO,JEJE BAS A BENIRR A PEDIR CHICHI AL JARUDO ACUERDATE DE LO KE TE DISE ESTE SUREÑO..I LA VERGUENZA ERES TU WEI KE NOMAS ABLAS POR ABLARR SIN SABER NI MADREE...I SABESS KE BETE A LA VERGA SUEÑO,JEJE,PINCHE APODO CAGADO ES DE NIÑO WEII NO MAMESS...JEJEJEJEJEJE....!!!!

MIGUEL ( e-mail: MIGUEL_ERO@HOTMAIL.COM )
Lunes 31.05.2010 / 11:38
YO AKI ME EXPRESO LA CIUDAD DONDE VIVO (REYNOSA) ETOY ASIEDO UN 3D EN EL CUADERNO CUADO ME BOY A RAYA SE ME SUBE LA ADRENALINA TENGO 23 AÑOS Y DE ESOS 23 QE TENGO 9 AÑOS GRAFITIANDO

( e-mail: )
Lunes 31.05.2010 / 06:25
BALLANSE ALA VERGA TODOS Y LAS GURUDAS K CUALES PINCHIS SUREÑOS EN LOS SUREÑOS NO AGARAMOS CULONES PURO BATO LOCOTE COMO EL SUEÑOKER DE LA SWK PBO 3CE SOUTH SIDE LOCOS Y PARA LAS GORUDAS NO DIGAN K SON SUREÑOS XK MEDA BERGUENSA K DIGAN ESO XK SON UNA BOLA DE CULONES ATTE SUEÑOKER

( e-mail: )
Viernes 28.05.2010 / 19:48
jarudo locoss de porr vida,.... aki es mi barrio, y aki esta mi gente,... nos la pelan todoss culeross puro b.j.l... SUR3ÑOS X3...JARUDO LOCOSSUR 13

( e-mail: )
Viernes 28.05.2010 / 12:21
jarudote lokos putos se los cocha a todos lbp creew atte el 4 letras

( e-mail: )
Jueves 27.05.2010 / 09:30
LA KAMADA JAJA SSSSSSSI HOMBRE .. JAJAJAJA

( e-mail: )
Miércoles 26.05.2010 / 17:49
los de sstk son culoss yo soi de los jarudo locoss,,y sy mui vergass ps kaiganle al barrio aki estamoss en lacuesta somos muchos y bien locoss puutos panochass..

sstk ( e-mail: )
Miércoles 26.05.2010 / 15:04
ya dejense de M... bola de P... sstk sureñotes se la rifa ak en zaragoza y x todo juarez pinches culotess

( e-mail: )
Martes 25.05.2010 / 13:15
eel doobllee a lookoos

( e-mail: )
Martes 25.05.2010 / 09:07
JARUDO.LOCOS..BAYANSE ALA VERGA TODOS LOS BARRIOSS..Y AGANLE COMO KIERAN,AKI NOMASS MI BARRIO Y MI GENTE JARUDOTE LOCOSS POR SIEMPRE PUTOSS,NOSOTROZ NO LE PEDIMOSS CHICHI A NADIE.. JARUDO SOMOSS UN CHINGO Y BIEN LOCOTESS PA KE LE CAIGAN Y SE CALEN...Y KE DESCANSE EN PAS EL PELON (SLIK) SE NOS FUE PERO AKI EN EL BARRIO ESTA BIEN PRESENTE...! PURO BARRIO.JARUDOO.LOKOSS LA CUESTA..

( e-mail: )
Martes 25.05.2010 / 08:59
LOS DEL JARUDO LOCOSS CONTROLAN LA CUESTA HOMIEZ..CUALESS ASK SI S0N PURO MOKOSO PANOCHUDO...AUNKE LES P3SE NINGUN PUTO BARRIO AKI EN TODA LA CUESTA NOS ASE NADA..RIFAMOSS TODO EL CACHO PUTOS NOS LA PELAN TODOSS..LOS MSF,ASK,SIETE,DANDIS 3O,U14,TODOSS SON DE AGUA CULOSS..PURO B.JARUDO.LOCOTESS B.J.L AWUEBO GENTE

FLOW RABIKER ( e-mail: )
Martes 25.05.2010 / 08:21
AKI REPORTANDOC DESD JARDINOTES DEL AEROPUERTOTE EL FLOW RABIK DAEK CIENS NISEK ASKC ASK SKC WEK 18ote

EL FLOW SKC CUESTA LOKOS 87 ( e-mail: )
Martes 25.05.2010 / 08:16
AKI REPORTANDOC EL FLOW DE LOS ASKC ASK SKC CUESTOTA LOKOS 87 EL MUñEKA DE LOS FALCONS 13 EL CHINO DE LOS TRISTE 21 RIFAN PUTOS DESDE EL CHUKO 915 ASTA LA 915 ORA miJOs EN MEMORIA DEL MALILLA Y KORONITA!!! FLOW, RABIK ASKC WEK 18

Sl3ck----------- ( e-mail: )
Martes 25.05.2010 / 08:05
K GENTE PURO CHUKO TOWN CENTRALOTE-----915-----

CASPER ( e-mail: )
Martes 25.05.2010 / 07:59
EL CASPERSOTE DEL CHUKO TOWN CENTRAL 915

meer ( e-mail: )
Lunes 24.05.2010 / 22:28
Que hay pasenle a ver. Graffiti wwwammyspace.com/primerseis pasenlee pasenle cdas union creeew

( e-mail: )
Sábado 22.05.2010 / 11:35
CUALES PINCHIS NORCACAS SON UNA BOLA DE CULOS AKI XRO SWK PBO 3CE SOUTH SIDE LOCOS ES SUEÑOKER

mr criminal ( e-mail: )
Viernes 21.05.2010 / 15:41
barrio norteños rifa. joma lo mejor a escuchar en cd juarez 14 656 915 controlando

joma ( e-mail: )
Viernes 21.05.2010 / 15:37
norteños rifa. el joma proximo rapero de cd juares esperen mir rimas. vato 14 656 lokotes

LA NUEVA CAMADA ( e-mail: )
Viernes 21.05.2010 / 08:56
MIREN PARA EMPESAR NO TIREN TANTO ROIO!!!! A NOSOTROS NOS VALE VERGA QUE LOS 2A QUE LOS AZTECAS NO NO YA ESTUBO BUENO COMO ANDAN ASIENDO MAMADAS YA ME ARTARON ESOS PINCHES LEPES DEL JARUDO NO VALEN VERGA MOCOSA EL f3

fL0w ( e-mail: )
Viernes 21.05.2010 / 08:49
PURO SKC CUEsTOta LOKOs 87 fALcons 13 TRistEsot 21 EL FLOW EL CHINo EL mUñeKa 915 asTa la 656 rIfaNDOla

EL fLo0w ( e-mail: )
Viernes 21.05.2010 / 08:43
K trANza KANAS EL FLOW DE LOS SKC DE LA KUESTOTA LOKOS 87 PURO ASKC WEK 18

( e-mail: )
Jueves 20.05.2010 / 13:02
para el azteca no mame we por jente nefasta como tu esta asi cd juarez k pinshe roio trampan trensandose por un territorio k ni es de ustedes maman putos

( e-mail: )
Jueves 20.05.2010 / 12:53
entonces para q estas alegando pinshe marrano de M... cual pinshe lomero wey no mame si todos los culos de los aztecas son unos pinshes tekatos de M... te guzte o no el doble a es la neta i yo no ando de mamador pork io le salto por mi barrio i la neta no por k anden meniados a mi esos pinshes roios no me entonan pero somos la neta el doble a puto

( e-mail: )
Jueves 20.05.2010 / 11:47
q transa jent ai tamos jarudolokotes ya se la saben ai estamos bien puestotes pa lo q gusten saludos a las klicas unidas jarudo lksotes lbjlbp coshandot drex

ken ( e-mail: )
Jueves 20.05.2010 / 11:13
ke rollo gente de cd juarez los saluda el ken de amc desde reynosa tam como esta juaritos alguien de aac que tenga correo pa cotorrear

( e-mail: )
Jueves 20.05.2010 / 05:29
ya no les boi a alegar pinches pokiteros..los AZTECAZ RIFAN...ANOSOTROSS NO NS GUSTA ANDARR LEBANTANDO POLVO COMO A USTEDESS PINCHESS FANFARRONESS CULOSS....BARRIO.AZTECA.. ARRIVA LA LINEA......

( e-mail: )
Miércoles 19.05.2010 / 16:15
jajja no cabe duda que son una vola de mugrosos lambepitos jajajaa nunka an vlido V... pinches titeres dises que son la mera V... jajaja alrato te tumban y qee?? sigues siendo la mera V... ? entiendan pinches titeres aqi en juares se la pelan...jaja doblados mugroosos, lomeros lambepitos jaja se creen muy vergas porqe matan y andan fajados y les pagan 5 milpesos o menos jajaja

( e-mail: )
Miércoles 19.05.2010 / 16:09
dooblee a lokos

2ac lks ( e-mail: )
Miércoles 19.05.2010 / 16:03
barretee ala veerga pinshee trensudoo de mieerda akii somoos la meera veerga eel dooblee a putoos

( e-mail: )
Miércoles 19.05.2010 / 14:24
aki en juarez rifan los AZTECAS...PURO CARTEL DE JUAREZ..PINCHESS 2A LAMBE HUEBOS...y saben ke chavalas el pez por su propia boca muere no le busken pinches pokiteros

( e-mail: )
Miércoles 19.05.2010 / 11:16
lanetaa pinnchiss estupidoss ni unodeloss doss laaarmma'jajaaj!ablaan porablarr.haha secreenmuii meniaditoss.'pendejoss nomas porkee jalan mota JAJAJAAJAJAJAJA.-oporke lleban una calaka de seguto JAJAJAJA! pinchis muertos de ambre ESTUPIDOS'

2ac ( e-mail: artistotas )
Martes 18.05.2010 / 14:18
pa el wei ese k dijop Qee loos doble a somos titeres mas titere P... es tu madre k la ponen komo kieren pinxe mokoso kulo sii kulero no asemos ni madres para k juarez este mejor pinxes alineados no valen V... kulero i hual k tu pinxe okoso meko atte doble aa

daniieel aac ( e-mail: )
Martes 18.05.2010 / 12:24
el doble a lokos putos

daniel aac lokos ( e-mail: )
Martes 18.05.2010 / 12:19
para el pendejoo k pusoo q los dobledos somos titeres no mame we de perdis ponga quien es pinshe mokoso C... no sabe ni q roio ablas por k tienes lengua C... i aunq no te guzte el doble a rifa aqui y en tu pinshe barrio pedorro P... de M...

elalexonek ( e-mail: aloi58@hotmail.com )
Martes 18.05.2010 / 09:36
keroyote lla llego el alexonek e pasamndo a degar una pinche rrallota aaaa gaga ora pues */*/*/*/*/el ALEX one*/*/*/*/

el clow ( e-mail: )
Martes 18.05.2010 / 06:30
los terrenotes trece rifan y controlan la heroes de la revolucion. somos pocos pero locos aqui estamos y no nos vamos terrenos trece estes donde estes aqui rifa el uno y el tres

( e-mail: )
Domingo 16.05.2010 / 20:10
yop se qien es el drack y es un lepe penddejo cree qe por tirar doblado nadie le ase nada pero es pinchhe mokoso mejor ni lo pelen aaaa ylos doblados alrato cain ya saven qe son una bola de mugrosos lambepitos , enves de meterle al toro por nuestra ciudad andan de chapetes por una miseria de dinero porqe ni eso les pagan bien y ya saven qe el gusto les dura poco, mientras los train de titeres penddejoss

( e-mail: mafiajarudo )
Sábado 15.05.2010 / 09:05
JARUDOTELOKOTES!IJOSDEPUTA

( e-mail: )
Sábado 15.05.2010 / 07:12
mex side kings forever and 4 life the gansters number one of the world mexicans 4 life by 3l @cm3 675

la vero doble a muni ( e-mail: )
Sábado 15.05.2010 / 07:11
la vero de los doble a lokos

( e-mail: )
Viernes 14.05.2010 / 12:14
el doble a putoos

( e-mail: )
Viernes 14.05.2010 / 12:05
barranse ala V... putos el doble a lokos jajajaj si les cala ni pedo

ken ( e-mail: karlosj83@hotmail.com )
Jueves 13.05.2010 / 20:19
alguien que me conteste que sea vergas en aac

ken ( e-mail: karlosj83@hotmail.com )
Jueves 13.05.2010 / 19:58
ESE DRACK YO SOY EL KEN QUIEN INVENTO EL DOBLE A CON EL SAIK OSEA EDER Y EL SNAKE QUE ME CUENTAS DEL EDER

( e-mail: mafiajaruo )
Jueves 13.05.2010 / 16:03
asies wei nomas abla el pinchi lepe pendejo.asta kese kede sin cabeza el meko!

( e-mail: mafiajarudo' )
Jueves 13.05.2010 / 15:58
lanetta weii te daree unkonsejoweii NOABRASEL OSIKO pinchipeerroo'ketepuuedes MIRIR entinddes wei ami nadda me kuestaa irr a buscartee atu barrioweii & lebantarte &mocharte la cabeza nomames noables PENDEJO. okierss bersufrir ATUMAMA! P... aggarre laonnda'pinnchi LOMEROTONTO'

( e-mail: )
Jueves 13.05.2010 / 15:39
mira pendego TU TE COGES A MI JEFA Y YO ME COCHO ALA PUTA DE TU PINCHI MADRE K TE PARIO K ADESER UNA PINCHI LOMERA Y GUAL K TU PINCHI BARRIO CAGADO ATT EL SUEÑOSTER SWKINGS SSL PBO 3CE

( e-mail: )
Jueves 13.05.2010 / 12:29
k weyes ami me bale berga sy estas aki o no we no bales berga pinchi mierdas jarudo lokos te kocha aty atu jefa idiota de M... .. la k ago diario k te KALO OKE .. PINCHIS MEKOS de los swkuloooooooootes. de M... JARUDO LOKOS OK HOMS

( e-mail: )
Jueves 13.05.2010 / 08:13
NOMAS XK NO ESTOI ALLA SINO YA UBIERAN BALIDO BERGA LAS LOMERAS DELAS JORUDAS NOMAS DEGEN K REGRESE Y BAN A CONOSER AL SUEÑOKER DEL SWK SOUTH SIDE LOCOS PBO 3CE APOLLANDO AMI GENTE

DRACK_113 LOKOS ( e-mail: )
Jueves 13.05.2010 / 01:58
ESTO VA PA TODOS LOS CULONES K DICEN K ME VAN A DESMADRAR Y LA VERGA A VER SI SE CREN BIEN VERGAS POR K NO PONEN EL APODO Y EL BARRIO O K TIENEN MIEDO A K LOS SAKE SOY EL DrAcK DE LOS DOBLE A Y NO SOY UN PINCHE MOKOSO Y SI KIEREN VER EL COLOR NO MAS DIGAN CUANDO Y AMARRENSE PINCHES CULONES DE MIERDA Y YA SAVEN PURA DOBLEASOTA HAY LE ENCARGO

( e-mail: )
Miércoles 12.05.2010 / 20:01
como tiran royo puttos .. yo soi del jarudo yyy queeee???? no tiren su royo y derato arre al topon vemos el color bola pinchiis lomeros..

yohana ( e-mail: princesa.virtuosa97@hotmaiul.com )
Miércoles 12.05.2010 / 12:27
Hola! barrio pesado un saludo de los primos k son la mera ley aca y los k no crean k se fijen les escribe la mas buena de las viegas la you!!! o mejor conocida como la pomo saludos especiales para la ligas, la chupones, el pikus, el burrro, para mi amorsote el macuin bueno a todos las banditas de aca los mas conocitos los biolines, los porros, los kakinos y muchos mas a y pa las nenas k H... en a su madre en serio bueno adios asta pronto. atte: LA POMOO!

SUENOKER ( e-mail: SUENOkerone )
Martes 11.05.2010 / 16:56
PINCHI PENDEGO SE ESCRIBE BALGAN BERGA PERO LOS UNICOS K BALEN BERGA SON ELBARRIO MAS NACO K PUEDE ABER LAS GORUDAS JAJAJAJAJAJAJAJAJAJAJAJAJAJAJAJAJAJAJAJAJAJAJAJAJAJAJAJAJAJAJAJAJAJAJAJAJAJAJAJAJAJAJAJAJAJAJAJAJA EL SUEÑOKER

( e-mail: )
Martes 11.05.2010 / 16:51
primero A PRENDE A ECRIBIR PINCHI LOMERO CUAL BALAGAN PINCHI PENDEGO SWK TE COCHA ATI Y ATU PINCHI BARRIO CAGADO NETA NO LESDA BERGUENSA TIRAR ESE BARRIO LA NETA K PUTA BERGUENSA ATT EL SUEÑOSTER DE LA SWK PBO 3CE SSL

ARVIZU ( e-mail: )
Martes 11.05.2010 / 15:24
BORRACHO d x vida puro PRM pa lo q gusten.tu diras?

( e-mail: )
Martes 11.05.2010 / 13:24
k H... ados kieren swk kiere k balaga berga kieren k akabemos con los tres weyes k kedan y dos no le sale jajaja no poes no se k ehingados kieren pinchis drogaditos de M... jarudo LOKOS TE KOCHA A UNO POR UNO

brian zoto aguilar ( e-mail: senckgreat@hotmail.com )
Martes 11.05.2010 / 13:23
k tranza k paza aki el senck de oriza veracruz de juarez se fue y asta aca ando soy del barrio delos vagos 1 y de la kmt ns locotes

ARVIZU ( e-mail: prmarvizuzarazua@hotmail.com )
Martes 11.05.2010 / 12:42
claro q existemos P... y somos muchos para q no le hagas al wey.puro MEXICLES PRM

alineados ( e-mail: )
Martes 11.05.2010 / 11:26
kalmate mexikles todavia existen jajajajjaa?

YSTO ( e-mail: PAN CON LECHE CREW )
Martes 11.05.2010 / 11:13
PPPPPPPPPCCCCCCCCCCCCLLLLLLLLLLL CREW KINGS

YSTO ( e-mail: PAN CON LECHE CREW )
Martes 11.05.2010 / 11:09
77777777 2222222 555555555 7 2 5 7 222222 55555555 CREW STYLE STREET 7 2 5 7 22222222 55555555

YSTO ( e-mail: PAN CON LECHE )
Martes 11.05.2010 / 10:44
725 UP FOREVER

ysto ( e-mail: PAN CON LECHE CREW )
Martes 11.05.2010 / 10:38
ÇÇÇÇÇÇ ÇÇÇÇÇÇ Ç Ç Ç Ç Ç YSTO Ç Ç Ç Ç ÇÇÇÇÇÇ Ç Ç FREESTYLE CREW Ç ÇÇÇÇÇÇÇ ÇÇÇÇÇÇÇ Ç

ysto ( e-mail: PAN CON LECHE CREW )
Martes 11.05.2010 / 10:33
ÇÇÇÇÇÇ ÇÇÇÇÇÇ Ç Ç Ç Ç Ç CREW ESTILO CALLEJERO Ç Ç Ç Ç ÇÇÇÇÇÇ Ç Ç Ç ÇÇÇÇÇÇÇ ÇÇÇÇÇÇÇ Ç

dick onerzote ( e-mail: )
Martes 11.05.2010 / 03:26
un zaludo para toda la adn de parte del dick adn 38 rifa y kontrola pcl kulos

ARVIZU ( e-mail: prmarvizuzarazua@hotmail.com )
Lunes 10.05.2010 / 18:26
Q ONDA CARNALES D LA PRM?DONDE ANDAN MIS BORRACHITOS?ANIMO RAZA REPORTENSE.PURO MEXICLES PRM

( e-mail: )
Lunes 10.05.2010 / 16:12
jarudo lokos lado bajo pitudos mmm de ke metete cabron!!

( e-mail: )
Lunes 10.05.2010 / 14:46
JARUDO LOKOTES.

( e-mail: )
Lunes 10.05.2010 / 13:59
DOBLE A PUTOS

fato ( e-mail: fatolive29@hotmail.com )
Lunes 10.05.2010 / 13:44
yo tengo mucho probema yo quiero mucho a yuda

( e-mail: )
Lunes 10.05.2010 / 13:17
k pinshe panochudos de los swk bien saben k los k no valen V... son ustedes peendejos cuantas veces no los isimos de water tenian q irle a pedir chichi alos bajos pinshes mamadorees ijos de la verga

NOoKSs ( e-mail: nokcer_08 )
Lunes 10.05.2010 / 06:17
saludos gente k le gusta el graff y el rap hoy paso x juarez spero y l atoren shidote lokos ay les dejo mitax de paso 1 saludotb para los 111 ke le estube caiendo ai d rato los huacho lokos... NOoKSs ¡gomez lokos! MPSCREW. SHIDO

( e-mail: )
Domingo 09.05.2010 / 18:24
son una bola de ppenndejos jajaj y los doblados no balen veerrgapinchhes muertos de ambre soy de un barrio muy famoso poes losculos delos unidos 7 m6 info y otros barrios nos conosen muy bien ya saven qe barrio selos cocha putos

EL KIRoNeKER ( e-mail: )
Domingo 09.05.2010 / 18:12
barrio jarudote lokos el kiro!! de la lbp crew saludos para toda mi gente ay tamos cana y a la V... los entrados ustedes ya saben a kienes les digo BJL barrio de barrios

( e-mail: JARUDO )
Domingo 09.05.2010 / 12:26
hahahahahhahahahhahahhaa en swk aipura SHOLA ASKEROSA.iukkk KE ASKO! hahahahahahhahaha-nomamenn.weii AGARRENLAONDA!pendejoss.somoss loss ke kontrolamoss JUAREZ.pinnchi PENDEJOS. pinnchis doble.tanto roioke tirann &sonn UNAMIERDA.hahahahahah pinnchis MEKOS.

( e-mail: )
Domingo 09.05.2010 / 11:58
barranse ala V... pinshees jarudos la neta no valen V... aqui los vergas somos los doble a putos

( e-mail: )
Domingo 09.05.2010 / 11:25
DESEGURO LAS PINCHIS BIEJAS AN DESER IGUALES DE PINCHIS ATERRADAS LOMERAS PIOGOSAS Y SIDOSAS JAJAJAJAJAJAJAJAJA PARA BIEJAS LAS DEL SOUTH SIDE LOCOS SWK EL SUEÑOKER

( e-mail: )
Domingo 09.05.2010 / 09:35
jaja bueguensa de k si es lo mas H... on k el barrio y MORRITAS NETA NOS SOBRASN ES OTRA KOSA K NO LAS KEREMOS PORKE YA PASARON KEREMOS NUEBO KADA DIA SY JARUDO ES LO MAS CHINGO K TODO JUAREZ .

( e-mail: JARUDO! )
Domingo 09.05.2010 / 09:11
hahahhahhahahhahhahhahahhah PORFAVOR! HAHAHAHHA lasmujeress noss PREFIEREN pendejo! hahahahahhahhahha.nomames.TERRROOSOS JAJAJAJAJA! KERISAENVD.´pinchiss pendejos.hahahahahaha.

( e-mail: )
Domingo 09.05.2010 / 04:11
msk swk aa osk sc am esos y muchos mas si son grandes no M... como barrios tierrosos que se sientan a la mera hora jajajaja el @cme

( e-mail: )
Domingo 09.05.2010 / 04:07
la neta si daria verguenza tirar el barrio jarudo ese pinche barrio que, que te pregunten las morras de donde del jarudo jajajaja no mames que pinche verguenza pinche barrio tierroso nadie lo conose cambien de nombre o mejor no tiren nimadre jajajaja

( e-mail: )
Sábado 08.05.2010 / 08:49
doble a doble a doble a doble a doble a doble a doble a doble a doble a doble a doble a doble a doble a doble a doble a doble a doble a doble a doble a doble a doble a doble a doble a doble a doble a doble a doble a doble a doble a doble a doble a doble a doble a doble a doble a doble a doble a doble a doble a doble a doble a doble a doble a doble a doble a doble a doble a doble a doble a doble a doble a doble a doble a doble a

SUENOKER ( e-mail: SUENOkerone )
Sábado 08.05.2010 / 06:32
DESEGURO LAS GORUDAS AN DESER PURO PINCHI LOMERO ATERADO CON SU ROPA DE CASI MARCA DE LAS SEGUNDAS JAJAJAJAJAJA PRIMERO BAÑENSE Y ECHENSE CREMA PINCHIS LOMEROS ATT SUEÑOKER SOUTH SIDE LOCOS

( e-mail: )
Sábado 08.05.2010 / 06:29
PUES SI NO MAS SEMETEN CON PURO BARRIESILLOS CAGADO METANSE CON LOS GRANDES PENDEGOS PURO SOUTH SIDE LOCOS SWK PBO 3CE SUEÑOKER

( e-mail: )
Sábado 08.05.2010 / 06:24
si no asemos nada preguntelen alos pks pbu14 joya 7 ajaja nomas preguntel kalas por juarez . jarudo lokos

doble aaaaaaa ( e-mail: )
Viernes 07.05.2010 / 16:08
jajajajjajaajaja doble a

( e-mail: )
Viernes 07.05.2010 / 16:01
doble a doble a doble a doble a doble a doble a doble a doble a doble a doble a doble a doble a doble a doble a doble a doble a doble a doble a doble a doble a doble a doble a doble a doble a doble a doble a doble a doble a doble a doble a doble a doble a doble a doble a doble a doble a doble a doble a doble a doble a doble a doble a doble a doble a doble a doble a doble a doble a doble a doble a doble a doble a doble a doble a

( e-mail: )
Viernes 07.05.2010 / 15:57
doble a lokos putricios maman con sus pinshes barrioos de mierda

( e-mail: )
Viernes 07.05.2010 / 15:40
ESE PINCHI BARRIO DE LOS JORODOS BALEN PA PURA BERGA ESE PINCHI NOMBRESITO K LE PUSIERON A ESE BARRIO DA BERGUENSA AMI MEDARIA PENA DESIR K SOY DE ESE PINCHI BARRIO CAGADO JAJAJAJAJA PURO SWK PB0 3CE SOUTH SIDE LOCOS

( e-mail: )
Viernes 07.05.2010 / 15:35
BALLANSE TODOS LOS BARRIOS ENTRADOS A CHINGAR A TODA SU PUTA MADRE K LOS PARIO NOMAS XK NO SEAN TOPADO CON LOS SWK DE LA OBRERA `PENDEGAS ATT EL SUEÑOKER

( e-mail: )
Viernes 07.05.2010 / 12:54
y aunq se acoplaran los bajos los solos i los estupidos de los swk nunka la armaron pendejos siempre pidiendo chichi jajaj amarrense un huevo culones cuantos no an caido de su barrio weies no mamen

( e-mail: )
Viernes 07.05.2010 / 12:49
barrete ala V... pinche bajo 21 de mierda apestan putos cuantas veces no los isismos de agua i ustedes encuetados nos pelann la V... ia se los emos demostrados dos k tres veces pendejos son una bola de culos jjjaaa aki estamos putos

( e-mail: )
Viernes 07.05.2010 / 10:58
PINCHIS JARUDOS YA ABURRIERON SIEMPRE AN TIRADO SU ROYO Y NUNKA AN ECHO NADA DAN HUEVA PINCHIS KUL0OS

bajo 21 ( e-mail: )
Viernes 07.05.2010 / 09:16
k nomas disen k los aztekas se le ba a kaer el canton jaja i no e bisto nads los 2aa aki los BAJO 21 se los cocha mierdas

( e-mail: )
Viernes 07.05.2010 / 09:08
jajaja no se me KULEEN PINCHI 7DE MIERDA KA JARUDO NO ES MAFIA NI NADA. ES UN BARRIO I NOMAS. I KLARO K AKI NO AI TEKATOS.. COMO LO K DIJIERON LO K AI K SOMOS PURA BERGA. I SI NOS NOS KRENN POES KIERO BEEEEEEEEER JARUDO LOKOS

nuZa 2ac ( e-mail: barreal )
Jueves 06.05.2010 / 20:36
esto va para toda la bola de culones delos barri0os que ni se ollen en cd juarez no mamen putos si ya saben que juarez ya no es de P... barrios pendej0ossi no la arman o k si ? que es eso juarez es de grupos criminales no es de M... ya aque el uniko barrio que la arman son los doble A si ya saben culones para Que se la jalan P... ya se la saben el doble *A* rifa i vive putos pa todos los alineados nos siguen pelando la vergotha asi nos gustha culoss son de water sigale cagando el palo i mas tumbaremos de su gente arTistotas asesinos cochando alos culosnes de aquii nos pelan la V... vdd aseptenlo 2ac l0ocos

( e-mail: oneQkonee's.Ds )
Jueves 06.05.2010 / 19:33
eiith ps aee ndoo n stha chengadera haha nmas pa mandarle un saludeiio a mes qmpas delaa BDR ee ora pss d ratoH..

B SIETE! ( e-mail: )
Jueves 06.05.2010 / 17:11
jaja devolada se ve q eso no lo puso el fioner jaja sta P... son jarudos neta ps si nosostros no andamos qon M... BARRIO SIETE LOQOS

doble a ( e-mail: )
Jueves 06.05.2010 / 13:27
y loos del 7 q de donde son e donde se juntan culones no mamen nadie los saka pinshes lomeros de seguro an de ser de san pancho pinshes lomeros de M... barranse ala V...

doble a ( e-mail: )
Jueves 06.05.2010 / 13:23
los del jarudo tienen q andar pidiendo chichi alos mugrosos de los solos xv maman putos les guzte o no les guzte nosotros no somos como todos ustedes nosotros somos una ranfla no un pinshe barrio pedorro

el doblee A ( e-mail: )
Jueves 06.05.2010 / 13:18
vaianse ala V... los del barrio 7 no mames donde queda ese pinshe barrio pedorro q nadie los conose jajaja i los del jarudo no se quedan atras puro pinshe tecato de M... no mamen weiees no lo pueden superar q somos mejores q ustedes vdd el doble a vive putos

r3d ( e-mail: )
Jueves 06.05.2010 / 09:15
[EL ROJO CLK ] -=KAKOS 90=-

( e-mail: JARUDO )
Jueves 06.05.2010 / 09:05
sii pinchi omosexsual.CAGADO-

( e-mail: el fioner B siete )
Miércoles 05.05.2010 / 20:57
ala V... los jarudo y mas los doblea aki la rifa los del barrio siete somos shingones los doblea son culotes shabalotas y llorones el drack es un panoshudo de M... me la pela el P... att fioner B7

r3d ( e-mail: )
Miércoles 05.05.2010 / 10:30
"THE RED CLK" "THE PASOS" :)KAKOS 90:)

( e-mail: )
Miércoles 05.05.2010 / 05:36
PINCHI MOKOSO ALIAS el drack ABER COMO LADRAS MUERDES IDIOTA. KIERO BER K LE SALGA CUANDO TE AGARREMOS OK pinchi niño idiota.

( e-mail: )
Miércoles 05.05.2010 / 05:06
wacha carnalnotiress tu roio wei K'teeboi a vajar de tua abion-donde andas trepado wei.nosoi un lepe komo TU.asdeser weei.kuandote tenga enmis manos wei terekordare lo ke pussiste en este portal bato.para kke sete kite lo osikon.

DRACK ONER COCHA ( e-mail: )
Martes 04.05.2010 / 17:40
K PINCHES JARUDOS LE KIEREN JUGAR AL VERGAS O K MEJOR VAJENLE DE HUEVOS K SI NO SE LOS VA CARGAR LA VERGA CULONES Y CHINGE TODA SU PERRA MADRE EL CULO K PUSO K LOS DOBLE A VALEN VERGA SI SE CRE BIEN VERGAS X K NO PÒNE EL APODITO O K LE TIEMBLA O ES PANOCHA COMO SU BARRIO DE MIERDA Y PA K VEA YO SOY EL DRACK DE LOS DOBLE A Y AMARRENSE TODOS LOS AZTECAS K SE LES VA CAER EL CANTON PINCHES MARRANOS DE MIERDA Y CULOS TODOS LOS K SON DE LA LINEA EL DOBLE A SE LOS COCHA PUTOS YA SAVEN Y VA PA RRIVA EL CHAPO Y LOS DOBLE A VAMOS ACAVAR A TODOS LOS AZTECAS

jarudo locos ( e-mail: )
Martes 04.05.2010 / 14:12
kuales pinchis doblea ni ke nada aki los unicos ke rifamos somos los pinchis jarudotes locotes clunoes apoco no y el ke diga ke no ke H... ue a toda su amdre puro pinchi jarudote locos y caiganle si keiren pinchis doble a ke a este pinchi barrio ustede sno entraran ni tomaran el control nunka putoss

( e-mail: )
Martes 04.05.2010 / 14:05
ala V... nos quieren desaparecer pero eso no se arma doblee a ai en todo juarez maman putos por uno q matan salen 4 ala V... el doblea rifa aqui i en sus pinshes barrios cagados

( e-mail: )
Martes 04.05.2010 / 14:01
del dooblee a puutoos

EL KIRoNeKER ( e-mail: )
Martes 04.05.2010 / 12:56
ke tranza gente aki nomas dejando marka putos el jarudo siempre controlara y rifara atte el kiro saludo pa todo el lado bajo..el kironeker de la lbp crew

jose ( e-mail: )
Martes 04.05.2010 / 12:16
ke royo pinchis nakos apoko se kren muy narkos dan risa bola de P... todos los P... kon su ropa chafa jaja kon su mexican eagle y su holister jaja bola de P... muertos de ambre

red ( e-mail: )
Martes 04.05.2010 / 05:15
KE TRANZA LOKOS AKI EL ''ROJO'' DE LOS KWS/CLK---KAKOS 90 INFO TEKK

( e-mail: )
Martes 04.05.2010 / 05:10
todos los de aki son unos sholos NAKOS askerosos. IUK.

( e-mail: )
Lunes 03.05.2010 / 12:14
AJJAA PINCHI KULO JAJA ESE WE DE ABAJO RETEBIEN K ME LA CHUPAS AY TE INFORMO KE YO NO LO ESCRBI . PERO GRACIAS POR ASERME MAS FAMOSOS IDIOTA EL KLENS

( e-mail: )
Lunes 03.05.2010 / 11:35
JAJAJAJAJAJ DEVOLADA SE GUACHA KE EL KE ESCRIBIO ESTO DE AKA ABAJO FUE EL KKULO DEL KLEN ES EL UNICO PENDEJO0TE KE ESCRIBE GENERACION CON J ... JAJAJ PINCHI VATO IDIOTA PRIMERO APRENDA A ESCRIBIR Y A LIMPIARSE EL CUL0 Y LUEGO YA ANDA DE TIRA ROLLO

jarudo lokos ( e-mail: )
Lunes 03.05.2010 / 08:00
NO POES EL JARUDO ES UNA BERGA Y SIEMPRE ES UNA BERGA. JENERACION POR JENERACION HOMS. TODABIA SIGUE AL BARRIO ESTO SEGUIRA PARA MAS . POR ME BARRIO SIENTO ORGULLO PORKE AL BARRIO ASTA LA MUERTE SOMOS DISTINGUILLO PORKE TANTO PINCHI CHOLO K SE LA RIFA POR EL BARRIO PUTOS.. ASI Y UN SALUDOOOTE AL KLEN K ESE SE LA RIFA A DARIO HOMS. Y AL SECK ESOS WEYES SIEMPRE SE LA BAN A RIFAR Y ME FALTO UNO ESPECIAL AL YESK . ESOS CABRONES NETA MIS RESPETOS. DESDE EL CHERRIS .. ESCRIBO ESTO PUTOS. EY HOMIS TRUCHA Y MI BARRIO K SIGA ASTA ARRIBA BARRIO JARUDO LOKOS

sukyllone ( e-mail: ns )
Domingo 02.05.2010 / 21:46
jajaja swkaka pinxe barrio todo muertothe en haciendas no keda ni una palomita pork por k los ddesapartaron no ammen mui vergas yson unos kulones de primeraese deve ser un barrio pa la V... no mms no tiren tanta M... kulones jajajswkakkaka

( e-mail: )
Domingo 02.05.2010 / 13:56
EL WEY K ESCRIBIO ESO TIENE RASON ANTES SIERAN BARRIOS AHORA SON PURO PINCHI NARCO DE MIERDA NOMAS LLEGARON A CAGAR EL PALO TODO ESTA CHIDO CUANDO ESTABAN LOS AZTECAS Y LOS MEXICLES ATT SUEÑOKER SWK PBO 3CE

( e-mail: )
Domingo 02.05.2010 / 10:26
no le ayo el pinshe caso de q los doblea a i loos d ee la linea esten peleando un pinshee teerritorio q no es de unoo de loos doos no mamen weeies pongansee a trabaajar mejoor

( e-mail: )
Domingo 02.05.2010 / 07:12
la neta antes si eran barrios los msk swk leones 13 19 velarde sc osk am info park y muchos mas pero ya ase acabo todo ,antes controlavan las pandillas en juarez todo buenos grafitis buenas lineas de todos pero ahora ya no todos esos pinches barrios tierrosos no valen V... se cren muy H... ones solo porque usan pistolitas de salva jajaja by @cme

EL KIRoNeKER ( e-mail: )
Sábado 01.05.2010 / 17:52
ke tranzaa!! barriio JARUDOTE LOKOS !! jarudo los cocha a todos los entrados.. el kironeker'' ee esperate tu keeee suenoker eso kee!! bn kagadote

drack ( e-mail: )
Sábado 01.05.2010 / 16:21
K TRANZA MI GENTE DE LOS DOBLE A YA SAVEN SEGIMOS CONTROLANDO A JUAREZ Y LOS AZTECAS NO VALEN VERGA SON PURO VATO PANOCHA K NO SAVE K TRANZA CON NOSOTROS LOS DOBLADOS PERO LE KIEREN SEGIR JUGANDO AL VERGAS Y POS LOS VAMOS A TENER K TUMBAR A TODOS LOS PERROS DE LA LINEA ME LA MAMAN PUTOS EL DRACK DE LOS DOBLE A

SUENOKER ( e-mail: )
Sábado 01.05.2010 / 12:59
SWKINGS REYES DEL LADO SUR EL SUEÑOKER DE LA OBRERA 3CE SOUTH SIDE LOCOS

( e-mail: )
Sábado 01.05.2010 / 08:52
l0s d0blad0s

( e-mail: )
Sábado 01.05.2010 / 08:20
EL KLEN DE JARUDO LOKOS ASI II NOMAS .. ME LA PELAN CONTROLANDO TODO EL PINCHI MAPÁ . OK .. PINCHIS MARIKAS AKI CON EL TOMATE .. PARA LO K GUSTEN JARUDO LOKOS .. ASTA EL OYOO

el kyfesiillo0 msh ( e-mail: crower gr )
Viernes 30.04.2010 / 17:49
qye transa putos el kyfes juanto con el cr0ower se los coje a todos los barrioss msh rifan puros atte el kyfesillo0 y el crower

( e-mail: )
Viernes 30.04.2010 / 14:07
do0blea l0k0s ala V... esta muertote aqui

( e-mail: )
Viernes 30.04.2010 / 13:56
puro0 113 lo0ko0s aac

( e-mail: )
Viernes 30.04.2010 / 13:52
puro doble a l0k0s put0s

( e-mail: )
Viernes 30.04.2010 / 13:26
SWK PBO 3CE SUEÑOSTER SWK X SIEMPRE LE DUELA A KIEN LE DUELA

( e-mail: )
Viernes 30.04.2010 / 13:17
puro swk south side locos pocos pero locos el SUEÑOKERONE

( e-mail: )
Viernes 30.04.2010 / 12:51
JAAARUDOoO.. LOKOS SE LOS COCHA. PUTOS ATTE KLEN

( e-mail: )
Viernes 30.04.2010 / 12:45
do0s a c l0k0s

( e-mail: )
Viernes 30.04.2010 / 12:33
south sidee

( e-mail: )
Viernes 30.04.2010 / 12:28
doblee a muunni

( e-mail: )
Viernes 30.04.2010 / 12:24
rip tibu,iker

( e-mail: )
Viernes 30.04.2010 / 12:20
saludando alos doble a

( e-mail: )
Viernes 30.04.2010 / 09:02
tu bete ALA BERGA PENDEGO XK TU LE MAMAS LA BERGA AL CHAPO PENDEGO PURO SWK EL SUEÑOKER

el norteño ( e-mail: elnorteño, )
Viernes 30.04.2010 / 08:33
ya dejense de P... que el unico amo y señor de juarez es el chapo aunque les duela bola de culos tacuaros ya porque traen una pinche resortera se creen hombresd putos

clow ( e-mail: )
Viernes 30.04.2010 / 05:56
somos pocos pero locos aqui estmos y no nos vamos terrenos 13 estes donde estes aqui rifan el uno y el tres

RED ( e-mail: )
Jueves 29.04.2010 / 16:07
KAKOS 90 KWS RED KAKOS 90 KWS RED KAKOS 90 KWS RED KAKOS 90 KWS RED KAKOS 90 KWS RED KAKOS 90 KWS RED KAKOS 90 KWS RED KAKOS 90 KWS RED KAKOS 90 KWS RED KAKOS 90 KWS RED KAKOS 90 KWS RED KAKOS 90 KWS RED KAKOS 90 KWS RED KAKOS 90 KWS RED KAKOS 90 KWS RED KAKOS 90 KWS RED KAKOS 90 KWS RED KAKOS 90 KWS RED KAKOS 90 KWS RED KAKOS 90 KWS RED KAKOS 90 KWS RED KAKOS 90 KWS RED KAKOS 90 KWS RED KAKOS 90 KWS RED KAKOS 90 KWS RED KAKOS 90 KWS RED KAKOS 90 KWS RED KAKOS 90 KWS RED KAKOS 90 KWS RED KAKOS 90 KWS RED KAKOS 90 KWS RED KAKOS 90 KWS RED KAKOS 90 KWS RED KAKOS 90 KWS RED KAKOS 90 KWS RED KAKOS 90 KWS RED KAKOS 90 KWS RED KAKOS 90 KWS RED KAKOS 90 KWS RED KAKOS 90 KWS RED KAKOS 90 KWS RED KAKOS 90 KWS RED KAKOS 90 KWS RED KAKOS 90 KWS RED KAKOS 90 KWS RED KAKOS 90 KWS RED KAKOS 90 KWS RED KAKOS 90 KWS RED KAKOS 90 KWS RED KAKOS 90 KWS RED KAKOS 90 KWS RED KAKOS 90 KWS RED KAKOS 90 KWS RED KAKOS 90 KWS RED KAKOS 90 KWS RED KAKOS 90 KWS RED KAKOS 90 KWS RED KAKOS 90 KWS

( e-mail: )
Jueves 29.04.2010 / 16:01
ala V... doble a vive putos

REDzazo ( e-mail: )
Jueves 29.04.2010 / 15:59
EL ROJO DE LOS KAKOS 90 DEL INFO TEK PURA KWS EL ROJO DE LOS KAKOS 90 DEL INFO TEK PURA KWS EL ROJO DE LOS KAKOS 90 DEL INFO TEK PURA KWS EL ROJO DE LOS KAKOS 90 DEL INFO TEK PURA KWS EL ROJO DE LOS KAKOS 90 DEL INFO TEK PURA KWS EL ROJO DE LOS KAKOS 90 DEL INFO TEK PURA KWS EL ROJO DE LOS KAKOS 90 DEL INFO TEK PURA KWS EL ROJO DE LOS KAKOS 90 DEL INFO TEK PURA KWS

( e-mail: )
Jueves 29.04.2010 / 15:43
doble a lo0ko0s putos

( e-mail: )
Jueves 29.04.2010 / 14:24
.....JARUDO.LOCOSS.SURX3 RIP P33LON........

( e-mail: BJL )
Jueves 29.04.2010 / 13:50
JARUDOTE LOKOS!!PURA CLIKA ASTA LA MUERTE !! BJL KABRONES

SUENOKER ( e-mail: SUENOkerone )
Jueves 29.04.2010 / 08:37
ESTODO MI CHIRINA REPRESENTANDO EL BARRIO PURO SWKINGS PBO 3CE LE BALE BERGA EL SUEÑOSTER

shiiriinass ( e-mail: )
Jueves 29.04.2010 / 08:31
aquii les va un mensajiito0 del shiriinas de lo0s SWK putiit0s t0da esa v0la de putiit0s q n0mas avlan vaiianse ala niickk put0s aquii se sientan c0n lo0s SWK PBO0 13 co0chaa puto0s del bariio0 delaa 0OBRERAA puto0s q avlan ii le piden chichii a mamii culo0ss

( e-mail: )
Jueves 29.04.2010 / 07:29
SWK SSL SWK SSL SWK SSL SWK SSL SWK SSWK SSL SWK SSL SWK SSL SWK SSL SWK SSL SWK SSL SWK SSLSWK SSL SWK SSL SWK SSL SWK SSL SWK SSL SWK SSL DE LA PBO12 PURO BARRIO OBRERA EL SUEÑOKERONE

SUENOKER ( e-mail: SUENOkerone )
Jueves 29.04.2010 / 07:24
ME BALE BERGA LOK DIGAN PENDEGOS AKI EL SUEÑOSRTERREPRESENTANDO MI BARRIO SWK DELA OBRERA PBO 13

JL ( e-mail: dover587@hotmail.com )
Jueves 29.04.2010 / 06:44
ke roio pinchees chavalaas, no la esteen kagando aki el dover de la sur cana, ai tamoos pinchee vatos kuloos... la S los represeenta ai tamos klen, saludoOs a toda la razaa del gun, chidoote gentee

myzzy ( e-mail: )
Miércoles 28.04.2010 / 22:41
swk no valeen V... no se k levanthan si no tienen genthe kul0os jajajaj pinxes panochithas

2ac barreal ( e-mail: )
Miércoles 28.04.2010 / 22:38
valeen para pura V... t0od0oz n0o saben Qe es barrio pendej0os sto va pa l0os putos s0ol0os 15 son una vola DE kul0os no pueden tienen k andar pidiendo chichitaa par de kul0ones i tambn l0os baj0o 21 son una bola demariko0nes ya sela saben el 2ac siempre rifara par de kul0ones l0os aac lo0k0oss controlando a juarith0os no valen V... putos

oxo ( e-mail: )
Miércoles 28.04.2010 / 14:47
rip oxo mp oxo y jenni te extrano un H... o mi chikito rip oxo 10-junio-2009 nunka te boy a olvidar in memoria of daniel b.mp 27 de la manuel valdez

sstk ( e-mail: )
Miércoles 28.04.2010 / 14:40
sstk de la zaragoza sige rifando putos digan lo ke digan sstk surenos sstk surenos saludos al gordo de la stk

JARUDO LOKOOOOTES ( e-mail: )
Miércoles 28.04.2010 / 12:57
JARUDO LOKO SE LO COCHA PINCHI CHABLAS DE LA swk K KIEREN CON ESO KIEREN KE AKABEMOS DE BOLADA CO NSU PINCHI BARRIO KAGADO .. KULEROS EL KLEN DE LOS COCHA PINCHI TEKATOS DEL CENTRO

( e-mail: )
Martes 27.04.2010 / 20:30
B.JARUDO.LOCOSS.... CONTROLAN LA CUESTA.......RIP.SLIK....... RIP GORDO..........DESCANSEN EN PAZ HOMIEES....

( e-mail: )
Martes 27.04.2010 / 20:20
valess berrga sueño me la pelass tu y tuss swk,sabess de echo tu perro barrio andaba mamando al JARUDO,tu no sabess ni madre weii tu ni sikiera estass en juarezz tu clikilla ya no existe,ya son puros P... drogadiktos,jeje el dissa te penetra y solito weii..JARUDOTE.LOKOTESS DE JUAREZZZ,EN LA CUESTA PA KE LE CAIGASS CULEERO TRABESSTY...

REGALADO ( e-mail: SUENOkerone )
Martes 27.04.2010 / 20:05
PURO SWKINGS REYES DEL LADO SUR EL SUEÑOMON ALA BERGA LOS OTROS BARRIOS

SUENOKER ( e-mail: SUENOkerone )
Martes 27.04.2010 / 20:02
MIRA PENDEGO EL UNICO MOCOSO ERES TU PENDEGO BETE MUCHO ALA BERGA TU Y TU PINCHI BARRIO CAGADO Y CUAL PINCHI SUREÑO PURO SWK DE LA OBRERA EL SUEÑOKER DELA BIEGA ESCUELA DE 2005 PENDEGO Y BAS Y CHINGAS A TODA TU PUTA MADRE DISA

( e-mail: )
Martes 27.04.2010 / 18:42
H... en su madre todos los swk son puro tecato muertos de amble,el sueñoker me la pela POR SYEMPLE eres C... weyy el dissa del JARUDO.LOKOS SUR X3 TE PENETRA PUTO MOKOSSO CAGA PALO..TU NO ERESS SUREÑO MOKOSO CAGOON..ERES DE AGUAA CHAVALA JARUDO DE POR VIDA

DRACK ONER ( e-mail: AAC_187@HOTMAIL.COM )
Martes 27.04.2010 / 16:57
K PEDO PINCHES CULOS LOS DE LA LINEA SIGEN CAGANDO EL PALO NO ENTIENDEN EDA SE LOS VA CARGAR LA VERGA PENDEJOS CUIDENSE A Y TAMBIEN ALOS BAJOS 21 Y LOS SOLOS 15 CUIDENSE LOS CUATES EL BEBE Y EL FOMI POR K VAMOS TRAS DE ELLOS NO MAS AMARRENSE CULONES EL DRACK DE LOS DOBLE A SE LOS COCHA PUTOS YA SE LA SAVEN

EL KIRoNeKER ( e-mail: )
Martes 27.04.2010 / 16:30
A la V... los swk,, puro Jarudote lokos los cocha culeros,, un saludo pa todo lado bajo!! el KIRONEKER pa lo k pidan putos

loko_el zorra_loko putos ( e-mail: 113_doblea_@hotmail.com )
Martes 27.04.2010 / 16:20
________doblea_________lopkos________ miren esto P... d los tal juarudos o d los linea todo lo q ponen es enbidia por q ustedes no púden kontrolar juarez ni la plaza miren hijos d su P... si no s quieren morrir mejor no pongan nada si miren si quieren konprobar q el doblea es chimgon ballan a rinkones de salbarkar don d estamos P... y tambien los putitos de los bajos 21 m la pelan nunka pudiron supuestamentre kon el turka,chino nunka pudieron y los solos tambien tiran micha miierda mieren P... los doblea akabaron kon su P... barrio nose agan P... nuka pudieron a los putitos d los cuates nunka m hicieron nada ni el P... del choche ni del sonrics y para los aztecas tambien tienen enbidia y mas los d la line__ son putos ]]]]]]] doblea lokos ]]]]]]]] el zorra]]]]]]

( e-mail: )
Martes 27.04.2010 / 12:48
JAJAJAJA NO SIMON K BALAGA BERGGA JARUDO LOKOS NUNA A MUERTO SIEMPRE ESTARA EN LA SIMA.. .. NO TIREN SU ROLLO PORKE LE DAMOS EN LA MADRE . JARUDO LOKOS EL KLEN SE LOC COCHA

SUENOKER ( e-mail: SUENOkerone )
Martes 27.04.2010 / 11:34
AISI AYTAMOS MI DISA PINCHIS PAR DE JOTOS CHINGEN A TODA SU PUTA PERRA MADRE A UNK SEN SUREÑOS AL SUEÑOKER LE BALE BERGA SWK REYES DEL LADO SUR

SUENOKER ( e-mail: SUENOkerone )
Martes 27.04.2010 / 11:21
MIRA PENDEGO BETE MUCHO ALA VERGA EL BARRIO MAS CHINGON ES SWK SUOTH SIDE LOCOS Y AKI EN WICHITA LE BANTANDO MI BARRIO SUREÑOTE ASTA LA MURETE SUEÑOKERONE

drexter ( e-mail: )
Martes 27.04.2010 / 11:11
jaja ai tamos mi jent del jarudo lokos cana un saludillo para las klicas unidas y ai tamos mi disa jarudo lks drexoner stop lbpenetrandot

( e-mail: )
Martes 27.04.2010 / 10:39
...EL DISSA DE JARUDO LOKOSS...

( e-mail: )
Martes 27.04.2010 / 10:30
bete ala V... pinche mokoso no sabes ni lo ke dises P... suñoker vales M... sureño 13 de los angeles california en san diego P... rifamoss sureño vida homieess...sur x3 tu i tu pinche clica de M... me la pelan swk,son putos lavacarross.

SUENOKER ( e-mail: SUENO )
Martes 27.04.2010 / 07:45
PURO SWK DE LA OBRERA Y AA DE DONDE

( e-mail: los doblea rifan )
Martes 27.04.2010 / 07:06
un saludoo para todos mis secuestradores del jarudo saven bien qe los doblea somos los shingones aqui nomas trabaja pura jente H... ona artistasasesinos adentro y fuera de cereso somos la V... parada

sstk ( e-mail: )
Martes 27.04.2010 / 05:19
sstk surenos sigen rifando putos pinches maricones ustedes puro bla bla bla

bjlstop ( e-mail: )
Lunes 26.04.2010 / 20:45
jarudote lokos bjl de aki aya ono jente el stoop

REGALADO ( e-mail: SUENOkerone )
Lunes 26.04.2010 / 18:43
ESE PENDEGO NO SABE PARA SER UN SUREÑO NO NESESITAMOS TATOO SOLA MENTE TENER HUEVOS PARA SALIRLE PENDEGO TELO DISE UN SUREÑO DELA BIEGA ESCUELA PURO SWKINGS REYES DEL LADO SUR EL SUEÑOKER

carlitos ( e-mail: SUENO )
Lunes 26.04.2010 / 18:39
NO MAS DEGEN K REGRESE A JUAREZ BOY A BOLBER A LEBANTAR EL BARRIO MAS CHINGO K A BIDOEN JUAREZ PUTOS PURO SWK DE LA OBRERA EL SUEÑOKER SELOS DISE PUTOS

( e-mail: )
Lunes 26.04.2010 / 17:38
ADN RIFANDO ATT. LOW UN SALUDO PARA TODA LA ADN

( e-mail: )
Lunes 26.04.2010 / 14:50
puro jarudo lokos SUR X3...esos pendejoss ke se disen ser sureños ke enseñen el pinche tatuaje.PINCHES

( e-mail: )
Lunes 26.04.2010 / 11:38
KIEN CHINGADOS DIJO ESO . MIRA EL MIEDO KE NO TIENE ES TAN CULO K NO PONE EL APODO ABER SY MUY BERGUITAS. WEY JARUDO LOKOS .

jorge ( e-mail: )
Lunes 26.04.2010 / 05:26
K ROLLO VAN PA RIVA LOS DOBLE A SEGIMOS CONTROLANDO A JUARITOS PUTOS NO SE LES OLVIDE K VAMOS A TROZAR A TODOS LOS AZTECAS DE MIERDA K SE CREN BIEN VERGAS Y POS AMARRENSE PINCHIS MARRANOS X K NOS VAMOS IR RECIO MIERDAS A Y CHINGEN A TODA SU PERRA MADRE CULOS TODOS LOS DE LA LINEA Y PURO 2AC LOKOS PUTOS

sstk ( e-mail: )
Domingo 25.04.2010 / 10:12
vayanse ala V... ustedes sstk los cocha putos sstk rifa pendejos

kironeker ( e-mail: )
Domingo 25.04.2010 / 09:53
ala V... todos, BARRIIIOOO JARUDOTE LOKOS LOS KOCHA

stooop ( e-mail: )
Domingo 25.04.2010 / 03:14
bjl1 desdeluego jarudo lokos el stop UNO1 pinches mamavichos ay con calidad JARUDO losdela uno jarudote aytamos jente

( e-mail: )
Sábado 24.04.2010 / 13:48
SIMON SALIERON EN LAS NOTICIAS CUANDO LES MATARON AL PINCHE MOKOSO PENDEJO DEL PELON JAJAJAJAJJA

SKOr!!jarudo haciuendas! ( e-mail: )
Sábado 24.04.2010 / 09:31
el skoR REPORTANDOSE I LEVANTANDO ATODO EL JARUDOOTE LOKOOS!! DE HACIENDAS POKOS PERO LOKOS DE AMADRES!!MENIADOTES ALINIADOTES!!!UN SALUDO PARA LOS KUESTOOTA!!PAL KLEN YESK SORK GUN SKIT SPOT!!I PARA TODA LA RAZA KE NOS APOYA DESDE LA KUESTA AKIE STAMOS KARNALITOOSS!!PELIANDOO ASTA LA MUERTE JUARITOSS!!!JARUDO POR TODOO JUAREZ!!!!

caca juarez ( e-mail: )
Sábado 24.04.2010 / 08:34
juarez es un vale caca

( e-mail: )
Viernes 23.04.2010 / 15:54
negro de los sstk no vales V... culero

( e-mail: )
Viernes 23.04.2010 / 14:53
jajaja sstk sur sela rifa con todo juarez y todo zaragoza sstk los cocha putos culotes sstk surenotes x siempre

( e-mail: )
Viernes 23.04.2010 / 13:59
JARUDO ESTA EN BOKA DE TOODOS.. K ISIERON AKELLO K SALIMOS EN LAS NOTICIAS KLARO .. SOMOS DE JUARITOS.. PURA RAZA MEXICANA.. PUTOS SOMOS LO K NO LA RIFAMOS A DARIO KON KASI MEDIO JUAREZ K ESTAMOS ENTRADOS.. NO AY PIRI JARUDO ASTA EL OYO

EL POKE ( e-mail: )
Viernes 23.04.2010 / 13:27
JAJAJA SI pinche kilo P... no sabe cochar jajaja arre mija yo si se, con migo si sentiras no como con ese P... precoz jajaja

( e-mail: )
Viernes 23.04.2010 / 09:22
BARRRIO JARUDO LOKOOOSSS.. ASTA EL PINCHI PUTO OYO

( e-mail: )
Viernes 23.04.2010 / 07:47
pinche guerejo ensenate a cochar x ke no siento nada con tu vergiya pinche kilo no vales V... pinche mocoso P... medas asco para jose trinidad melendres alias kilo atte mirna saludos atu novia ale ke no te kiere jajajaja sufre perro

( e-mail: )
Viernes 23.04.2010 / 07:13
sstk surenos x siempre arifado y se gira rifando pinches ojetess sstk sur

( e-mail: )
Viernes 23.04.2010 / 07:10
sstk surenotes

kuate ( e-mail: )
Jueves 22.04.2010 / 18:21
JARUDO,JARUDO,JARUDO,JARUDO,JARUDO,VJARUDO,JARUDO,JARUDO,JARUDO,JARUDO,JARUDO,JARUDO,JARUDO,JARUDO,JARUDO,JARUDO,JARUDO,JARUDO,JARUDO,JARUDO,JARUDO,JARUDO,JARUDO,JARUDO,JARUDO,JARUDO,JARUDO,JARUDO,JARUDO,JARUDO,JARUDO,JARUDO,JARUDO,JARUDO,JARUDO,JARUDO,JARUDO,JARUDO,JARUDO,JARUDO,JARUDO,JARUDO,JARUDO,JARUDO,JARUDO,JARUDO,JARUDO,JARUDO,JARUDO,JARUDO,JARUDO,JARUDO,JARUDO,JARUDO,JARUDO,JARUDO,JARUDO,JARUDO,JARUDO,JARUDO,JARUDO,JARUDO,JARUDO,JARUDO,JARUDO,JARUDO,JARUDO,JARUDO,VJARUDO,JARUDO,JARUDO,JARUDO,JARUDO,JARUDO,JARUDO,JARUDO,JARUDO,JARUDO,JARUDO,JARUDO,JARUDO,JARUDO,JARUDO,JARUDO,JARUDO,JARUDO,JARUDO,JARUDO,JARUDO,JARUDO,JARUDO,JARUDO,JARUDO,JARUDO,JARUDO,JARUDO,JARUDO,JARUDO,JARUDO,JARUDO,JARUDO,JARUDO,JARUDO,JARUDO,JARUDO,JARUDO,JARUDO,JARUDO,JARUDO,JARUDO,JARUDO,JARUDO,JARUDO,JARUDO,JARUDO,JARUDO,JARUDO,JARUDO,JARUDO,JARUDO,JARUDO,JARUDO,JARUDO,JARUDO,JARUDO,JARUDOJARUDO,JARUDO,JARUDO,JARUDO,JARUDO,VJARUDO,JARUDO,JARUDO,JARUDO,JARUDO,JARUDO,JARUDO,JARUDO,JARUDO,JARUDO,JARUDO,JARU

( e-mail: )
Jueves 22.04.2010 / 16:02
doble a l0k0s

( e-mail: )
Jueves 22.04.2010 / 15:57
doble a aqui rifando

( e-mail: )
Jueves 22.04.2010 / 15:20
kual pinchi jarputos valen V... rifando y controlando sstk surenotes cochan

kIRO ( e-mail: )
Jueves 22.04.2010 / 12:11
JAJA Es todo mi clen esi se culea, ya estan todos panikeados, o alomejor no an conseguido dinero para poder ir a las compu a rentarlas jaja pinches lomeros jediondos el kiro los cocha y los dedea putos barrio jarudote y lado bajo crew

( e-mail: )
Jueves 22.04.2010 / 10:23
K ROLLO JARUDOOO LOKOS.. PUTO BIEN LOS SABE KE EL JARUDO CONTROLA TODO EL MAPA PUTOS . ME LA PELAN .. BIEN LO DYICHO YY SE LOS DYGO LA PUTA CARA DE TY .. WEYES.. OK BJL JARUDO LOKOS EL KLEN ASY ES MI KIRO ... YY UN SALUDOTEEEE AL NOXX.. PUTOS .. YY KE CHINGUEN SU MADRE LAS LOMERITA..A DE AKEL LADO DE JARUDO .. RIFA YY CONTROLA LBPKREW

( e-mail: )
Jueves 22.04.2010 / 09:58
mp rifando y controlando rip oxo rip oxo jenni y oxo for ever oxo y jenni

juarez ( e-mail: )
Jueves 22.04.2010 / 09:54
para las cherrys de la m valdez jenni yobana lucia alejandra son las mas H... onas sstk

tuti ( e-mail: sstk** )
Jueves 22.04.2010 / 09:48
puro sstk surenotes rifan y controlan ak en zaragoa y en juaritoz

lalalala ( e-mail: )
Miércoles 21.04.2010 / 20:51
ya dejense de M... i mejor ponganse a resarpa k no les mochen la kabeza pendejos juarez no vale V... puro sikario kul0o cristo los ama

SINALOA ( e-mail: )
Miércoles 21.04.2010 / 20:46
PA QUE SEPAN KULER0OS AKI EL CARTEL DE SINALOA RIFA PUTOS LOS ALINEADOS SON UNA BOLA DE PENDEJOS QUE SE DEJAN QUITAR SU TERRITORIO BOLA DE INUTILES TRENSUDOS

kIRONEKER~` ( e-mail: )
Miércoles 21.04.2010 / 17:57
PINCHE chato C... ni puede correr el weii y el Kleens asta lo izo correr del pinche paniko si sitenias q ser lomero pinch C... cojo

kiro bjl ( e-mail: )
Miércoles 21.04.2010 / 13:27
a la V... todos se los cocha el jarudo el kiroo de la LBPcrew

RED ( e-mail: )
Martes 20.04.2010 / 07:29
KrOnIcKz wEedZ sMoKeRz CrEw KWSC el RED CLKAKOS 90

RED ( e-mail: )
Martes 20.04.2010 / 07:21
EL ROJO DE LOS KAKOS 90 CLK-CLK-CLK-CLK-CLK-CREW PASOS-PASOS-PASOS-PASOS

red ( e-mail: )
Martes 20.04.2010 / 07:15
Loz KaKoZ 90 InFo TeK eL RoJO CLk Loz KaKoZ 90 InFo TeK eL RoJO CLk Loz KaKoZ 90 InFo TeK eL RoJO CLk Loz KaKoZ 90 InFo TeK eL RoJO CLk Loz KaKoZ 90 InFo TeK eL RoJO CLk Loz KaKoZ 90 InFo TeK eL RoJO CLk Loz KaKoZ 90 InFo TeK eL RoJO CLk Loz KaKoZ 90 InFo TeK eL RoJO CLk Loz KaKoZ 90 InFo TeK eL RoJO CLk Loz KaKoZ 90 InFo TeK eL RoJO CLk Loz KaKoZ 90 InFo TeK eL RoJO CLk Loz KaKoZ 90 InFo TeK eL RoJO CLk Loz KaKoZ 90 InFo TeK eL RoJO CLk Loz KaKoZ 90 InFo TeK eL RoJO CLk Loz KaKoZ 90 InFo TeK eL RoJO CLk Loz KaKoZ 90 InFo TeK eL RoJO CLk Loz KaKoZ 90 InFo TeK eL RoJO CLk Loz KaKoZ 90 InFo TeK eL RoJO CLk Loz KaKoZ 90 InFo TeK eL RoJO CLk Loz KaKoZ 90 InFo TeK eL RoJO CLk Loz KaKoZ 90 InFo TeK eL RoJO CLk Loz KaKoZ 90 InFo TeK eL RoJO CLk Loz KaKoZ 90 InFo TeK eL RoJO CLk Loz KaKoZ 90 InFo TeK eL RoJO CLk Loz KaKoZ 90 InFo TeK eL RoJO CLk Loz KaKoZ 90 InFo TeK eL RoJO CLk Loz KaKoZ 90 InFo TeK eL RoJO CLk Loz KaKoZ 90 InFo TeK eL RoJO CLk Loz KaKoZ 90 InFo Te

( e-mail: )
Lunes 19.04.2010 / 21:16
pinshes swk a qe le tiran ia ni existen pinshe barrio ya ni pego no se para qe levantan esa marranda antes era otro pedo ahora son fantasmas ia murio la sw ala brava ia no valen para pura vergaaaaaaa

REGALADO ( e-mail: SUENO )
Lunes 19.04.2010 / 20:15
EL SUEÑÓKER REPRESENTANDO ATODOS LOS SWK SOUTH SIDE LOCOS DE LA COLONIA OBRERA

SUENOKER ( e-mail: SUENOkerone )
Lunes 19.04.2010 / 20:12
PURO SWK DE LA BIEGA ESCUELA

SUENOKER ( e-mail: SUENOkerone )
Lunes 19.04.2010 / 20:04
LA NETA COMPAS CHINGEN TODOS ASU PUTA MADRI PURO SWK SOUTH SIDE SELOS COCHA ALA BERGA TODOS ESOS PINCHIS BARRIOS

jArUdo L k S ( e-mail: LBPKrew. )
Lunes 19.04.2010 / 14:53
EL KLEN DE JARUDO SE LOS COCHA LOMERITOS DE MIERDAAAA.. NO LA KUAJAN CON EL KLEN ..

kironeker ( e-mail: )
Lunes 19.04.2010 / 13:27
soy el kiro del jarudo lokos P... tu kien H... ados te crees pinche vende donitas de azukar tenias k ser del pinche mini anapra, a tu mama la violo el pinche diablo cabron

( e-mail: )
Lunes 19.04.2010 / 07:52
no ma men eso Qee miReen mejor pongansen a estuuDiiar eso de g

PB7! ( e-mail: BARRIO SIETE! )
Lunes 19.04.2010 / 07:44
jajaja aver aver aver tu qien eres wei jaja nadie te qonoce! BARRIO SIETE TE QOSHA!

KIRONEKER'S ( e-mail: )
Domingo 18.04.2010 / 08:02
KE TRANZAAAA PINCHES LOMEROS CULOS SE LOS VA A KARGAR LA VERGA CON EL KIRO DEL JARUDO. PA KE SEPAN A LO KE LE TIRAN PINCHES MUGROSOS VENDE DONITAS

red ( e-mail: )
Viernes 16.04.2010 / 10:42
EL ROJO CLK - KAKOS 90 - EL ROJO CLK - KAKOS 90 EL ROJO CLK - KAKOS 90 - EL ROJO CLK - KAKOS 90 EL ROJO CLK - KAKOS 90 - EL ROJO CLK - KAKOS 90 EL ROJO CLK - KAKOS 90 - EL ROJO CLK - KAKOS 90 EL ROJO CLK - KAKOS 90 - EL ROJO CLK - KAKOS 90

TATOOS 13 ( e-mail: SUTATOOS13 )
Miércoles 14.04.2010 / 09:36
TATOOS 13 LOCKOTES DOMINANDO A WEBOOOOOOOO PURO PINCHI SUREÑOTE LOCKOTEE

( e-mail: LINEA! DE JUAREZ )
Lunes 12.04.2010 / 07:26
SOMOS DEL CARTEL DE JUAREZ AKI ANDAMOS TODAVIA MONTAPERROOS YA DEJA DE CAGAR LA VERGA Y LARGATE DE JUAREZ POR QUE VAMOS A MATAR ALAS FAMILIAS DE LOS DOBLE.A ATTE:LA LINEA

LA LINEA ( e-mail: DEL MONIKO )
Lunes 12.04.2010 / 07:19
AVER AVER CHOLITOS DE MIERDA ULTIMO LLAMADO QUE HACEMOS PARA LA PANDILLA DE LOS DOBLE A SI SIGUEN MAMANDO AL PINCHE ENANOO CULERO O SI SIGUEN CAGANDONOS LA ESTACA Y ROBANDO CARROS LES VAMOS A DAR EN SU PINCHE MADRE CULEROS YA VIERON LO QUE LES HA ESTADO PASANDO ASUS AMIGUITOS PENDEJOS QUE NO AN VALIDO VERGA EN JUAREZ LA LINEA DOMINA I EL CHAPO SOLO ES UN MUERTO DE HAMBRE KE MAMA AL MAYO

jarudo LOKOS.1 ( e-mail: theklen )
Lunes 12.04.2010 / 06:57
jarudo jarudo jarudo jarudo jarudo jarudo jarudo jarudo jarudo jarudo jarudo jarudo jarudo jarudo jarudo jarudo jarudo jarudo jarudo jarudo jarudo jarudo jarudo jarudo jarudo jarudo jarudo jarudo jarudo jarudo jarudo jarudo jarudo jarudo jarudo jarudo jarudo jarudo jarudo jarudojarudo jarudo jarudo jarudo jarudo jarudo jarudo jarudo jarudo jarudo jarudo jarudo jarudo jarudo jarudo jarudo jarudo jarudo jarudo jarudojarudo jarudo jarudo jarudo jarudo jarudo jarudo jarudojarudo jarudo jarudo jarudo jarudo jarudo jarudo jarudo jarudo jarudo jarudo jarudo jarudo jarudo jarudo jarudo jarudo jarudo jarudo jarudo jarudo jarudo jarudo jarudo jarudo jarudo jarudo jarudo jarudo jarudo jarudo jarudo jarudo jarudo jarudo jarudo jarudo jarudo jarudo jarudo jarudo jarudo jarudo jarudo jarudo jarudo jarudo SE LOS COCHA ATODOS KE DISE NOS ASEN DE AGUA JAJA .. LBPKrew..

pickos ( e-mail: )
Domingo 11.04.2010 / 13:34
pclokos los kocha adn aora dan nalgas a los 725 y el sney q ni la vuele a qui dejando marka el sckot y el nicklo pickos sckot los kocha adn kulos pcloooooooooooookooooooooooosssssssss el fasty el H... on los ace de aguas

HeLiO!PB7! ( e-mail: BARRIO SIETE! )
Domingo 11.04.2010 / 08:18
BARRIO SIETE!

( e-mail: )
Domingo 11.04.2010 / 05:54
msk galeanota 4 ever and 4 life the clika number one of the world mex side kings 4 ever, by @cme msk

zNeeL ( e-mail: )
Sábado 10.04.2010 / 14:14
BaaDbooiiZooTaa DiieeZyNuueeVee tHee ZneeLooQuiiTooW

( e-mail: )
Sábado 10.04.2010 / 14:11
KK II NN TT EE RR OO SS UU RR !! !!

( e-mail: )
Sábado 10.04.2010 / 13:04
estaan BN cagados

( e-mail: )
Sábado 10.04.2010 / 12:32
acg acg acg acg acg acg acg acg acg acg acg acg acg acg acg acg acg acg acg acg acg acg acg acg acg acg acg acg acg acg acg acg acg acg acg acg acg acg acg acg acg acg acg acg acg acg acg acgacg acg acg acg acg acg acg acg acg acg acg acg acg acg acg acg acg acg acg acg acg acg acg acg acg acg acg acg acg acg acg acg acg acg acg acg acg acg acg acg acg acg acg acg acg acg acg acg

ACg! ( e-mail: )
Sábado 10.04.2010 / 12:08
keeee tranzaaa MIJASSS aki nomass deJANDO LAA MARKA YAA REGISTRADA SANTANITAA LOKOSSS PAA TODOSS ESOS SHAPETONESS ! AcGlokotesss! ya lebantados por todo juaritoz )

KLEN BJL .LBPKrew.- ( e-mail: )
Viernes 09.04.2010 / 14:43
HAHAHAHA ME BALE BERGA LOS KE DYGAS PINCHI LOMEROS DE MIERDA .. BIEN LO SABEN KE NOSOTROS LOS JARUDO SOMOS KE CONTROLAMOS TOOOOOOOOODAAAAAAAAAA LA CUESTA Y TODA LA PINCHI FRONTERA DE JUARITOS PUTOS .. NO LA KUAJAN .. NOS ASEN ALGO YY LE ASEMOS UN PUTO PINCHI DESMADRE SI NO PREGUNTELE alos pbu alos joya.. JAJAAJ ASI DE SIMPLEMENTE ATTE KLEN .. COMO LES KEDO EL PINCHO OJOS YYY ASY .. DE SIMPLE SE ME CULIARON TODOS LOS DE 7 JAJA LOS BAILE EN SU BARRRIO NOOOO JAJAJAJAJAJ PINCHI BOLA DE CULOS YY ME BALE BERGA SY ME BUSKAN OOO NO .. TENGO KONKE .. IJOS DE PUTA . EL KLEN DE BJL ..

ARES ( e-mail: )
Viernes 09.04.2010 / 10:02
HEY ALIEN DIME KOMO PODREMOS DARLES EN LA MADRE Y ME LES UNO PINCHES PUTOS CAGANDO EL PALO SOLAMENTE

ares ( e-mail: )
Viernes 09.04.2010 / 09:57
QUIEN ERES TU TRANE PURO ADN LOKOS

trane ( e-mail: )
Viernes 09.04.2010 / 06:30
adn lockotes se cocha a todos

( e-mail: BJL'UNOS. )
Jueves 08.04.2010 / 18:42
KALLLATE I SAKA DE TRABAJAR A TU MAMA DE LOS KAMIONES BENDIENDO KAKAHUATES PODRIDOS PINCHI ROÑOOSO

paLomo ( e-mail: PB7! )
Jueves 08.04.2010 / 14:00
jaja PENDEJOO! pinshe ignorante nii sabes qomo me llamo! deseguro tenias q ser del jarudo igual de meqote q todos los de aia jaja BARRIO SIETE QOSHA!

red ( e-mail: )
Jueves 08.04.2010 / 10:36
CLK RED CLK RED INFO TEK LOS KAKOTES 90 CLK RED CLK RED INFO TEK LOS KAKOTES 90 CLK RED CLK RED INFO TEK LOS KAKOTES 90 CLK RED CLK RED INFO TEK LOS KAKOTES 90 CLK RED CLK RED INFO TEK LOS KAKOTES 90 CLK RED CLK RED INFO TEK LOS KAKOTES 90 CLK RED CLK RED INFO TEK LOS KAKOTES 90 CLK RED CLK RED INFO TEK LOS KAKOTES 90 CLK RED CLK RED INFO TEK LOS KAKOTES 90 CLK RED CLK RED INFO TEK LOS KAKOTES 90 CLK RED CLK RED INFO TEK LOS KAKOTES 90 CLK RED CLK RED INFO TEK LOS KAKOTES 90 CLK RED CLK RED INFO TEK LOS KAKOTES 90 CLK RED CLK RED INFO TEK LOS KAKOTES 90 CLK RED CLK RED INFO TEK LOS KAKOTES 90 CLK RED CLK RED INFO TEK LOS KAKOTES 90 CLK RED CLK RED INFO TEK LOS KAKOTES 90 CLK RED CLK RED INFO TEK LOS KAKOTES 90 CLK RED CLK RED INFO TEK LOS KAKOTES 90 CLK RED CLK RED INFO TEK LOS KAKOTES 90 CLK RED CLK RED INFO TEK LOS KAKOTES 90 CLK RED CLK RED INFO TEK LOS KAKOTES 90 CLK RED CLK RED INFO TEK LOS KAKOTES 90 CLK RED CLK RED INFO TEK LOS KAKOTES 90 CLK RED CLK RED

red ( e-mail: )
Jueves 08.04.2010 / 10:26
EL ROJO KAKOTES 90 CLK AL 100% EL ROJO KAKOTES 90 CLK AL 100% EL ROJO KAKOTES 90 CLK AL 100% EL ROJO KAKOTES 90 CLK AL 100% EL ROJO KAKOTES 90 CLK AL 100% EL ROJO KAKOTES 90 CLK AL 100% EL ROJO KAKOTES 90 CLK AL 100% EL ROJO KAKOTES 90 CLK AL 100% EL ROJO KAKOTES 90 CLK AL 100% EL ROJO KAKOTES 90 CLK AL 100% EL ROJO KAKOTES 90 CLK AL 100% EL ROJO KAKOTES 90 CLK AL 100% EL ROJO KAKOTES 90 CLK AL 100% EL ROJO KAKOTES 90 CLK AL 100% EL ROJO KAKOTES 90 CLK AL 100% EL ROJO KAKOTES 90 CLK AL 100% EL ROJO KAKOTES 90 CLK AL 100% EL ROJO KAKOTES 90 CLK AL 100% EL ROJO KAKOTES 90 CLK AL 100% EL ROJO KAKOTES 90 CLK AL 100% EL ROJO KAKOTES 90 CLK AL 100% EL ROJO KAKOTES 90 CLK AL 100%

red ( e-mail: jorgerojoc@hotmail.com )
Jueves 08.04.2010 / 10:14
RED-CLK-KAKOS 90 RED-CLK-KAKOS 90 RED-CLK-KAKOS 90 RED-CLK-KAKOS 90 RED-CLK-KAKOS 90 RED-CLK-KAKOS 90 RED-CLK-KAKOS 90 RED-CLK-KAKOS 90 RED-CLK-KAKOS 90 RED-CLK-KAKOS 90 RED-CLK-KAKOS 90 RED-CLK-KAKOS 90 RED-CLK-KAKOS 90 RED-CLK-KAKOS 90 RED-CLK-KAKOS 90 RED-CLK-KAKOS 90 RED-CLK-KAKOS 90 RED-CLK-KAKOS 90 RED-CLK-KAKOS 90 RED-CLK-KAKOS 90 RED-CLK-KAKOS 90 RED-CLK-KAKOS 90 RED-CLK-KAKOS 90 RED-CLK-KAKOS 90 RED-CLK-KAKOS 90 RED-CLK-KAKOS 90 RED-CLK-KAKOS 90 RED-CLK-KAKOS 90 RED-CLK-KAKOS 90 RED-CLK-KAKOS 90 RED-CLK-KAKOS 90 RED-CLK-KAKOS 90 RED-CLK-KAKOS 90 RED-CLK-KAKOS 90 RED-CLK-KAKOS 90 RED-CLK-KAKOS 90 RED-CLK-KAKOS 90 RED-CLK-KAKOS 90 RED-CLK-KAKOS 90 RED-CLK-KAKOS 90 RED-CLK-KAKOS 90 RED-CLK-KAKOS 90 RED-CLK-KAKOS 90 RED-CLK-KAKOS 90 RED-CLK-KAKOS 90 RED-CLK-KAKOS 90 RED-CLK-KAKOS 90 RED-CLK-KAKOS 90 RED-CLK-KAKOS 90 RED-CLK-KAKOS 90 RED-CLK-KAKOS 90 RED-CLK-KAKOS 90 RED-CLK-KAKOS 90 RED-CLK-KAKOS 90 RED-CLK-KAKOS 90 RED-CLK-KAKOS 90 RED-CLK-KAKOS 90 RED-CLK-KAKO

( e-mail: )
Jueves 08.04.2010 / 10:12
oye pinche palomo eso k wei cambiate el P... nombre wei no mames,ta bien cagado neta pinchi meko simberguensa jajajajajajajajajjajajjaj

( e-mail: JARUDO asta la muerte )
Jueves 08.04.2010 / 09:49
PURO BARRIO JARUDOOOTE LOKOS,para toda la pinchi gente,REVOLUCION PUTOS

AZTEKAS ( e-mail: )
Miércoles 07.04.2010 / 19:09
puro JARUDOTE lokoss cana asi d simple asi ess la vergota en el bariio jarudo lokos y pelones 1 cochan pur jarudo saludos para el skor klen gun nox drex fiver kiro spek yesk wike stop diees homie mago doser file gost doky duda kuba drak disa y a todos los JARUDO DE LA CUESTA HACIENDAS OASIS Y TODOS

( e-mail: )
Miércoles 07.04.2010 / 18:57
nndaa mass caagandoohhLaa cmooh siiempree yaa nooh maamenn tantoohh piitooh see qkeedaaraann siinn saaLiibaa weeyyess

( e-mail: JARUDOTE. )
Martes 06.04.2010 / 18:06
hahahahahahhahhahhahhahahhah LANETA IJOS DEPEERA' nossmetimosss astaa dentrroo del pinncchi kucchitrill laa pinnchi CASA roñosaa. NO DIGAN kee no ijossddeputtaa hahahhaa-loss asemoss mierdaa i eramoss komo 10 pendejooosss. hahahahahhahhahhahahhah KOMO less kedoo el GRAF hahahahhahhahahhahhahhahhahhahhahahha ese pinnchi MOKOSO MEKO ES BN KULOOOOOOOO KULOOTTTEEE. NOSEE LO kissoo daarr de acholee mejorr see fuue konn los polisss HAHAHHAHHAHAHH POBRESS ESTUPIDOS.NETA. UNAA kosaaa mmass ROÑOOSSOS porkkee sonn taann BIEJAS i meteen demanndaaa hahhahhahhahhahahahhahhahhahhahhahhaha pinncchi MARIKONES. rpscreew'

barrio siete lokos ( e-mail: BARRIO SIETE! )
Martes 06.04.2010 / 17:26
q putos el otro dia nos qisieron hacer de agua ii valieron V... nomas para q vean q no entran tan vergas al barrio ii no esta soLo!! ii qomo les qedo el weii q desmadramOs el sabadO en los telefono?? jaja nomas para q se qaLen putitOs! ia aqaben de pagar sus qantones fiados pinshes quLones! jajajajajajajajajajajajajajajajajjajajajajjajajajajajajajajajajajajajajajjajajajajajajajajajajajajajajajajajajaja BARRIO SIETE eL HeLiO! eL paLomO eL wisO ii el drek!

( e-mail: )
Martes 06.04.2010 / 10:10
LLA DIJO MEN JARUDOTELOKOS

( e-mail: )
Martes 06.04.2010 / 05:07
se k no conocen a los k nombre pero son de su pinchi barrio,,,,pinchis mocosos cuando tope a uno de ustedes no c la ban acabar de rato gente nos vemos en la torcida

( e-mail: PGS 77 )
Martes 06.04.2010 / 05:04
saludotes pa mi gente loka del jarudo pal juanillo,el mata,tragedias y al mostriyo pal 7 al gato,pirata quino y al apy pura gente lokota k rifaba en el EXO JUAREZ

( e-mail: PGS 77 de los 90"s )
Martes 06.04.2010 / 04:59
pinchis mocosos del 7,sigen siendo lomeros como los longos de su barrio,ni sikiera saben kien iso esa virgen en donde c lucen tomando fotos. y los de jarudo k no saben ni kienes empezaron el barrio jajajapobres chavos igual de P... los 2 barrios x k estan entrados y desde cuando??????? pinchis tontotes no conocen nada de su barrio,pero si le salen x el jajajaaj

ALIEN ( e-mail: GFG@HGGF.NET )
Lunes 05.04.2010 / 18:29
ATENCION MEXICANOS Y LATINOS, ESTADOS UNIDOS ESTA UTILIZANDO UN EXPERIMENTO LLAMADO HAARP, PARA PROVOCAR TERREMOTOS Y ALTERAR EL CLIMA, QUIERE ELIMINAR POBLACION DE TODO EL MUNDO, PORQUE NO SE ELIMINAN LOS GRINGOS Y LOS EUROPEOS QUE SON LA PINCHE PORQUERIA DEL MUNDO, ES HORA DE PARA A ESTOS PENDEJOS, QUIEREN SER LOS AMOS DEL MUNDO, CUANDO SON UNOS VALE MADRES, QUE SOLO LO QUE SABEN ES ROBAR A LOS DEMAS PAISES, NESESITAMOS PARARLOS Y DARLES EN SU MADRE,

NENE ( e-mail: )
Lunes 05.04.2010 / 12:53
si que maten a toda esta escoria infrahumanos y limpiar a juarez de tanta basura

roro ( e-mail: )
Lunes 05.04.2010 / 12:50
y aqui que pedo puro anormal cholos de M... no se por que no los quiebran a todos los vatos de la linea para que se acabe todo el pedo pero yaaaaa!!!!!!!!!!!!!!

junior ( e-mail: PoKeR123@hotmail.com )
Lunes 05.04.2010 / 12:38
puro pinchi pelones 1 y pinchi jarudo loco cochan a tu jefa y rifan en tu pinchi barrio

HeLiO!pB7 ( e-mail: )
Lunes 05.04.2010 / 06:57
BARRIO SIETE! LQS

( e-mail: b j l )
Domingo 04.04.2010 / 14:39
jarudo locos

( e-mail: )
Sábado 03.04.2010 / 08:40
EL STYK LOS KOCHA IJOS DE PUTA UNDERPLAGA JARUDOTESLOOKOS! RPSCREEW°

( e-mail: INFO3 )
Jueves 01.04.2010 / 17:22
MAMO ALOS JARUDO .

( e-mail: )
Miércoles 31.03.2010 / 14:29
saken loz partys laz_m0rrithaz_de_praderaz@hotmail.com

( e-mail: )
Miércoles 31.03.2010 / 12:50
ESCRIBISTE AKI PINCHI MOKOSO MEKO IGNORANTE

( e-mail: )
Martes 30.03.2010 / 13:57
TOOODOOODD LOSS PINSHHES PUTOOS QUE ESCRIIBBEENN AKII ME LA PELLAANN PEDEJOSSS .!!!! PINSHES MAMA PITOOSS CULEROOSS VALE VERGAA,!!!

( e-mail: RPS ESELCREEW' )
Martes 30.03.2010 / 05:08
JARUDOTE!RPSCREWW'JARUDOTE!RPSCREWW' JARUDOTE!RPSCREWW'JARUDOTE!RPSCREWW' JARUDOTE!RPSCREWW'JARUDOTE!RPSCREWW' JARUDOTE!RPSCREWW'JARUDOTE!RPSCREWW' JARUDOTE!RPSCREWW'JARUDOTE!RPSCREWW' JARUDOTE!RPSCREWW'JARUDOTE!RPSCREWW' JARUDOTE!RPSCREWW'JARUDOTE!RPSCREWW' JARUDOTE!RPSCREWW'JARUDOTE!RPSCREWW' JARUDOTE!RPSCREWW'JARUDOTE!RPSCREWW' JARUDOTE!RPSCREWW'JARUDOTE!RPSCREWW' JARUDOTE!RPSCREWW'JARUDOTE!RPSCREWW' JARUDOTE!RPSCREWW'JARUDOTE!RPSCREWW' JARUDOTE!RPSCREWW'JARUDOTE!RPSCREWW' JARUDOTE!RPSCREWW'JARUDOTE!RPSCREWW' JARUDOTE!RPSCREWW'JARUDOTE!RPSCREWW' JARUDOTE!RPSCREWW'JARUDOTE!RPSCREWW' JARUDOTE!RPSCREWW'JARUDOTE!RPSCREWW' JARUDOTE!RPSCREWW'JARUDOTE!RPSCREWW' JARUDOTE!RPSCREWW'JARUDOTE!RPSCREWW' JARUDOTE!RPSCREWW'JARUDOTE!RPSCREWW' JARUDOTE!RPSCREWW'JARUDOTE!RPSCREWW' JARUDOTE!RPSCREWW'JARUDOTE!RPSCREWW' JARUDOTE!RPSCREWW'JARUDOTE!RPSCREWW' JARUDOTE!RPSCREWW'JARUDOTE!RPSCREWW' JARUDOTE!RPSCREWW'JARUDOTE!RPSCREWW' JARUDOTE!RPSCREWW'JARUDOTE!RPSCREWW' JARUDOTE!RPS

( e-mail: )
Lunes 29.03.2010 / 23:46
JARUDO JARUDO JARUDO JARUDO JARUDO JARUDO JARUDO JARUDO JARUDO JARUDO JARUDO JARUDO JARUDO JARUDO JARUDO JARUDO JARUDO JARUDO JARUDO JARUDO JARUDO JARUDO JARUDO JARUDO JARUDO JARUDO JARUDO JARUDO JARUDO JARUDO JARUDO JARUDO JARUDO JARUDO JARUDO JARUDO JARUDO JARUDO JARUDO JARUDO JARUDO JARUDO JARUDO JARUDO JARUDO JARUDO JARUDO JARUDO JARUDO JARUDO JARUDO JARUDO JARUDO JARUDO JARUDO JARUDO JARUDO JARUDO JARUDO JARUDO JARUDO JARUDO JARUDO JARUDO JARUDO JARUDO JARUDO JARUDO JARUDO JARUDO JARUDO JARUDO JARUDO JARUDO JARUDO JARUDO JARUDO JARUDO JARUDO JARUDO JARUDO JARUDO JARUDO JARUDO JARUDO JARUDO JARUDO JARUDO JARUDO JARUDO JARUDO JARUDO JARUDO JARUDO JARUDO JARUDO JARUDO JARUDO JARUDO JARUDO JARUDO JARUDO JARUDO JARUDO JARUDO JARUDO JARUDO JARUDO JARUDO JARUDO JARUDO JARUDO JARUDO JARUDO JARUDO JARUDO JARUDO JARUDO JARUDO JARUDO JARUDO JARUDO JARUDO JARUDO JARUDO JARUDO JARUDO JARUDO JARUDO JARUDO JARUDO JARUDO JARUDO JARUDO JARUDO JARUDO JARUDO JARUDO JARUDO JARUDO JARUDO JARUDO

( e-mail: )
Lunes 29.03.2010 / 23:43
JARUDO JARUDO JARUDO JARUDO JARUDO JARUDO JARUDO JARUDO JARUDO JARUDO JARUDO JARUDO JARUDO JARUDO JARUDO JARUDO JARUDO JARUDO JARUDO JARUDO JARUDO JARUDO JARUDO JARUDO JARUDO JARUDO JARUDO JARUDO JARUDO JARUDO JARUDO JARUDO JARUDO JARUDO JARUDO JARUDO JARUDO JARUDO JARUDO JARUDO JARUDO JARUDO JARUDO JARUDO JARUDO JARUDO JARUDO JARUDO JARUDO JARUDO JARUDO JARUDO JARUDO JARUDO JARUDO JARUDO JARUDO JARUDO JARUDO JARUDO JARUDO JARUDO JARUDO JARUDO JARUDO JARUDO JARUDO JARUDO JARUDO JARUDO JARUDO JARUDO JARUDO JARUDO JARUDO JARUDO JARUDO JARUDO JARUDO JARUDO JARUDO JARUDO JARUDO JARUDO JARUDO JARUDO JARUDO JARUDO JARUDO JARUDO JARUDO JARUDO JARUDO JARUDO JARUDO JARUDO JARUDO JARUDO JARUDO JARUDO JARUDO JARUDO JARUDO JARUDO JARUDO JARUDO JARUDO JARUDO JARUDO JARUDO JARUDO JARUDO JARUDO JARUDO JARUDO JARUDO JARUDO JARUDO JARUDO JARUDO JARUDO JARUDO JARUDO JARUDO JARUDO

cuate* ( e-mail: )
Lunes 29.03.2010 / 21:12
como tiras tu roio palomo ia tumbese sus roios de maliya kagado neta we nomas no estes cagando el palo en jarudo we ke despues ai andas iorando we ke tu ia no eres del 7 i la V... pinshi mokoso nena i simon we pongame lo kekiera por aki porke aste eso ere srete kulo en persona pinshi mokosillo P... losCANGRY TE KOSHAN jarudolks

( e-mail: )
Lunes 29.03.2010 / 21:01
jajajajajajajajaja ALBERTO como te quedaroon los vidrioos jajajajajajajajaj ATTE:Paco y Palomooo tu pesadiilla jaja

adn 38 ( e-mail: )
Lunes 29.03.2010 / 09:32
adn 38 nomamen culos no la pelan los 725 los vamos a desmadrar de uno por uno a todos y el rafa dise ke les va a cargar la V... por andar mamando P... los adn 38 se los cochan

sckot 725 ( e-mail: )
Lunes 29.03.2010 / 08:54
shingen a su madre el sckot los kosha ahora koshamos alos q dominan disq ustedes bola d kulos y al kulo del pelon q no la kaliente x q si no ban a baler berrrgaaaaa kulos 725crew los koshan

( e-mail: jarudoo locoos )
Lunes 29.03.2010 / 07:57
ii cuando entren a jarudo no nomas en la primera cuadra metanse asta el fondo na qe shhingadoos hahahaahhaha no son pendejoos saven bien qee no salen de ai adentroo del jarudooo putoos

( e-mail: jarudoos locoos )
Lunes 29.03.2010 / 07:52
si wee haha como tiran rollo neta si bien qee los sacaron wee nomas para qee washen qe alas 5 de la mañana se meten ii de todos modos de donde qieran les salen ii a cualqier ora no como su pinshe barrio fantasma qe no se aya a nadie aunqe sean las 6 de la tarde nomas para qe washen qe a todas horas ai jarudos en las calles

fernando ( e-mail: aldoo_95@hotmail.com )
Lunes 29.03.2010 / 06:38
no k onda un mensaje para los tandos locos de san angel sur

( e-mail: BARRIO SIETE! )
Domingo 28.03.2010 / 17:00
jaja q roio qomo les qedaron los vidriOs jaroshillos?? jaja nos la pelan ii el yesk todo qulo no se qiso dar un tiro de a shoLe ni xq tiramos las piedras i andabamOs sta adentro de su pinshe barrio QAGADO, i el fredy tmb todo QULO no se qiso dar un tiro les digo son bn SHAVALAS ii es mas la habLadera q traen q lo q hacen jaja ii esto apenas empieza AMARRENCE!! BARRIO SIETOTE!

el papa de los pollitos ( e-mail: )
Domingo 28.03.2010 / 12:16
H... uen a su P... madre todos pinches cholos de M... se esconden detras de una pinche computadora jajajaja me dan risa eso no es tener huevos eso se llama ser culos jajaja pinches cholos P... muy vergas se cren pero ala mera hora se sientan putos att cartel de juarez nosotros si tenemos mas que huevos y lo emos demostrado a nivel mundial

( e-mail: )
Sábado 27.03.2010 / 10:12
AITAMOS HOMIS.DESDE H.K.J LEBANTADO AL JARUDO EN AGS

reote one ( e-mail: )
Viernes 26.03.2010 / 20:05
saludos al war sure dido senso dae sifo y a todos los de la bb dd rr south side 13 de haciendas y alos msh del granjero su home el reote desde denber col ssl

( e-mail: JARUDOTE )
Viernes 26.03.2010 / 19:17
JARUDOTELKS.RPSCREWW''JARUDOTELKS.RPSCREWW'' JARUDOTELKS.RPSCREWW''JARUDOTELKS.RPSCREWW'' JARUDOTELKS.RPSCREWW''JARUDOTELKS.RPSCREWW'' JARUDOTELKS.RPSCREWW''JARUDOTELKS.RPSCREWW'' JARUDOTELKS.RPSCREWW''JARUDOTELKS.RPSCREWW'' JARUDOTELKS.RPSCREWW''JARUDOTELKS.RPSCREWW'' JARUDOTELKS.RPSCREWW''JARUDOTELKS.RPSCREWW'' JARUDOTELKS.RPSCREWW''JARUDOTELKS.RPSCREWW'' JARUDOTELKS.RPSCREWW''JARUDOTELKS.RPSCREWW'' JARUDOTELKS.RPSCREWW''JARUDOTELKS.RPSCREWW'' JARUDOTELKS.RPSCREWW''JARUDOTELKS.RPSCREWW'' JARUDOTELKS.RPSCREWW''JARUDOTELKS.RPSCREWW'' JARUDOTELKS.RPSCREWW''JARUDOTELKS.RPSCREWW'' JARUDOTELKS.RPSCREWW''JARUDOTELKS.RPSCREWW'' JARUDOTELKS.RPSCREWW''JARUDOTELKS.RPSCREWW'' JARUDOTELKS.RPSCREWW''JARUDOTELKS.RPSCREWW'' JARUDOTELKS.RPSCREWW''JARUDOTELKS.RPSCREWW'' JARUDOTELKS.RPSCREWW''JARUDOTELKS.RPSCREWW'' JARUDOTELKS.RPSCREWW''JARUDOTELKS.RPSCREWW'' JARUDOTELKS.RPSCREWW''JARUDOTELKS.RPSCREWW'' JARUDOTELKS.RPSCREWW''JARUDOTELKS.RPSCREWW'' JARUDOTELKS.RPSCREWW''JARUDOTELKS.

( e-mail: jarudote )
Viernes 26.03.2010 / 09:07
hahahahhahha io solo los agaoo korreerr PENDEJOS hahahahhah pobress mekoss NETA esperate esparate kee komo noss kedoo la ´plakaa hhahahahhaa lla pintaronn & AORA KOMO LES kedoo la MIAA hahahahhaahahaahahh PENDJOS.

DREAM AND GARY ( e-mail: )
Viernes 26.03.2010 / 05:40
K TRANZA PENDEJAS

( e-mail: B SIETE! )
Jueves 25.03.2010 / 16:37
x cierto qomo les qedO la plaqilla tashada?? jaja iluego anoshe los shavillos iorando i deciendo no tiro jarudo jaja mas SHAVALAS no pueden ser les digO. eL SIETE se los QOSHA!

( e-mail: B SIETE!! )
Jueves 25.03.2010 / 16:25
jaja se qren mui verrgas nomas xq asen un desmadrecillo pinshes jaroshos jaja pero buenO nomas amarrence xq va la de nosotros jaja B SIETE!

( e-mail: JARUDOTE )
Jueves 25.03.2010 / 14:46
nosotross somos los unikoss ke dominamos GENTE

adn 38 ( e-mail: cholito 38 )
Jueves 25.03.2010 / 06:45
un saludote a la jente del adn 38 del roma de parte del cholito 38 a y a los cvs 38 controlando y dominando

( e-mail: JARUDOTE )
Miércoles 24.03.2010 / 17:07
hahahah mee metooo a raaiiaarrr EN LA KARA DEL wooffee & no mee diccee NADAA hahahahahhahahhahhahahhahhahha PENDJOS

( e-mail: )
Miércoles 24.03.2010 / 15:02
qe transa oxer.. soe el rocka we , saqa una pinta wey................................................ ................................................. apoco los pinches lomeros piojosos lomeros tienen computadora jjaja jarudo selos cocha putos jaja elrockaone!bjL!!

( e-mail: jarudoo locoos )
Miércoles 24.03.2010 / 13:10
qee siete lomeros pra qe washen qe no nomas ablamos ia les isimos el desmadre hahahahha aii pobresitos pero como no somos comformistas vamos aser mas para qe no anden de llorones como ahorita trallendo soldados ii poniendo demandas neta tss qee culos pinshes shavalottototas ia vieron qienes son los buenos i qee como qedo el siete bonito noo ? hahahahaha ii sus camionetas tambien hahahhaha

BJL .. LB ( e-mail: )
Miércoles 24.03.2010 / 13:07
la neta pinchi LOMERITAS DE MIERDA .. NO LA ASEN CON NOSOTROS .. para ke guache pinchi marikas de M... .. nosotros sy asemos algo yy kien puro la demanda JAAJJA ESO KE ASY OOOOO MAS LLORONES DE MIERDA.. ESOS ROLLLOS KE NI UN NIÑO SE ABIENTA ESO NETA PONER DEMANDA JAAJAJJAJAJAJAJAJAJAJAJAJAJAJJAJA .. ABER KIEN CHINGA AKIEN BIEN SABE KE EL KE RIFA YY SIEMPRE RIFARA SERA EL JARUDOOOOOOOOOOOOO PUTOSSS .. ASI DE SIEMPLEEEEEE SERA ... LBP .. RIFA EN JARUDO .. PUTOS

oxer96 ( e-mail: oxerwm@hotmail.com )
Miércoles 24.03.2010 / 10:47
k tranza raza de juaritos soy el oxer de el paso tx un saludo a todos los k no an dejado morir al graff.

B.J.L ( e-mail: )
Miércoles 24.03.2010 / 08:59
QUE ROLLO MIS JARUDO ME LEVANTO ESTA MAÑANA Y LO PRIMERO QUE VEO EN LA CALLE ES QUE ESOS PINCHES TERROSOS DE MIERDA SE METIERON AL BARRIO A TACHAR TODO EL PEDO ARRE GENTE VAMOS ASERLOS DE AGUA Y ESE CULO DEL FIONER QUE NOMAS ALAS 3 DE LA MAÑANA PUEDEN Y EL WOFE QUE PINCHE CARA DE CHANGO CULERO ARRE GENTE BARRIO JARUDO LOKOTES VAMOS A ASER EL DESMADRE Y QUE VALGA VERGA

( e-mail: )
Miércoles 24.03.2010 / 08:51
mmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssshhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllll msh locos

( e-mail: )
Martes 23.03.2010 / 17:39
oigaaan laaa vdddd esquee soi bisexuaal i andoo buscandoo parejaaa i pues me dijieron que me comunicara con el tal fioner que tmb es BI solo kiero conosertee papii me diceeen MIQS para cuando kieras solo contestamee este msj MIQS selas mama pero mas al fioner que es BISEXUAL meeamoor ¢¾

( e-mail: )
Martes 23.03.2010 / 17:35
BJAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOO RRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSS

( e-mail: JARUDOTE! )
Martes 23.03.2010 / 17:05
hahahahah ahueebboo PUTOS loss segiraa cochannddoo SIEMPREE SIEMMPREE hahahaha.el fioner lloro el fioner lloro JAJAJAJA unsaludo AL SPEEK. RPSSCREWW.LOKA!

( e-mail: hahhahahah pinnchi marikonnn & aparttee LLORON' )
Martes 23.03.2010 / 16:59
el fionerr LLORO'el fionerr LLORO' el fionerr LLORO'el fionerr LLORO' el fionerr LLORO'el fionerr LLORO' el fionerr LLORO'el fionerr LLORO' el fionerr LLORO'el fionerr LLORO' el fionerr LLORO'el fionerr LLORO' el fionerr LLORO'el fionerr LLORO' el fionerr LLORO'el fionerr LLORO' el fionerr LLORO'el fionerr LLORO' el fionerr LLORO'el fionerr LLORO' el fionerr LLORO'el fionerr LLORO' el fionerr LLORO'el fionerr LLORO' el fionerr LLORO'el fionerr LLORO' el fionerr LLORO'el fionerr LLORO' el fionerr LLORO'el fionerr LLORO' el fionerr LLORO'el fionerr LLORO' el fionerr LLORO'el fionerr LLORO' el fionerr LLORO'el fionerr LLORO' el fionerr LLORO'el fionerr LLORO' el fionerr LLORO'el fionerr LLORO' el fionerr LLORO'el fionerr LLORO' el fionerr LLORO'el fionerr LLORO' el fionerr LLORO'el fionerr LLORO' el fionerr LLORO'el fionerr LLORO' el fionerr LLORO'el fionerr LLORO' el fionerr LLORO'el fionerr LLORO' el fionerr LLORO'el fionerr LLORO' el fionerr LLORO'el fionerr

( e-mail: )
Martes 23.03.2010 / 16:57
hhahaha al fioneeer ia ponganlee una mascaraa no valeee V... su facee neethaaaa i pobrees lomerooos cada diaa van valiendoo vergaaa ya ni el pinchii royoo que tiraaan pinchiis costrudos mierdas i veean elñ cal tv tss pobrees JARUDOOOOOOOOOOOOOOTEEEEE LOS COCHAAAA I LOS SEGUIRAAAA COCHANDOOO DONEROS DE MIERDAAAAAAA un saludooo al slatuno aithamooos CARNAL BJL'RPSPEECK COCHAAAAAA ! ! ! !

( e-mail: JARUDOTE )
Martes 23.03.2010 / 16:29
hahahaha H... atuu madree komo? JAROCHOS hahahahahahahahahahahahahhahahha nomamesss MEKO bbeetee en un espejooo ASKEROSO hahahahaah pinnchi MEKO estupiddoo'sonn unaa bolaa DE KULOS tooddoss es la VD nomamess ABER el klenn se metioo astaa suu barrio i KEE nadiee se kisso DAR el tiroo JAJAJAJAJAJAJAJ KULOSS KULOS KULOS hahahahahah BN sabenn PENDJOS

( e-mail: )
Martes 23.03.2010 / 16:12
sOfEr!!!!!!!!!

( e-mail: BARRIOSIETE! )
Martes 23.03.2010 / 16:07
aa pero como tiran royo pinshes jaroshos de mierda!! ustedes son los q eran qomo 25 i nosotros qomo 10 ii asi no la pelaron!BARRIO SIETE LOQOS!

( e-mail: )
Martes 23.03.2010 / 14:27
YA CAYENSE PINCHES JAROCHAS D MIERDA YA NO TIREN TANTO ROYO Y SI SON CONOCIDOS PERO POR LO CULOS KE SON Y KE SON PURO BLA BLA BLA

( e-mail: JARUOTE )
Martes 23.03.2010 / 14:21
ARRE LLA SE LA SAVEN CABRONES AI ESTAMOS PUESTOTES.

aac ( e-mail: )
Martes 23.03.2010 / 13:44
artist6as rifamos panochitas no balen bergas kaiganle pa ber kuantos qbramos 1 saludo al jarudo q lla estamos akople kon el pandooooo ok kuidense l.s.e.a.d.e.r.guter.............

( e-mail: )
Martes 23.03.2010 / 13:34
aquii estamoos presentes pinches lomeroos y arre putos io ia no andoo en riñas peroo quiero agarrarme a putos mi barrio con su barrio a putasos para ver quien es mas H... on q quien putas pero se culean jajaja se metieroon nomaas dos weies y no se quisiseron dar un tiro pinches culones de M... BjL rps LOS NUMBER WAANNNNN!!!!!! aunq les duela MADAFAKAS

JARUDO LOKOS ( e-mail: )
Martes 23.03.2010 / 09:30
JARUDO LOKOS .. ASI DE SIMPLE TODOS KIEREN ASER FAMOSOS COMO NOSOTROS .. TODO CD JUAREZ NOS CONOSEN JAJAAJAJJAJA.. ASI DE SIEMPLE POR LOKOS.. JAAJAJA

( e-mail: uoneqkoners. )
Martes 23.03.2010 / 06:24
O N E Q K O N E E ' S . .

( e-mail: jarudoo locoos )
Lunes 22.03.2010 / 18:53
qee mi fioner otra sicatris en tu cara de los del jarudo hahahahahahaa ai pobres sieterilloos es mas no se ni para qee tiran tanta M... si saven bieen sigan cagando la V... tambien para cuetiarles otravez sus casas

( e-mail: RPSCREEW' )
Lunes 22.03.2010 / 17:01
hahahahahaahahahahahahahhaha sonn unaa MIERDA lomerosss noss tieenneenn PANIKO vdd pendejooss.HAHAHAAHAHAHAH. asii noss gusstaann pinnchiss KULONES komoo OY pura bola de kulosss i ROÑOSOS ke nomass ASEN bola putoss HAHAHAHA nommmass eramosss 10 putooss ustedes ERAN komo 25 PINNCHI KULONES HAHAHAHAHAHAHAHAHHAHAHAHAHAHAHHAHAHAHHA SON UNAA MIERDAA

( e-mail: 656 el jarudo )
Lunes 22.03.2010 / 13:11
JARUDOTE LOKOTES!!!!!!!!MOST DANGEROUS GANG!! in ciudad juarez chihuahua

JARUDO. ( e-mail: kierennsegirrnuestrospasoss' )
Lunes 22.03.2010 / 08:20
RPS'CREWW! RPS'CREWW! RPS'CREWW! RPS'CREWW! RPS'CREWW! RPS'CREWW! RPS'CREWW! RPS'CREWW! RPS'CREWW! RPS'CREWW! RPS'CREWW! RPS'CREWW! RPS'CREWW! RPS'CREWW! RPS'CREWW! RPS'CREWW! RPS'CREWW! RPS'CREWW! RPS'CREWW! RPS'CREWW! RPS'CREWW! RPS'CREWW! RPS'CREWW! RPS'CREWW! RPS'CREWW! RPS'CREWW! RPS'CREWW! RPS'CREWW! RPS'CREWW! RPS'CREWW! RPS'CREWW! RPS'CREWW! RPS'CREWW! RPS'CREWW! RPS'CREWW! RPS'CREWW! RPS'CREWW! RPS'CREWW! RPS'CREWW! RPS'CREWW! RPS'CREWW! RPS'CREWW! RPS'CREWW! RPS'CREWW! RPS'CREWW! RPS'CREWW! RPS'CREWW! RPS'CREWW! RPS'CREWW! RPS'CREWW! RPS'CREWW! RPS'CREWW! RPS'CREWW! RPS'CREWW! RPS'CREWW! RPS'CREWW! RPS'CREWW! RPS'CREWW! RPS'CREWW! RPS'CREWW! RPS'CREWW! RPS'CREWW! RPS'CREWW! RPS'CREWW! RPS'CREWW! RPS'CREWW! RPS'CREWW! RPS'CREWW! RPS'CREWW! RPS'CREWW! RPS'CREWW! RPS'CREWW! RPS'CREWW! RPS'CREWW! RPS'CREWW! RPS'CREWW! RPS'CREWW! RPS'CREWW! RPS'CREWW! RPS'CREWW! RPS'CREWW! RPS'CREWW! RPS'CREWW! RPS'CREWW! RPS'CREWW! RPS'CREWW! RPS'CREWW! RPS'CREWW! RPS'CREWW! RPS'CREWW! RPS'CREWW!

info.EL JARUDO ( e-mail: JARUDO DS )
Lunes 22.03.2010 / 06:44
aky el jarudo reportandose desde westcoust,arre people tras de los askerosos lomeriyos ni un P... terroso puede ser del jarudo,tirenle los dientes cuando les digan k kieren ser del jarudo no c apiaden de los vende donas!!jajajaja

eeL yeesK de los cangry's crew ( e-mail: yesk jarudo locos )
Domingo 21.03.2010 / 21:17
un saludo para mis compas los rps lbp aii stamos atte el mishel del jarudo arre sieterilloos me shupan las bolas ii siempre me las an shupado culeroos aii sta lo qee los avia prometido hahhahahahaha

( e-mail: west side califas!!! )
Domingo 21.03.2010 / 14:03
barrio jarudo lokos asi c yama mi barrio y a donde kiera k bamos siempre le saltamos,pinchis maricones jarudo es mas H... on,si kieren entrarle lo pueden intentar pero pinchis vatos yo les voy a ensenar como m la van a pelar....in memory rest in peace,mi karnalito"el toto"mi homie"el gordo" we love you homitos,we miss you

( e-mail: dark side jarudote!! )
Domingo 21.03.2010 / 13:50
k royo kien es ese hijo de la V... k dice k los jarudo de antes eran H... ones y k los de aora son puros chaviyos..de k lado esta P... si es del barrio salgale yagales un paro guey no este tirando tanta M... C... no deje morir alos chavos,yo soy el k dijo lo de la vieja escuela culero,soy longo y eso aprendi nunca dejar morir alos del barrio y siempre le sali x todos!!!

( e-mail: EL PAPPI... )
Domingo 21.03.2010 / 07:26
pongan un mail de verdad pa konocerlas..pa k m inviten a pistear morritas de praderas

( e-mail: )
Domingo 14.03.2010 / 12:52
laz_m0rrithaz_de_praderaz@hotmail.com

( e-mail: )
Domingo 14.03.2010 / 11:49
shiikitha@live.com.mx Lazs morrrithaz de praderaz

( e-mail: )
Domingo 14.03.2010 / 11:46
Qe rooioo pzs aKiii Lezs dejamozxs un Peqeeño mensajeee pzs shiidfozs suzs comentariozs puroo maton aki!! pz mejor toDozs saQen Lozs pariizs aver azsii kmo ladran piistean Lazs morriThazs de praderazs

SLAAT ( e-mail: )
Domingo 14.03.2010 / 09:56
JARUDOOOOTE CONTROLANDO A TODOS LOS PINSHES ENTRADOS AII PARA K SE WASHEN PUTOS AII TAMOS PINSHIS MEKOSSS

KLEN BJL LBP CREW ( e-mail: )
Sábado 13.03.2010 / 03:23
de ke sirbe ke ponga mi apodo .. we ke me bas aser jaja soy el KLEN .. DE JARUDO CANA .. EY WE CUANDO BAS A BENIR PARA KE NOS MAMES LA BERGA .. LO KE SABES ASER MEKO.. TU YY OSKAR JAJA.. EL KLEN DE JARUDO LOKOS.. ASI DE SIEMPLE

( e-mail: )
Viernes 12.03.2010 / 18:14
aber aber el palomo q we no nos daba servesa a mi y al yesk para q no le pegaramoos pinche chavo de M... y hablas de mamarprimero deja de mamarnos ami y al yesk y ya hablas pinche bastardo o quieres otros pinches plomasoos en tu house jajajajajajajajajaja barrio jarudo el SNAFONE TE COCHA PENDEJO

el lier loco ( e-mail: )
Viernes 12.03.2010 / 07:29
cartelon 23 pinches vatos caga sangre valen V... ychupan huevos nadie los conoce por culnes el lier los cocha culotes

el reote one ( e-mail: )
Viernes 12.03.2010 / 06:58
un saludo para los msh del granjero y los surenotes 13 del bdr de haciendas pal warsito el sure el bambu dido senso de su compits el reote pts

( e-mail: )
Viernes 12.03.2010 / 05:34
PINCHIS JARUDOS KE TIRANDO SU MIERRDOTA Y NI SU APODO PONEN LOS PNDJOS AI SE VE KE SON CULOS PINCHIS NIÑAS MIEDOSAS JAJAJ

LBP CREW ..BJL ( e-mail: )
Viernes 12.03.2010 / 05:04
HAHA NO MAMES palomo WEE AMI ME BALE BERGA SY TE LAS COCHAS.. SON biejas we aora no me salgas ke yo no ando con esos rollos .. we yy AMI ME BALE BERGA SE DONDE VIVO WE.. como tu casa parese ..tapias .. bueno son ay se akoplaron ajajajajjaaj.. UN JARUDO TE COCHO ATU HERMANA YY VIVE AY EN TU PINCHI KASA.. JAJAJA KE MAS CHINGADOS KIERES JAJA YY cual oskar mamamos yy el nos mama ke rollo mis jarudo ASY DE SIEMPLE NOS DIESEN .. aber sy cierto .. weee ke muy berguitas B A R R I O ..JARUDO ... L O K O S

( e-mail: )
Jueves 11.03.2010 / 15:02
LO APOIO CARNAL ESOS WEIES SON UNA MIERDA WEI I MAS ESE CAGADO DE EL PALOMOO ESTOI KON TIGO VATO ALTAVISTA BJL RIFAN

( e-mail: JARUDOTE )
Jueves 11.03.2010 / 14:27
hahahahahahahha nosotrooss no MAMAMOSS a nadiee BASTARDO hahaha encammvio usteddes sii se agarraan de los HUEBOS de los unidos HAHAH pero kon elloos o sinn elloos sonn UNA mierddaaa PENDJOSSS.hahahahaha.ii kochensee alass rukkass aki EN jarudoo NADIE las pelo PERO NADIE weiii i puues no abiaaa de otraa KE irseee KON LOS piojossoosss.HAHAHAHAH nosotrooss tampokoo andamooss kon mamadass palomo BN sabbes BASTARDOO.

eL palOmO! ( e-mail: )
Jueves 11.03.2010 / 12:33
q putOs soi el palomO pasesen de vergas para matarlOs ala V... io no ando qon mamadas, me qoshO a sus viejas todos los dias ia se dnd viven todos para q se amarren! aii me seguiran viendo en su barriO!pendejos en el cherokee o en laa expediciOn jaja pendejossssssss. ii sigan mamandO al osqar!! jaja pendejOs!

( e-mail: )
Jueves 11.03.2010 / 08:19
DeeL KAMPANARIO putthOzz !!! ssomoss laa veerGaa !!

( e-mail: )
Jueves 11.03.2010 / 08:17
arreee no sse kien eras pero PARA KE GUCAHE KE ESTA CHABO ES CABRON LE EE ESCHO UN DESMADRE ALOS DE SIETE .. ARRE YO ME APUNTO EL KLEN PARA KE BALGA BERGA DE UNA BES JARUDO LOKOS

( e-mail: JARUDOTE. )
Jueves 11.03.2010 / 06:15
kkee kiereen los del 7 aasiendoo esas pendejadass nomammen no seaann pendejosss weiesss SIMPLEMENTE nossottros somosss loss ke kontrolamoss IJOS DE PUTA i bieenn sabben unaaa PREGUNTA porrkk asenn esasss pendejass PIOJOSOS hahaha de dessir no no la generasionn de oyy no bale berghaa JAJAJAJAJAJAJA bnn sabben kee rifamos puutoosss. hahahahahahahahahahhahahahaha

LA LINEA ( e-mail: )
Jueves 11.03.2010 / 03:52
ESTE FUE EL ULTIMO AVISO LA MUERTE DEL TIBU I DEL AXER DE LOS DOBLE A I FALTAN MAS EN LA LISTA CUIDENSE LOS QUE SE HACEN YAMAR ARTISTAS ASESINOS QUE YA VAMOS A LIMPIAR JUARITOZ DE ADOLECENTES PENDEJOS QUE LE SALEN POR LOS CONTRA Y NO POR SU CIUDAD AMARRRENSE QUE AI LES VA MAS HOMBRES Y MUJERES VAN PARA ABAJO ATTE:LA__________

( e-mail: )
Miércoles 10.03.2010 / 16:37
barrio jarudo lokos es H... on pero los de antes esta generacion son pura bola de culos ojala que mi jarudo vuelva aser como el de antes H... on no M... con puros pinches niños culos pero culos que me cala admitir puero nomas ven bronca y se meten a su casa con su mami ya vamos a demostrar el pinche color del barrio contra esos pinches vende donas de M... arre o que gente aver quen me contesta quien se agarra los wevos de los pinches chavos de M... del barrio a aser el desmadre con los lomeros

( e-mail: )
Miércoles 10.03.2010 / 16:32
ase mucho que no me metia y siguen mi gente del jarudo diciendo P... ya gente que no les da verguenza el ablador del klen no que ya iva a balir V... no as echo ni madre wey on ta el wey que arre a agarrar la vieja escuela les dijo mis jarudo amarrense un pinche huevo pero amarrenselos no puro bla bla ya no digan P... mis jarudo mejor actuen que no lo creo nunca ban a actuar pinches chavitos que traen haora no sirven para ni madre

( e-mail: )
Miércoles 10.03.2010 / 14:04
AQUI MANDA EL CARTEL DE JUAREZ NO SEAN PENDEJOS ATODOS LOS QUE SE VAYAN CON LOS CONTRARIOS LES VAMOS A DAR PISO NO LE AGAN AL VERGITAS CHAVOS ATTE LA __________________

( e-mail: )
Miércoles 10.03.2010 / 14:00
bjarudolockos!!!los piojosos del siete son culos jarudo selos cocha putitas...

SEXYYY CALIENTE ( e-mail: caliona@hotmail.com.mx )
Miércoles 10.03.2010 / 08:28
QUE ROYO BUSCO AMIGOS CALIENTES camaliona@hotmail.com.mx con minusculas sexyyyy 37 besitos

( e-mail: )
Martes 09.03.2010 / 13:52
JARUDOES EL PUNNTTOO IJOS DE PEERRA

MR.DRECK*¢¾ ( e-mail: BYG TRISTE 13 )
Martes 09.03.2010 / 07:17
AZTECAS MATONES SICARIOTESDE LA LINIA

¢¾AZTECAS .V*B*T**13¢¾ ( e-mail: BYG TRISTE13 )
Martes 09.03.2010 / 07:13
p style="visibility:visible"object classid="clsid:d27cdb6e-ae6d-11cf-96b8-444553540000" height="475" width="600" style="width:600pxheight:475px" param name="allowScriptAccess" value="never" / param name="allowNetworking" value="internal" / param name="movie" value="http://widget-e3.slide.com/widgets/slideticker.swf" / param name="wmode" value="transparent" / param name="quality" value="high" / param name="scale" value="noscale" / param name="salign" value="l" / param name="flashvars" value="cy=ms&il=1&channel=2449958197320723427&site=widget-e3.slide.com" / embed type="application/x-shockwave-flash" allowScriptAccess="never" allowNetworking="internal" src="http://widget-e3.slide.com/widgets/slideticker.swf" height="475" width="600" style="width:600pxheight:475px" wmode="transparent" quality="high" scale="noscale" salign="l" flashvars="cy=ms&il=1&channel=2449958197320723427&site=widget-e3.slide.com" / /objectp style="white-space:nowra

V*B*T*13 ( e-mail: BYG TRISTE13 )
Martes 09.03.2010 / 07:09
DRECK COCHON AZTECAS V*B*T*13

♫¢Ü¢¾MR*DJ*DRECK¢¾♫¢Ü ( e-mail: )
Martes 09.03.2010 / 07:05
ke rooyo atodas las putas de los doblados AA los bamos a esterminar AZTECOTAS putos de la col. INDEPENDENCIA#2 V*B*T*13 MR .DRECK *COCHON *JAJAJAJAJJAJAJ

( e-mail: snaaf UNO no hay mas )
Lunes 08.03.2010 / 17:21
BjL

( e-mail: )
Lunes 08.03.2010 / 17:15
aber aber los de el siiete q quieren we nos disen chabalas para empesar q nos desia el chato no io ia no tiro barrio es mas me quiero aser jarudo no me agan nada snaf tira paro pinchis chabalas y el fioner q andba aqui de biker y tmbn queria ser jarudo jajaja les digo q el jarudo es su padre jaja y loego se meten en ranfla pero nomas por las orillas pinches BASTARDOS de mierdas ia saben q el JARUDO esnumero uno en juarez PUTOS ok ia saben q aqui la rps y un saludo para el yesKARMELO arre ai tamos BjL rps CREW su dolor de cabesa pinches doneros de M... jajaja JARUDOTESLOKOTES RPSCREW

( e-mail: )
Domingo 07.03.2010 / 14:03
culos todos los pcl el sney ya saben donde vivo putos estoy puestoteee el SNEY de la ADN LOKOS son culos de amadre

SNEY ( e-mail: )
Domingo 07.03.2010 / 13:59
saludoos a toda la ADN q todabia se sigen le bantando en el muro y entodas partes el sney rip omek des canse en pas

FOWER ONE ( e-mail: )
Domingo 07.03.2010 / 06:49
JAJAAJ EL FOWER DE LA LOS SUREÑOS LOCOS 13 DE LAS TORREZ RIFA Y CONTROLA

( e-mail: )
Domingo 07.03.2010 / 06:24
RPS CREWW' *RPS CREWW' *RPS CREWW' *RPS CREWW' RPS CREWW' *RPS CREWW' *RPS CREWW' *RPS CREWW' * RPS CREWW' *RPS CREWW' *RPS CREWW' *RPS CREWW' * RPS CREWW' *RPS CREWW' *RPS CREWW' *RPS CREWW' * RPS CREWW' *RPS CREWW' *RPS CREWW' *RPS CREWW' * RPS CREWW' *RPS CREWW' *RPS CREWW' *RPS CREWW' *

cholito adn 38 ( e-mail: )
Domingo 07.03.2010 / 04:00
adn 38 y cvs 38 controlando el roma

sckot ( e-mail: )
Sábado 06.03.2010 / 12:55
saludos para los pclcrew al sprock,lemonsk,weat, al niclo,ysto,grate,snopy,signo,snocker,picos,fasty,smock,gasper,cone,fomek,eri,bleck,neo,pelon,more,blay,bart,crone,la miriam y la koral,cron y los q se me olvidaron y la kornyoner puro pclcrew para los kulos de los kanikas el sckot delos de la pclokos del roma

sckot ( e-mail: )
Sábado 06.03.2010 / 12:35
saludo desde delicias para los pclocos kocha del roma y a toda la jente de la divi y del grangero del chuko sigan graffityando komo siempre nosotros si graffityamos x q lo traemos en la sangre no x lebantar stilos del sckot pclcrew kontrol juarez y chihuahua para q no la kaguen los pinshes mokosos del roma 725crew ay los huacho karnales para dentro d unos meses ya se saben el royo para los pclcrewersota y para los 727 kontrolen toda la cuesta del sckot de los 725 chida bye

( e-mail: )
Sábado 06.03.2010 / 08:27
hola, la verdad no entiendo x k la neseda de echarse unos a otros x k diosito no les yama ni los reconose x sus apodos de gangas apeidos diosito nos quiere a todos x k mejor no mandar un saludo a sus seres queridos k no ven como a mi me encantaria k mis abuelitos supieran cuanto los amo pero el internet no yega asta mi pueblito pero bueno k diosito los bendiga y los cuide a todos

( e-mail: JARUDOTE- )
Sábado 06.03.2010 / 07:04
BAAARRRIOOjaruddddootte(8) LOKOS puutoosss.

YA SABEN putas! ( e-mail: )
Viernes 05.03.2010 / 10:27
ANDAN DICIENDO QE NOS BAN APLASTAR, CON NOSOTROS SE LA AKABARON DE BUSKAAR (8) USTEDES NO TIENEN PAKAS , SIII PARA NOSOTROS SON " PERROS, GATO Y RATAS" ANIMALES QE SE ARRASTRAN POR EL PISOOO, SIENTAN CABRRRRRRRRRONES COMO ME DESLISOO! SI MI FLOW FUERA UN OCEANO USTDS FUERAN PECES JAJAJAJAJA! UPS ESTA BA PA USTDS BABYS¿ SI PA USTDS LOMEROS (: UMMM PRRRRRRRRRAAAH, NOSEAN ENVIDIOSOS ERMANOS SE BEN FEEEEEEEEEEEEOS! bARRIO- JAAAAAAAAA RUUUUUUUDOOOOOOOOOOOOOO LKS YOUKNOW MUTHAFUCKERS .... saben qe no llegan a nuestro nivel jajajaja ustedes pa nosotros no son nadaaa papiiiis shaooooooooooo ai segimooooos siempre, nuestro combooo esta puestote babys!

( e-mail: )
Viernes 05.03.2010 / 09:37
PARA KE KIERES SABER elio ke ME POEEDES ASER PINCHI MOKOSO NIÑA SOY EL KLEN YY KE .. PORKE AYER NO BINIERON ABER DYGAMAN COMO SE KREEEN PRESUMEN . DILE ALA MAMA DE PALOMO KE NO CHINGUE YA WE... OK JAJA BAN A BALIR BERGA UNO POR UNO OK EL KLEN .. I ME LA PELAN ASY DE SIEMPRE JARUDO LOKOS

GARY ONE! ( e-mail: )
Viernes 05.03.2010 / 09:13
ui uii ASTA ME DA MIEDO METERME A ESTA PAGINAAA, PURO CHOLITO WANABIIIIIIIIIIIIII JAJAJAJAJJAAAAA! AUUUSH qe kieren los LOMERITOS¿ pobresitos, dejenlos entrar a jarudo esqe se impresionan ber el pabimento jajajaja! pinches MUGROSOS terrosos me dan askooooooooooooo pinches NAKOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOS bARRIOOOOOOOOOOOOOOOO JARUUUUUUUUUUDOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOO LKS! THEFUCKIN G A R Y ONE MUTHAFUCKER'S

( e-mail: )
Viernes 05.03.2010 / 09:05
miren hijos de la V... nadie los pela pobres P... son kulos salgale uno por uno muy vergas todos juntos aber uno por uno aber sie sierto pinchis chabalas uno solocorre y despues se la gasta de ke le sale mucho cuando andan todos bola de KULOS BARRIO SIETE!

( e-mail: elslaat' JARUDOTE. )
Viernes 05.03.2010 / 06:12
ttuu no le salesss ELIO ala vravvaa wei erss KULO. ASSI kee no tires ttu roio weii mme meto a raiarles en frente de suus caras wei le sale mas la rukaa gedionnda de la eskinaa hahah PENDEJOS.

cholito adn 38 ( e-mail: )
Viernes 05.03.2010 / 03:09
un saludo al adn 38 del roma y a los cvs 38 y a la V... los pcl

HeLiO!pB7! ( e-mail: )
Jueves 04.03.2010 / 15:13
aver sii muii vergas dii qien eres weii! PB7!

frank ( e-mail: chavo_cha@hotmail.com )
Jueves 04.03.2010 / 13:51
ke pedo

sckot ( e-mail: )
Jueves 04.03.2010 / 13:03
kulo tu marika pos si bien saben q la calidad esta d nuestro lado ni le salen ni saben graffitear primero aprendan de latas y de tapas y luego rrayan rrayan como d kinder los 725crew rifan para los konikas d M... asta una rola ya les dedike y cuando quieran bengan para q huachen la kalidad del sckotonersotototottestar soludos al ysto al kondor al grate al nicklo el sprock el lemonsk el weat y a todos los pclocos de la divi y los 725 del grangero pcl los kocha pinshis kanikas kulos.

ARVIZU ( e-mail: arvvizuzarazua@hotmail.com )
Jueves 04.03.2010 / 11:25
ARRIVA LA PRM MEXICLES.esos putos jotos d los azcacas no traen nada.miran un borracho y c mean d miedo.aqui rifa puro PRM

JARUDO LOKOTESSSS ( e-mail: )
Jueves 04.03.2010 / 08:29
hahaha MIREN LOMERITO .. SE ANDANDAN METIIENDO EN EL BARRIOO SYGAN ACIENDOLO JAJA AKABO .. KE SIRBE ENTRAN EN RAFLA YY NOSOTROS CAMINANDO LO KE USTEDES LE TIEMBLA NOMAS AMARRESEN LA JENY YA NOS DIJO AKIORAS BIENEN BOLAS DE PENDEJOS JAAJAJAJAJJA ALAS 10:30 ESTAN AAKI OK .. AY LOS ESPERAMOS AORA SY LO PODEMOS CUETIAR AYAR IBA NO PODIAMOS PERO YA IJOS DE PERRA .. COMO ESPERE ESTE MOMENTO . JAJAJAAJ BAN A BALIR BERGA JARUDO LOKOS PUTOSSSS BIEN LO SABEN IJOS DE PERRA KE EL JARUDO RIFA TU PINCHI BARRIO

( e-mail: losss MAMO. )
Jueves 04.03.2010 / 05:59
BAARIOJARUDOTELOKOSS!

( e-mail: )
Miércoles 03.03.2010 / 11:35
BARRIO SIETE!

el ckEr y el soE... ak47 ( e-mail: )
Miércoles 03.03.2010 / 05:42
saludos alos compas.. V... alos entrados.. !!

el ckEr ( e-mail: )
Miércoles 03.03.2010 / 05:38
ak47 ak47 ak47 ak47 ak47 ak47 ak47

cholito adn 38 ( e-mail: )
Martes 02.03.2010 / 07:59
un saludo de su gente para su gente del cholito del adn 38........cvs 38 controlando el roma

( e-mail: JUAREZ )
Lunes 01.03.2010 / 13:31
aarree arrreeeee JUARITOSSS kontrolanndddoo piinncchiisss BASTARDOSSS

LA LINEA ( e-mail: CD JUAREZ )
Lunes 01.03.2010 / 13:14
Y PARA LOS PANDILLEROS DEFIENDAN ASU TIERRA JUARENZE NO SE PONGAN EN CONTRA NO SEAN PENDEJOS EL MONTA PERROS SOLO LOS USA PARA DESECHARLOS MIREN ALOS JOVENES ACRIBILLADOS EN SALVARCAR YA MEJOR UNANSE POR JUAREZ PA DARLES EN SU MADRE A ESOS PINCHES SINALOENSES DE MIERDA USTEDES SON NACIDOS EN JUAREZ. NO SE PONGAN EN CONTRA

LA LINEA! ( e-mail: CARTEL DE JUAREZ! )
Lunes 01.03.2010 / 13:11
YA ALA CHINGADA CON USTEDES PINCHES SINALOENSES DE MIERDA EY..MONTA PERROS MEJOR APODADO COMO EL CHAPO YA SACA ATU PINCHE JENTE DE JUAREZ Y YA DEJA DE IMBOLUCRAR INOCENTES EN TUS ACTOS DE BASTARDOS O QUIERES QUE TE VOLVAMOS A AMASACRAR ATUS DOBLADITOS O ATUS MEXICLES EN EL CERESO TENEMOS EL CONTROL AZTECAS BRAZO ARMADO DEL CARTEL DE JUAREZ!YA SALE A TERRENO PARA DARNOS EN LA MADRE NO SEAS CULO NI ECHES ATUS PINCHES SOLDADOS CAGADOS QUE NO PUEDES SOLO PINCHE CULON NEZEZITAS DE SOLDADOS PINCHE ENANO MARIKON!! ATTE: LA LINEA!DE EL DIEGO

cholito adn 38 ( e-mail: )
Lunes 01.03.2010 / 04:40
el cholito del adn 38 se los cocha el adn 38 controlando p....pcl....culotes

ADN 38 ( e-mail: )
Lunes 01.03.2010 / 04:37
culo el sckot

skoR! ONE ( e-mail: )
Lunes 01.03.2010 / 02:45
AJAJA KE TRAY EL SKOT KUAAL PINCHE CHAVALEASTES A KIEN ME ESTAS DISIENDO AMI EL SKOR ??? PORKE YO EN MI PUTA VIDA TE E VISTO Y NUNKA ME LE E KULIAADO A NADYEN DIME KIEN VERGAS ERES PUTO!!ATTE:EL SKOR

CHOLITO adn 38 ( e-mail: )
Domingo 28.02.2010 / 10:28
UN SALUDO A TODOS LOS ADN 38 DE PARTE DEL CHOLITO RIFANDO Y CONTROLANDO CUANDO KIERAN CULOS PCL

CHOLITO adn 38 ( e-mail: )
Domingo 28.02.2010 / 10:25
NI MADRES CULO NOS TIENEN MIEDO PAR DE WUEYES Y SOMOS ADN 38 Y CUANDO KIERAS AY VAMOS A ESTAR PCL CUUUUUULOTES ADN 38 SE LOS COCHA EL CHOLITO R...Y SE LOS C...A LA VERGA LOS PCL=725

sckot ( e-mail: )
Sábado 27.02.2010 / 18:56
mira P... no le tiembio kon el burro llego asta agachado pues lo ice de aguas una vez no se quiso bailar. pero no memes eras tu y 2 vatos y yo te cay solo y no kisiste tus compas tan culotototes le siguieron caminando hasta el taweck solo los baila culotes 725crew saludos a los pcl desde parral de rrato les caigo pinshes kanikas culos para my siempre ban a ser kanikas bola de jotos PCLOCOS CREW LOS KOSHA STILSCKOT DE LA 725CREWWWWWWWERSOTOTESTARKINSOTER

skoR!ONe BjLcK!hPl! ( e-mail: )
Sábado 27.02.2010 / 12:36
EEH NO MAMEN KIEN ES SKOT I PORKE SE ESTA PIRATIANDO MI APODO!!!!!!!!!!!!!!

( e-mail: JARUDOTE. )
Viernes 26.02.2010 / 14:59
hahahaha IJO de tuu puuttaa madreee komooo llorabbas weii JAJA kuannddoo te atropellamoss weii hahahahaha pinncchi INVESIL ijo de la vergha tee voi a serraar el osiiko qq tiieennes weiii pinncchii RENGOO IJO DE PUTA.iooo mme mettooo a raiaarless en su puuttaa CARA pendeejoo i ME CAII ke le sale mmas la rukkaa roñosaa de la esskinnaa WEII hahahahhaha pincchii JODIDOSS idioottas.

axerone ( e-mail: )
Viernes 26.02.2010 / 14:35
jajaj y segun ustede los del siete ya no somos nadie no mamen todos los dias les entramos a su barrio y ni cuenta se dan P... preguntale al pinchi ivalido del pancho jajaj en el siete somos un H... o nomas ke ya nadie les hace caso mejor los tiramos al leon xk nomas la hacen de pedo y salen corriendo mejor nos evitamos gastar energias neta bien saben ke el barrio siete 727 los kocha pinchis babys ate el axerone y no mame no estoi cojo P... 727 727 727 727 los kocha jajaja ya mejor no la cagen xk les vamos a venir matando otro pinci mokoso weyes eske la neta ya nos dan lastima P... bie

axerone727@hotmail.com ( e-mail: )
Viernes 26.02.2010 / 14:31
jajaja pinchis jarudos neta asta dan risa son puros pinchis babys y dicen ke segun ellos entran al barrio jajaj no mamen nomas entran en la primer calle P... donde ni hay nadie weyes y eso de ke enfierrando cueteando atropellando no mamen ni ustedes se la cren jajaja

HeLiO!pB7! ( e-mail: )
Viernes 26.02.2010 / 12:05
jajaja BARRIO SIETE!! aunque les qaLe putOs!

( e-mail: JARUDOTE )
Viernes 26.02.2010 / 05:42
hahahahahahahahahahahahahahaha KOMO ME DASS RISA PINCHI NIÑA PENDJa

TU MADRE ( e-mail: )
Viernes 26.02.2010 / 03:53
PINCHE EDER DE MIERDA TU AMAS A ANILENE Y ES EL AMOR DE TU VIDA NO TE AGAS GUEY.....

HeLiO!pB7! ( e-mail: )
Viernes 26.02.2010 / 03:46
jajaja sii muii vergas dii qien eres ii arre quLo!! si bn saben todos q me la peLan!! BARRIO SIETE LOQOTES!!

( e-mail: JARUDOTE )
Viernes 26.02.2010 / 02:09
pinchi LEPE no ersssNADA weii ers unaa caca pinncchi VOZ deee niña toddooss TE SAKAAN por lo abladorrr ke ersss weii por otraa KOSA NAAA.-haha penddeJO.°

HeLiO!pB7! ( e-mail: )
Jueves 25.02.2010 / 14:26
jajaja simOn weii pero me la pelas BARRIO SIETE!

cholito adn 38 ( e-mail: )
Jueves 25.02.2010 / 13:04
Y APARTE NO ERAN 6 ERA TODO TU BARRIO PARA KE DISES KE NO NI LE SALTA POR KE NO DIJISTE NADA CUANDO FUIMOS POR KE LE TIENES MIEDO AL BURRO ADN 38 RF....

ADN 38 ( e-mail: )
Jueves 25.02.2010 / 13:01
A KE HORAS EMPESE A TEMBLAR,USTEDES NOMAS ME AGARAN CUANDO VOY SOLO PENDEJO Y COMO LES DIJE TENGO 10 AÑOS PERO LR SALTO MAS KE TU Y TU BARRIO LOS ADN 38 CONTROLANDO Y SIGE SECRIBIENDO TUS MAMADAS KE NI SALES EL CHOLITO C...

SCKOT ( e-mail: )
Jueves 25.02.2010 / 11:45
MIRA PENDEJOTE CULOS USTEDES X Q FUERON TODA LA 8 Y NO ISIERON NADA Y NOSOTROS ERAMOS 6 NOSOTROS ESTAMOS MAS LEVANTADOS AL 100 Y SI LE SALES X Q LE TEMBLASTE CON MIGO O AL SPROCK A USTEDES NOMAS LOS CONOCE LA 8 SI ESO ES ESTAR LEVANTADO IMAGINATE NOSOTROS ESTAMOS MAS LEVANTADOS A NOSOTROS NOS CONOCEN TODOS ASTA VARIOS DE USTEDES FUERON DE NOSOTROS Y BIEN SANBEN COMO EL SNEY Y VARIOS ASTA NOS LEVANTARON Y BIES SABEN COMO LOS ASIAMOS DE AGUA ANTES Y AHORA PEOR NOMAS PARA Q SE LA HUACHEN CON LOS PCLCHE ME SACAS PENDEJO 725 CREW KONTROLANDO

SKER ( e-mail: OMER_SEMOSVURROS@HOTMAIL.COM )
Jueves 25.02.2010 / 09:40
SKER SGK SKER SGK SKER SGK SKER SGK SKER SGK SKER SGK SKER SGK SKER SGK SKER SGK FUCK SIDE ONES SKOBEDO SENECU SGCK LOS PRIMEROS RIFA GRAFF

skerone ( e-mail: omer_semosvurros@hotmail.com )
Jueves 25.02.2010 / 09:36
qe tranza aqi les dejo mi firma soi el sker de los SGCK FUCK SIDE 11 DE LA SKOBEDO.

( e-mail: JARUDOTE! )
Jueves 25.02.2010 / 07:35
ttukkeeee? PINCCHI voozzzz dee pittooo metaaseeee a BAÑAR ijooo de la verghaaaa. HAHAHA

HeLiO!pB7! ( e-mail: BARRIO SIETE! )
Jueves 25.02.2010 / 04:38
BARRIO SIETE!!

( e-mail: B.J.L. )
Jueves 25.02.2010 / 03:37
PURO JARUDOTE LOKOS controlando la cuesta y k putos...atoda madre o un desmadre.salganke culos .....

( e-mail: JARUDO )
Jueves 25.02.2010 / 03:34
BAAAAAAARRRRRRRRRRRIIIIIIIIIOOOOOOOOOO...........JAAAAAAARRRRRRRRUUUUUUUDDDDDDDDDOOOOOO............LOOOOOOOKKKKKKKKKOOOOOOOOOSSSSSSSSSSS...........

ADN 38 ( e-mail: )
Jueves 25.02.2010 / 03:18
pan con mecos ke risa son culos los pan con leche no valen verga

cholito adn 38 ( e-mail: )
Jueves 25.02.2010 / 03:14
simon simon tengo 10 años pero le salgo mas ke ustedes y si me van a maranear pues maranenme para ver como les va y lo ke esta sonando aorita son el adn 38 los pcl ya pasaron ya no valen V... el cholito del adn 38 r... putos

( e-mail: pan y mekos )
Jueves 25.02.2010 / 03:13
pinchis mokosos P... k es eso de pan con mecos o k . ala V... putos cambien de nombre no sean P... dan risa mejor no pongan nada pinchis pan y vino o k.sorry.me rei un putal cuando oi su nombre cagodo.c pasan d vergas neta

ADN 38 ( e-mail: )
Jueves 25.02.2010 / 03:09
y por ke no le dijiste al burro cuando fuimos a su barriesillo si ay estaba tu barrio por ke ninguno le salto por culos nomas por le les tachamos su pinche muralsillo fuimos todos los adn 38 para ke sepas,y son bien culos por ke me agaran solo eee por ke cuando voy con mi gente no pendejos, adn 38 se los cocha

( e-mail: B.JARUDOTE.LKS )
Jueves 25.02.2010 / 03:09
ora chido PELONES 1 aver cuando les caemos paser un desmadre chidote..JARUDO LOKOS

( e-mail: pelonsotees uno )
Miércoles 24.02.2010 / 15:32
los pelones uno un saludo alos jarudo ya se la saven los ke rifan bp1 y bjl

sckot ( e-mail: )
Miércoles 24.02.2010 / 15:27
mira pentedejo no es barrio y los pan con leche estamos mas lebatados q ustedes yo doy clases de graff para q no rallen tan C... rallo mejor kon los pies y ustedes q no se acuedan de su barriesillo kk kanikas q es eso si eres un mocoso de 10 años qieres bailar al sprock y ni la cuajas valen pura vergota y no entiedes q ya le cambien x eso estan como estan

ADN 38 ( e-mail: )
Miércoles 24.02.2010 / 04:10
A TAMBIEN UN SALUDOTE A LA JENTE DE LA ADN 38, AL LOW,SNEY,DILO'C,DREAM,ARES,GARY,DICK, Y A LOS DE LA 8 SLOCKER,FOSTER,FLEX,LOSNY,TRANE,DIDO,DOSER,POYO Y A LOS CVS 38 DE PARTE DEL CHOLITO DE LA ADN 38

ADN 38 ( e-mail: )
Miércoles 24.02.2010 / 04:05
JA JA JA...NO NOS AGAN REIR PENDEJOS NI SE BURLEN KE SU PINCHE BARRIO ESTA BIEN CULERO PAN CON LECHE KE SON ESAS MAMADAS, ESTE SI ES UN BARRIO AHORA DOMINAMOS NOSOTROS 38 NO PENDEJADAS COMO LAS SUYAS LOS ADN 38 DEL ROMA C...POCOS PERO LOCOS A LA VERGA LOS PCL...C....

( e-mail: dsd )
Miércoles 24.02.2010 / 02:13
puro Barrio Jarudo Lokos

sckot ( e-mail: )
Miércoles 24.02.2010 / 02:10
no mamen ya cambienle pcl culos ya dan risa adn kosha no mamen kuleros primero aprendan a graffitiar rayan pala bergaaaaa y pongan apodo no sean kulotes. un saludo al snoopy,fasty,sprock,weat,,nicklo,isto,tawek,sonik neo,fomek y los q me faltan pcleche crew.desde cuauhtemoc

( e-mail: ONEQKONE''S )
Martes 23.02.2010 / 16:25
UN SALUDEEIIOOP PA MES QOMPEYYAS EL MIQKE'KUSHO'DISER'SOME'BETHO'ILOS Q FALTHAN DEL LA ds..

( e-mail: JARUDOTE- )
Martes 23.02.2010 / 13:40
chinngggeee asuu MADREE USTEDD WEI

ADN 38 ( e-mail: )
Martes 23.02.2010 / 12:50
ADN 38 CONTROLANDO CHOLITO R.... AHORA DOMINAMOS NOSOTROS 38

( e-mail: JARUDOTE- )
Martes 23.02.2010 / 07:14
hahahahah ssii no puueddeeenn KON nosotroosss pinnchi VOZ de niññaa komo konn otrss weiies JAJAJAJA! pinchisss MEKOS!

( e-mail: HeLiO!pb7! )
Lunes 22.02.2010 / 22:49
soy el HeLiO y el fioner del barrio siete y me La peLan Los de La Linea !! hahahaha si muchos webos caiganLe al carteL del barrio siete !!

ADN 38 ( e-mail: )
Lunes 22.02.2010 / 11:51
ADN 38 SE LOS COCHA EL CHOLITO RIFA PUTOS

( e-mail: )
Lunes 22.02.2010 / 06:50
altiro con las M... k ponen pinchis chavillos,novaya ser ke se los carge la verga.si tienen huevos metanse a lo grande a defender su ciudad.va a ver un reclutamiento pa los k se cren cabrones a demostrarlo como escuadrones

el doser del adn ( e-mail: )
Lunes 22.02.2010 / 04:54
un saludote para mis carnales del adn y el burro C... ke se llevo mi camara a mexico el hijo de perra el adn 38 cocha AHORA DOMINAMOS NOSOTROS 38

hbo ( e-mail: )
Lunes 22.02.2010 / 04:01
pinches jarudos no la pelan weies hbo los cochan putosylos ak

hbok locos ( e-mail: )
Lunes 22.02.2010 / 03:57
na pos pinches cnc son culotes y nomas asta asiç hbo los cocha

AK47 ( e-mail: )
Lunes 22.02.2010 / 02:34
AK47..CREW!! AK47..CREW!! AK47..CREW!! AK47..CREW!! AK47..CREW!! AK47..CREW!! AK47..CREW!! AK47..CREW!! AK47..CREW!! AK47..CREW!! AK47..CREW!! AK47..CREW!! AK47..CREW!! AK47..CREW!! AK47..CREW!! AK47..CREW!! AK47..CREW!! AK47..CREW!! AK47..CREW!! AK47..CREW!! AK47..CREW!! AK47..CREW!! AK47..CREW!! AK47..CREW!!

AK47 ( e-mail: )
Lunes 22.02.2010 / 02:30
AerOsoles KinGs.. !! AerOsoles KinGs.. !! AerOsoles KinGs.. !! AerOsoles KinGs.. !! AerOsoles KinGs.. !! AerOsoles KinGs.. !! AerOsoles KinGs.. !! AerOsoles KinGs.. !! AerOsoles KinGs.. !! AerOsoles KinGs.. !! AerOsoles KinGs.. !! AerOsoles KinGs.. !! AerOsoles KinGs.. !! AerOsoles KinGs.. !! AerOsoles KinGs.. !! AerOsoles KinGs.. !! AerOsoles KinGs.. !! AerOsoles KinGs.. !! AerOsoles KinGs.. !! AerOsoles KinGs.. !! AerOsoles KinGs.. !! AerOsoles KinGs.. !! AerOsoles KinGs.. !! AerOsoles KinGs.. !! AerOsoles KinGs.. !! AerOsoles KinGs.. !! AerOsoles KinGs.. !! AerOsoles KinGs.. !! AerOsoles KinGs.. !! AerOsoles KinGs.. !! AerOsoles KinGs.. !! AerOsoles KinGs.. !! AerOsoles KinGs.. !! AerOsoles KinGs.. !! AerOsoles KinGs.. !! AerOsoles KinGs.. !! AerOsoles KinGs.. !! AerOsoles KinGs.. !! AerOsoles KinGs.. !! Ae

acgg! ( e-mail: )
Domingo 21.02.2010 / 15:26
sanTANITAAAA LOKOSSS! ACg es el sello ke yebamosss ai tamoss mi warerr !

warERoNEE! ( e-mail: )
Domingo 21.02.2010 / 15:19
ME PELANN LAAA VERGA CULOSS LA CUESTA LOKOSS ACG EL WARerONEEEMIJASS

ADN 38 ( e-mail: )
Domingo 21.02.2010 / 11:20
ADN 38 LEVANTANDOSE EN TOTO LO ALTO DE JUARITOS LOS PCL=725 CULOTES

( e-mail: rpssCREW! )
Domingo 21.02.2010 / 09:40
BLABLABLA- JARUDDOTEELOKOS KONTROLANDO LA CUESTOTAAA LOKOTTTAAA PUUTTOS.

ADN 38 ( e-mail: )
Domingo 21.02.2010 / 04:23
YA NO SOMOS CANICAS SOMOS ADN 38 APRENDANSELO POR QUE SON LOS KE LOS VAN A VARER A TODOS LOS PCL=BARRIO CULO

ADN 38 ( e-mail: )
Domingo 21.02.2010 / 04:20
jajajaja se los cochan los adn 38 ay estamos puestotes pues caiganle cuuuuuuuuuuuulos pcl

ADN 38 ( e-mail: )
Domingo 21.02.2010 / 04:15
SIGANSE LEVANTANDO PERO DE RATO VAN A VALIR VERGA EEEE PUTOS 725 CUUUUUUUUUUULOTES ADN 38 CONTROLA

ADN 38 ( e-mail: )
Domingo 21.02.2010 / 04:11
NOMAMEN NOMAMEN USTEDES NI LE SALEN PINCHES COLOS NO IMPORTA KE SEAN MAS EN EL ROMA PERO BAYAN A LA ESCULIN 8 PARA VER COMO LES VA DE RATO PUTOS A LA VERGA LOS PCL=725 NO LA PELAN PUTOS EL ADN 38 CONTROLANDO SOMOS POCOS PERO LOCOS,AHORA DOMINAMOS NOSOTROS 38

Cesar ( e-mail: )
Sábado 20.02.2010 / 16:49
Que tal putos arriba las chivas van 7 al hilo y como siempre barrio londres de la 31 de chihuahua los mas H... ones juntos con el 725 de juarez putos

gabo ( e-mail: )
Sábado 20.02.2010 / 16:44
arribbba las chivas y arriba el norte de la 725 apooco no locos el gabooooo!!!!!!!!!!!!!!!

sckot ( e-mail: )
Sábado 20.02.2010 / 16:40
un saludo desde camargo del sckot alos pcl de todo juarez los kocha de rato los huacho sigan grifiando y fifando ya se la saben dentro d 2 meses los imbito a pistiar

ESCKOTONER ( e-mail: )
Sábado 20.02.2010 / 16:23
Y UNSALUDO PARA LOS PAN CON LECHE DE LA DIVI PARA EL ESMO Y TODOS

( e-mail: )
Sábado 20.02.2010 / 16:19
UN SALUDO PARA LOS 725 D LAS CRUCES AL ISTONERSOTOTOTOTOTOTOTOTOTOTOTOTOTOTE PARA Q SIGA GRAFFITIANDO TODO LAS CRUCES

SCKOT ( e-mail: )
Sábado 20.02.2010 / 16:16
UN SALUDO A LOS 727 D LA CUESTA PARA Q SE ACUEDEN D LOS 725 DE LAS TORRES 725 LOS KOCHA PARA Q SE GUACHEN LAKALIDAD D LOS 725CREW

SCKOT ( e-mail: )
Sábado 20.02.2010 / 16:12
USTEDES NI SALEN D LA 8 NI D EL PARQ SE QUIEREN LEBANTAR Y NI LE SALEN PICHES MARIKONES TODOS LOS D LOS KANIKAS DE LA 8 SON CULONES PARA LOS 725ONERSOTOTOSTARKIGSOTES

el DAFE ( e-mail: )
Sábado 20.02.2010 / 16:11
SOY EL DAFE DELOS WEST SIDE KILLER 77 DEL ROMA PS AKI DEJANDO MI PLACA Y UN SALUDOTE PARA MI PRIMO EL ANDY DELO PCL CREW BUENO AINOS WACHAMOS PUTOS DE RATO Y PUROS WEST SIDE KILLER 77 PUTOSS

SCKOT ( e-mail: )
Sábado 20.02.2010 / 16:03
BIEN SABEN Q D 1 X 1 NO LA ARMAN PINCHES CULOS PCL CREW LOS KOCHA EL WEAT EL SPROCK EL FASTY Y EL ESCKOTYONERSOTOTOTOTOTOTOTESTAR

HeLiO!pb7! ( e-mail: )
Sábado 20.02.2010 / 14:33
simOn lo q digan weies jaja BARRIO SIETE se los QOSHA!

astaaalaMUERTE! ( e-mail: BJL )
Sábado 20.02.2010 / 14:03
RPS*¨CREEW'RPS*¨CREEW'RPS*¨CREEW'RPS*¨CREEW' RPS*¨CREEW'RPS*¨CREEW'RPS*¨CREEW'RPS*¨CREEW' RPS*¨CREEW'RPS*¨CREEW'RPS*¨CREEW'RPS*¨CREEW' RPS*¨CREEW'RPS*¨CREEW'RPS*¨CREEW'RPS*¨CREEW' RPS*¨CREEW'RPS*¨CREEW'RPS*¨CREEW'RPS*¨CREEW' RPS*¨CREEW'RPS*¨CREEW'RPS*¨CREEW'RPS*¨CREEW' RPS*¨CREEW'RPS*¨CREEW'RPS*¨CREEW'RPS*¨CREEW' RPS*¨CREEW'RPS*¨CREEW'RPS*¨CREEW'RPS*¨CREEW' RPS*¨CREEW'RPS*¨CREEW'RPS*¨CREEW'RPS*¨CREEW' RPS*¨CREEW'RPS*¨CREEW'RPS*¨CREEW'RPS*¨CREEW' RPS*¨CREEW'RPS*¨CREEW'RPS*¨CREEW'RPS*¨CREEW' RPS*¨CREEW'RPS*¨CREEW'RPS*¨CREEW'RPS*¨CREEW' RPS*¨CREEW'RPS*¨CREEW'RPS*¨CREEW'RPS*¨CREEW' RPS*¨CREEW'RPS*¨CREEW'RPS*¨CREEW'RPS*¨CREEW' RPS*¨CREEW'RPS*¨CREEW'RPS*¨CREEW'RPS*¨CREEW'RPS*¨CREEW'RPS*¨CREEW'RPS*¨CREEW'RPS*¨CREEW'RPS*¨CREEW'

ADN 38 ( e-mail: )
Sábado 20.02.2010 / 10:34
BLA BLA BLA,NOMAMEN KE CONTROLAN NISIKIERA SALEN DE SU CUADRA PAR DE WUEYES, PCL CUUUUUUUUULOTES=725,NO LA PELAN CUANDO KIERAN NOMAS CAIGANLE PUTOS AY ESTAMOS PUESTOTES,ADN 38=AHORA DOMINAMOS NOSOTROS 38 Y NOS VAMOS A SEGIR LEVANTANDO ASTA DONDE KERAMOS PUTOS

( e-mail: jarudoteeLOOKOS! )
Sábado 20.02.2010 / 09:05
RPS*¨CREEW'RPS*¨CREEW'RPS*¨CREEW'RPS*¨CREEW' RPS*¨CREEW'RPS*¨CREEW'RPS*¨CREEW'RPS*¨CREEW' RPS*¨CREEW'RPS*¨CREEW'RPS*¨CREEW'RPS*¨CREEW' RPS*¨CREEW'RPS*¨CREEW'RPS*¨CREEW'RPS*¨CREEW' RPS*¨CREEW'RPS*¨CREEW'RPS*¨CREEW'RPS*¨CREEW' RPS*¨CREEW'RPS*¨CREEW'RPS*¨CREEW'RPS*¨CREEW' RPS*¨CREEW'RPS*¨CREEW'RPS*¨CREEW'RPS*¨CREEW' RPS*¨CREEW'RPS*¨CREEW'RPS*¨CREEW'RPS*¨CREEW' RPS*¨CREEW'RPS*¨CREEW'RPS*¨CREEW'RPS*¨CREEW' RPS*¨CREEW'RPS*¨CREEW'RPS*¨CREEW'RPS*¨CREEW' RPS*¨CREEW'RPS*¨CREEW'RPS*¨CREEW'RPS*¨CREEW' RPS*¨CREEW'RPS*¨CREEW'RPS*¨CREEW'RPS*¨CREEW' RPS*¨CREEW'RPS*¨CREEW'RPS*¨CREEW'RPS*¨CREEW'

sckot ( e-mail: )
Sábado 20.02.2010 / 08:18
725 dominando las calles de juarez no como los adn solo ablan y no pintan ni se suenan y ay se andan dando fama falsa zZz atte hak hard cores art chiwas graff

raacK ( e-mail: raacK_ABC )
Sábado 20.02.2010 / 04:43
ee pinche gato no estes mamando wey ke no noams porke estes mas longo kle yo y ke unos k otros pienses keke kna no save ke pinche kolor se karga la trifulka we mejor dele leveraund we esas M... son de morriyyos las cosas se dicen en la cara we

b jarudo loko ( e-mail: ptks 13 )
Viernes 19.02.2010 / 14:13
los del siete k simpre kon la misma ropa k no mamen de rato les mando una despensa pinche jodidos komo me da risa la pinche gente jodida tan P... jajajjajajajajja

ADN 38 ( e-mail: )
Viernes 19.02.2010 / 12:36
EL CHOLITO DE LOS ADN 38 CONTROLANDO

ɢαтнчCк•вʟαCк•σɴєss! ( e-mail: ɴɢŁк™•вктα sυг•σɴєs! )
Viernes 19.02.2010 / 07:29
cke tranza lockos un saludo pa los homithos cke no nos dejan morir jaa! i un saludosky pa los grafer's jaa! ora pz pongansen vergas los badboys i los ycw van a valir V... weyess!!!!

chuy ( e-mail: culos )
Viernes 19.02.2010 / 04:15
e no mamen con sus pinchis M... esas se dan abajo pongancen a trabajar putos soy el clow de los terrenos 13 de la heroes de la rev. putas de M... muerance todos el clow rifa y controlan terrenos 13,pbt13 RW el sock frow owel owner rifan unidotes chida acuerdencen que los terrenos son los mas pesados de cd juarez

el clow ( e-mail: )
Viernes 19.02.2010 / 04:10
los terrenos 13 el clow rifa y controla la heroes de la rev.

( e-mail: DSD!!BJL!!ONES!! )
Viernes 19.02.2010 / 02:55
ayva el saludote pa los jarudos lokos dsd!!!!!656 gente navegando!!!! arre homies firmes

ADN 38 ( e-mail: )
Viernes 19.02.2010 / 02:43
adn 38 controlando

CANGRYS CREEW ( e-mail: jarudo yesk cangry creew )
Jueves 18.02.2010 / 21:03
Qee nadiee le manda saludo aloos cangry crew del jarudo no ps io me mandare solo un saludo para los cangri del jarudo att yesk los amoo rps lbp gsp DSD tps13 y ptks 13 de jarudo ii un saludoo para el snafodonga de la rps

( e-mail: JARUDOTE! )
Jueves 18.02.2010 / 11:40
RPS'CREEW*RPS'CREEW*RPS'CREEW*RPS'CREEW*RPS'CREEW*RPS'CREEW*RPS'CREEW*RPS'CREEW*RPS'CREEW*RPS'CREEW*RPS'CREEW*RPS'CREEW*RPS'CREEW*RPS'CREEW*RPS'CREEW*RPS'CREEW*RPS'CREEW*RPS'CREEW*RPS'CREEW*RPS'CREEW*RPS'CREEW*RPS'CREEW*RPS'CREEW*RPS'CREEW*RPS'CREEW*RPS'CREEW*RPS'CREEW*RPS'CREEW*RPS'CREEW*RPS'CREEW*RPS'CREEW*RPS'CREEW*RPS'CREEW*RPS'CREEW*RPS'CREEW*RPS'CREEW*RPS'CREEW*RPS'CREEW*RPS'CREEW*RPS'CREEW*RPS'CREEW*RPS'CREEW*RPS'CREEW*RPS'CREEW*RPS'CREEW*RPS'CREEW*RPS'CREEW*RPS'CREEW*RPS'CREEW*RPS'CREEW*RPS'CREEW*RPS'CREEW*RPS'CREEW*RPS'CREEW*RPS'CREEW*RPS'CREEW*RPS'CREEW*RPS'CREEW*RPS'CREEW*RPS'CREEW*RPS'CREEW*RPS'CREEW*RPS'CREEW*RPS'CREEW*RPS'CREEW*RPS'CREEW*RPS'CREEW*RPS'CREEW*RPS'CREEW*RPS'CREEW*RPS'CREEW*RPS'CREEW*RPS'CREEW*RPS'CREEW*RPS'CREEW*RPS'CREEW*RPS'CREEW*RPS'CREEW*RPS'CREEW*RPS'CREEW*RPS'CREEW*RPS'CREEW*RPS'CREEW*RPS'CREEW*RPS'CREEW*RPS'CREEW*RPS'CREEW*RPS'CREEW*RPS'CREEW*RPS'CREEW*RPS'CREEW*RPS'CREEW*RPS'CREEW*RPS'CREEW*RPS'CREEW*RPS'CREEW*RPS'CREEW*RPS'CREEW*RPS'CREEW*RPS'CREEW*

( e-mail: )
Jueves 18.02.2010 / 11:35
ERREPESE'CREEW. JARUDOTELOKOS! saludoss.: DASER.WOSK.SKIT.SLAT'.SPEK.SNAF.EFIK.SORK.STYK.

AURORA ( e-mail: )
Jueves 18.02.2010 / 10:28
TE AMO CHOLITO ERES EL AMOR DE MI VIDA

doser y el foster ( e-mail: )
Jueves 18.02.2010 / 10:24
pinches pobres de M... no la pelan desgraciados hijos de perra AHORA DOMINAMOS NOSOTROS 38 DOSER FOSTER LOW SNEY SLOCKER FOWER DILOOCK ASTER GARY DREAM ARES DIDO DUCKER TRANE LOSNI

( e-mail: )
Jueves 18.02.2010 / 04:11
k royo pinchis lomeros culos a la V... pinchis cucarachos de M... del 7 pinchis vatitos culos

ADN 38 ( e-mail: )
Jueves 18.02.2010 / 02:57
P=PUROS C=CULOS L=LOCOS=PCL 725 A LA VERGA PUTOS

ADN 38 ( e-mail: )
Jueves 18.02.2010 / 02:54
ADN 38 CONTROLANDO,CUANDO KIERAN PUTOS AKI ESTAMOS PUSETOTES PCL CULOS,NO VALEN VERGA,AHORA DOMINAMOS NOSOTROS 38,725 NO LA PELAN CUUUUUUUUUUUUUUUUULOS

JaRUdoOo ( e-mail: DrAk )
Miércoles 17.02.2010 / 17:04
ke rollo putos el jarudo rifando y controlando BJL EL DRAK SE LOS COCHA UN SALUDO para el LADO BAJO PELIGROSO .

risas ( e-mail: cnds 12 )
Miércoles 17.02.2010 / 17:00
ke tranza putos el risass de los condes 12 cocha

HeLiO!pB7! ( e-mail: )
Miércoles 17.02.2010 / 16:08
duuuu!! jaja pinshee meqO, BARRIO SIETE QOSHA!

( e-mail: adonde no llegaran )
Miércoles 17.02.2010 / 14:43
KE H... geen assuuu MADRE loss KE noo se vañññaann ( abber si no le caiiii el sako alooss DEL 7) JAJAJAJA! pinnchiss roñossoos

sckot ( e-mail: )
Miércoles 17.02.2010 / 13:35
dominaran en su casa peropero roma no a de asco d de dan lastima y n de no valen V... pcl saludo a los 727 y a los 725 siga rrapeando my weat y sigue de loco sprock

angel ( e-mail: )
Miércoles 17.02.2010 / 09:18
H... en asu madre todos los barrios de juarez y mas los del jarudo puro punetas puros karnales ese

( e-mail: ABL )
Miércoles 17.02.2010 / 01:39
un saludo a los del jarudo.conosco a 2 k 3s de ace anos k kayeron al tribilin el kem,el chato y al momia camaradas chidos k le salen x su barrio. aber si nos volvemos a guashar de rato cabrones.desde la ALTA VISTA LOKOS EL CESARONE!!!

ADN 38 ( e-mail: )
Martes 16.02.2010 / 12:22
A LA VERGA LOS PCL PINCHE BARRIO CAGADO,ADN 38 CONTROLANDO PUTOS LE GUSTE A QUIEN LE GUSTE, AHORA DOMINAMOS NOSOTROS 38 DEL ROMA, PCL=725 CUUUUUUUUUUUUUULOTES

sckot ( e-mail: )
Martes 16.02.2010 / 11:53
H... en a su madre los adnacos y un saludo alos 725crew y los 727 roma y alos pcl dela divilocotes rifan esckotonersotestar.

( e-mail: )
Martes 16.02.2010 / 07:59
A MI ME ENKANTA EL FIONER DEL BARRIO 7 TAS BN WENO MIJO SI LEES ESTO YAMAME 2027795

clow ( e-mail: )
Martes 16.02.2010 / 02:49
el clow de los terrenos 13 cochan de la heroes de la rvolucion putos trns13

SUENOKER ( e-mail: SUENOkerone )
Lunes 15.02.2010 / 11:44
el unico barrio mas H... on es SWK SOUTH SIDE LOCOS el SUEÑOKER rifa putos

( e-mail: )
Domingo 14.02.2010 / 04:15
NO POES BIEN LO SABE LO KE RIFA Y ESTA DE MODA Y KE TODOS HABLAN Y KE ES EL KE RIFA KLARO EL JARUDO EL BJL .. BIEN LO SABEN PUTOS ... RIFA Y CONTROLA SIEMPRE DONDE BALLLA APOKO NO SE LO EMOS DESMOTRADOS BOLA DE CULOS ...

ADN 38 ( e-mail: )
Sábado 13.02.2010 / 12:38
ADN 38 SE LOS COCHA

jairo ( e-mail: Jsomer2008@hotmail.com )
Viernes 12.02.2010 / 03:14
jajaja graffiti a qui cas nadie ase ai q aser una pinta myspa Jsomer2008@hotm aver si se ase atte kfc crew

skoR! FREDY! ( e-mail: HACIENDAS14.JL! )
Viernes 12.02.2010 / 02:28
K ROIOO PS AKI NAMAS REPORTANDOSE EL SKOR Y EL FREDY DE HACIENDOTAS MIS JARUDO KE MI YESK DEJA KE PASE EL DIA DEL AMOR Y LA AMISTAD JJAJAA PARA KAERLES EL LUNES VAMOS A KAEER YO Y GUERO NAMAS PA IR ASER DE AGUA ALOS DEL SIETE AVEER SI MUY VERGAS EL HELLIO I ESOS WEYES ESKE YA SABES KOMO ESTUVO LA TRANZA AKA..POR ESO NO AVIA KAIDO WE !PERO NETHA ORASY AY KE AVENTARNOS UUNA KALAKA IA PARA QUE SE KAYEN LOS DEL SIETE NETHA!YA ME TIENEN ARTO Y ESO KE NO LOS LIDEOO TODOS LOS DIAS JAJAJAJA ARRE CHIDO MI YESK SALUDOS PAL SNAF SKIT KLEN GUN STIK I TODOS LOS DEMAS ARRE CHIDO!! DE RRATO!

( e-mail: )
Jueves 11.02.2010 / 13:17
BARRIO SIETE SE LOS QOSHA!

CHOLITO ADN 38 ( e-mail: )
Jueves 11.02.2010 / 12:35
ADN 38 CONTROLANDO LE GUSTE A KIN LE GUSTE,AHORA DOMINAMOS NOSOTROS 38,SALUDOTE A TODO EL ADN 38 A LOS CAMARADAS Y LAS MORRAS

( e-mail: )
Jueves 11.02.2010 / 10:47
BARRIOO JARUDOTE LOKOS CONTROLANDO LA CUESTA LOKOA PUTOOSS.

( e-mail: )
Jueves 11.02.2010 / 09:58
QUE QUIERE EL PUTO BABALU Y EL CABEZOTA CON ESO

SUENOKER ( e-mail: SUENO )
Jueves 11.02.2010 / 09:49
miren pendegos el barrio mas H... on es SWK LE DUELA A KIEN LEDUELA AKI EL SUEÑOKER SELOS COCHA A TODA ESA BOLA DE CULOS PURO SOUHT SIDE LOCOS

( e-mail: )
Jueves 11.02.2010 / 07:23
PINCHHE CABEZONNN GACHO «

( e-mail: )
Miércoles 10.02.2010 / 17:25
un saludo `param compa el yesskarmeloo jajajaja de parte de el snaf y ia no te juego canicas por ioras cuando te ganoo y me las quita tu mama jajajajaja y aii tamoos el snaf de la RPS jajaja arre chiido pi yeskarmelo

( e-mail: el yesk uno bjL )
Miércoles 10.02.2010 / 17:23
el yeesK uno amaa a snafodonga de jarudo un saludo para mi amigo snaf qe le gusta jugar musho alas canicas aver cuando nos aventamos un partido de tasos mi snaf el yeesk del jarudo locos los cangry creew

ADN 38 ( e-mail: )
Miércoles 10.02.2010 / 03:16
ADN 38 CONTROLANDO,PCL CUUUUULOTES JAJAJAJA PAR DE CULOS,AHORA DOMINAMOS NOSOTROS 38,A LA VERGA LOS PCL,ASTER,LOW,ARES,GARY,D'LOCK,DREAM,SNEY DEL ROMA CVS 38 CONTROLANDO PUTOS.

el pappy ( e-mail: paso tx.2 barrio )
Miércoles 10.02.2010 / 03:03
k tranza shina de k barrio eres mija.nesesito a alguien como tu con huevos!!! i like that.girl!

SynaaONEE ( e-mail: shinytaonersita@hotmail.com )
Lunes 08.02.2010 / 14:57
Laa ShynaaONER Riffandoo & QontrOlaandoo awaao paapa SHYNAA ONEER Laa moomy dee tdaas Uzteedees QuLAaZz! VAA PARAA LAA PINCHEE LAADY CELEESTE MICHEL CELIA DIANA PAOLA Y LA PUTA DE FANNY

el zamarripa ( e-mail: el_zama420@hotmail.com )
Lunes 08.02.2010 / 06:28
ke pedo ala berga todoz me la perzinan chato_padilla1@hotmail.com

BjL snaaf RPS ( e-mail: )
Domingo 07.02.2010 / 17:29
buenoo aquell q me dijoo un chiingoo de cosaas q el snaf q prometia sangre y asii q venga el y lo demuestre o q preste el cuete por q aqui en el barrio sii hay huevoos por donde sea ok ia estamooos y aii toii para lo q quieraan chiida ia si quieres desirme cosas aqui esta mi msn bjl_rps_snaf@hotmail.com bjL loka aunq les caleee 656BjL

eL VeeRgUiiLLaS cOcHaa ( e-mail: verguillas@hotmail.com )
Sábado 06.02.2010 / 13:48
si se cren muii vergas todos amos a desmadrarnos aqi les dejo mi msn culones para q me agregen el_chikis_boy@hotmail.com para q vean q no soii qulo

eL VeeRgUiiLLaS cOcHa ( e-mail: verguillas@hotmail.com )
Sábado 06.02.2010 / 13:45
a la V... todos los qe aqi aqi qon mi gente la qeqe jazmin choii zamarripa los cochan putos pinchi gente jodida qomo me da risza q nomas pierde su tiempo aqi en estas mamadas

kekeo ( e-mail: )
Sábado 06.02.2010 / 11:42
k ijos de perra los pcl son de agua ia los desmadramos una bes puro brg rifando y controlando y los pcl k H... en a su madre

( e-mail: JARUDO.L )
Sábado 06.02.2010 / 11:23
chida pa todos los barrios k nos respetan c les retacha la copa..y a los k no H... en su madre x eso les segimos pateando el C... BBBBBBBBBBBJJJJJJJJJJJJJJLLLLLLLLLLLLLL!!!!!!!!!!!!!!!

bjl ( e-mail: jarudones )
Sábado 06.02.2010 / 11:18
si los perros ladran gente es x k vamos pa delante.digan todas las M... k kieran.cuando tengan huevos ya saben en donde estamos kaiganle putos!!!!! barrio jarudo lokos

sanFRANCISCO ( e-mail: chidasJARUDOS )
Viernes 05.02.2010 / 16:00
ALA BRABA WEIES LLO SOI DE LA SAN FRANCISCO I SEE Q LOS JARUDOS SON UNA VERGHA NETA AUNKE DIGAN KE NO

v.i.p. ( e-mail: jarudo lokos )
Viernes 05.02.2010 / 12:32
arre gente ya pa H... ados se echan dejen q los P... se luzcan para q sepan q nos la pelan para q vean la calidad

jarudo lokos ( e-mail: cgk )
Viernes 05.02.2010 / 12:29
tranza gente arriba jarudo

( e-mail: )
Viernes 05.02.2010 / 09:06
UN SALUDO A JARUDO .. DESDE KALIFASSS .. ESOS WEYES SY SON UNA BERGA .. NO LOS AGAN EPUTAR PORKE NO SE LA BAN A CAGAR ASTA MAFIA TIENEN .. OK

q lokooo ( e-mail: )
Viernes 05.02.2010 / 08:39
un saluduiyo amis kompas k andan paradotes al daiki i al biwor dela echbikei.. k nole rajan.. hbk je d morrelus 12 23

( e-mail: bjL )
Viernes 05.02.2010 / 08:08
SSSI les kalaaa ALOS ojeettes dee MIEERDA hahah!

( e-mail: )
Viernes 05.02.2010 / 07:04
POS USTED TAMBIEN PONGA SU APODO WEY K LES KALA K LES DIGAN LA NETA

( e-mail: )
Viernes 05.02.2010 / 06:29
ese pinche kulero de abajo el k se la pasa ablando de los jarudo de aora k diga su pinche apodo kulero no k nosotros somos lod kulos k valga V... kulero aki la raza piteka kulero

( e-mail: bJL )
Jueves 04.02.2010 / 14:30
USTED calleseee i ballasee munnccho ala BERGHAA weiii usteedddes soonn looss qq ESCRIBENN esass madresss weeiiies haha quiereeenn agarrrar FAMA levantarsee qon nuestroo barriooo JAJA! qq pendejoss neettaaa

HeLiO!pB7! ( e-mail: )
Jueves 04.02.2010 / 14:02
jaja ia bn los mismos de su barrio lo dicen eL barrio SIETE siempre los a qOshadO! q wei aOra anda en su pinshi barrio soLo a pie ii son requLos les decia del siete ii no me decian nada jaja BARRIO SIETE QOSHA!

KONDOR ( e-mail: )
Jueves 04.02.2010 / 13:21
SOY EL KONDOR C N D S X 11 UNSALUDO PARA TODA LA GAMGA YEN ESPESIAL ALOS DELAS CRUSES NM

KONDOR ( e-mail: )
Jueves 04.02.2010 / 13:17
SOI EL KONDOR C N D S X 11 DIVI SALUDOS ATODA LA GANGA DE LAS CRUSES NM

soy el ysto ( e-mail: )
Jueves 04.02.2010 / 12:14
soy el ysto de aca de las cruces NM i ailes va una dedicasion para los adn que andan diciendo P... fuck you the one that is writting that bull shet y sino me entienden usen su pinche diccionario P... C... y nosotros traemos el arte del graffiti en la sangre pcl crew 725 graffiteros H... ones un saludo para los carnales delas calaveras 38 del roma para el chito alias el creo

soy el ysto ( e-mail: )
Jueves 04.02.2010 / 12:11
soy el ysto de aca de las cruces NM i ailes va una dedicasion para los adn que andan diciendo P... fuck you the one that is writting that bull shet y sino me entienden usen su pinche diccionario P... C... y nosotros traemos el arte del graffiti en la sangre pcl crew 725 graffiteros H... ones un saludo para los carnales delas calaveras 38

( e-mail: )
Jueves 04.02.2010 / 10:16
guachen mis jurudos nadie me ha dicho por aki que arre vamos a aser el desmadre o vamos a juntarnos todas las crew para aser el desmadre y que valga V... con los lomeros de kk pero nadie esas M... que a agarrar la vieja escuela no mamen si nisiquiera le salimos vamos a agarrar los wevos gente y que valga V... pero neta no M... y tu klen ya callate wey demuestra con echos no esperes a que se metan al barrio ay que meternos nosotros para sembrar el panico y ya que deveras nos tengan respeto y vamos con toodo gente mas con esos C... del 7

( e-mail: )
Jueves 04.02.2010 / 08:31
ghfghfh

( e-mail: )
Jueves 04.02.2010 / 07:14
jaja EL KLEN DE JARUDO LOKOS KIERO BER KE ENTREN AL JARUDO PUTOS OK ... ABER SY COMO HABLAN PERO ESAS MAMADAS KE ALA MARRUGADA KE .. JAJA ESO KE POES ASY SOLO POEDEN

( e-mail: )
Jueves 04.02.2010 / 06:28
este pendjho d abajo q? si vas a poner k ponga su apodo pos ponlo tu tambien wey no seas PENDEJHO y CULHO

JARUDOTE- ( e-mail: BJL.LOKOS )
Jueves 04.02.2010 / 05:59
EXACTAMENTE weeiii no qeremoss serr qomo loss de annttes no qereemos aserle ala mierddaa weii NO qeremosss andaarrr de pincchis tecatooss weii qoomo no poness tuu pinncchi apoddoo qulero PINCHI mierddaa aber si es vdd q mui BEGHAS hahaha nomas ablann weiiess perroo io see KEE usteddes no balenn BERGHAA. & nooo tirroo mii RROIOO weeii perroo loo bamoss a demostraarr QON ecchoss weiii paraa serrarless EELL OSICO

( e-mail: )
Jueves 04.02.2010 / 03:36
jajaj jarudillos no treten d compararse con los d antes k nunk ban aser como eyos, entiendan k se les acabo el teatrito ya todos sabemos k no son nada. y pueden segir tirando su royo sikieren alcabo ya sabemos como corre el awa y no valen verga. los dl 7 siempre los an hecho d agua ya aceptenlo no la arman!

HeLiO!pB7 ( e-mail: )
Jueves 04.02.2010 / 03:22
jaja nos peLan la vErgaa! BARRIO SIETE!

bjl.rifa ( e-mail: )
Jueves 04.02.2010 / 01:57
yo c k los longos eran un desmadre y H... ones le salian donde kiera x eso les tenian miedo..amos agarrar la vieja eskuela gente .arre!! jarudote lokotes....

somos uno solo ( e-mail: juntense gente )
Jueves 04.02.2010 / 01:54
k royo gante no sean P... no ay k peliarnos entre nosotros. Atodos esos kuleros k an hablado de nosotros es x corage.diganlo de frente si tienen guevos .Nada mas sirven pa kriticar pinchis culos....BBB...JJJ...LLL...XEVER!!!!!!!!!!

( e-mail: )
Miércoles 03.02.2010 / 14:40
ESTOY DECUERDO CONTIGO BATO ESOS ABLADORES QUE ANDABAN DICIENDO QUE IVA A VALER VERGA QUE LO DEMUESTREN CON ECHOS NO NOMAS CON TIRAR SU KK DE QUE SON DEL JARUDO ARRE MIS JARUDO A SER EL DESMADRE Y QUE VEAN QUIENES SOMOS ESOS PINCHES TERROSOS DE MIERDA DEMOSTREMOS QUE NO ES BLA BLA BLA VOMOS ASERLO CON ECHOS O SE AWUITAN GENTE

( e-mail: )
Miércoles 03.02.2010 / 13:25
que tranza yo soe del jarudo quiero que tumben a alguien del 7 y demestren que en verdad nos pelan la vvergga... ya es hora de demostrar que sigen siendo jarudos..porque hay muchos que lo tiran pero hay pocos .. jarudos lockos..

EL GRATE ( e-mail: )
Miércoles 03.02.2010 / 11:55
SOI EL GRATE DELOS PANCON LECHE SOY EL CARNAL DE ISTO UN SALUDO PAFRA EL ESMO PINCHES ADN NOMAS ABLAN PORK TIENEN BOCA LOS PUTOS IN MEMORI OF LEONEL PINCHICONPOTA DESCANZA EN PAZ PUROS PAN CON LECHE POR SIMPRE

thE WeSo ( e-mail: fer_lowrider@hotmail.com )
Miércoles 03.02.2010 / 06:48
ARRIBA LOS DEL TRIZTE 13 NSL LOS COCHAN PUTAS EL WESO LA RIFA LOKOS ARIIBA EL GRAFFITI LOCOS DESPLAYENC KON LAS PLAKAS ZONA NORTE

( e-mail: jarudo locos )
Miércoles 03.02.2010 / 05:32
ya pues para qee vergas nos estamos peliando entre el mismo barrio ii las diferentes crews del barrio ia no ai q ablar demas ia savemos q nos traemos corajes varios del barrio ii nos emos trensado C... pero ni pedo vamos a unirnos otravez como antes ia ala V... no ai q ablar nomas actuar ala vergaaa esta P... pagina iaaa

( e-mail: )
Miércoles 03.02.2010 / 04:12
SIMON YO DIRIA KE LOS DE ANTES .. ERAN UNA BERGA Y DE ECHO TODABIA EXISTEN SY NOSOTROS ..KEREMOS LES HABLAMOS PERO PARA KE ELLOS SOLOS PUDIERON Y NOSOTROS PODEMOS TAMBIEN ..EMOS ECHOS UN PUTEROS DE COSAS .. KE YA ME ARTATON ESTOS PINCHI ROLLOS KE CANA PELIARNOS ENTRE NOSOTROS NO TENEMOS BERGUENSA .. PERO YO ASTA LA MUERTE Y SE LOS DESMUSTRO ME DISEN EL KLEN DE JARUDO Y YA ME ARTE BA BALER BERGA TODO YA .. OK NOMAS TRUCHA PORKE EL JARUDO BA BOLBER IJOS DE PERRA YA ME ARTATON ..KE NOMS PURO BLA BLA BAMOS CHKOS .. PARA KE GUACHEN KE TAMBIEN NOSOTROS PODEMOS ..Y KE BALAGA BERGA YA JENTE

JARUDO LOKOS ( e-mail: )
Miércoles 03.02.2010 / 04:05
jajaja SIMON SEREMOS FRESAS WEEE.. KIEN DIJO KE LA BESTIMENTA TIENE KE BER ALGO WE .. AMI NETA ME DA YGUAL .. Y PORKE MUCHOS PINCHIS BARRIOS NOS TIENEN MIEDO POES ... WE LOS LONGOS .. LO UNIO KE ASEN NO DIGO KE TODOS ... UN EJEMPLO EL DUKE Y EL FREEE ESOS WEYES AMIS RESPETOS Y AL GRINGO .. POES SI LE SALEN LOS DE MAS LO UNIKO EL FAT KE ASE TUMABR Y TUMABR NOS MANDO ALA BERGA POR KIERESE DROGAR LA NETA .. LOS JARUDO CHIKOS ANDAMOS ARIESGANDO LA PINCHI PUTA VIDA .. KITANDO CUETES ALOS DE SIETE.. ATRPELLANDO .. EFIERRANDO Y CUETASOS Y KALMANDO EL PANIKO EN LOS PARYS KE MAS KIEREN KE AGAMOS PUTOS ESTO ES UN PINCHI BARRRIO Y SIEMPRE SERA CHINGON JARUDO LOKOS Y CHIKOS Y LONGO SEREMOS UNA BERGA .. WEYES Y SI NO KREN POES BENGAN LOS KIERO BER CAMINANDO EN MI BARRIO .. PUTOS ..Y LOS LADO BAJO .. LA NETA AY UN WE . KE LE DISEN EL KLEN .. ESE WE SY AA DADO LA VIDA POR EL BARRRIO Y OTROS WEYES KE ASEN.. JUGANDO Y ACIENDO PURAS PENDEJADAS .. NOMAS TRUCHA CON EL KLEN .. PORKE CUA

altavista!!! el actoo ( e-mail: )
Martes 02.02.2010 / 14:05
simon es la mera neta yo conoci a los jarudo a los longos hace un H... o le caian para aca a conectar y esos weyes si le salian eran H... ones pero los de hoy en dia de ningun barrio le salen la neta andan con sus M... de andarse drogando machin y ya ni le salen por el barrio la neta son puro pinchi chavillo fresilla que nomas porla compu pueden y si kieren calarse arres soy el acto de aki de la altavista !!!!

ADN 38 ( e-mail: ADN 38 )
Martes 02.02.2010 / 12:03
SALUDOS AL ADN 38 DE PARTE DEL CHOLITO K RIFAN ACA EN EL ROMA Y A LOS CVS 38 A LA VERGA LOS PCL PINCHES CULOS

( e-mail: )
Martes 02.02.2010 / 10:04
nettaa KEE ssiii weii esttoii qonn tiiggoo battooo PARA empesarla loss kanngrii wei aseenn JARUDO a puroo pinncchi MARICON qq no bale berghaa ala brabaa weii nettaa weii puro pinnchi MARICON

( e-mail: )
Martes 02.02.2010 / 09:57
Y SIGO DICIENDO LOS LBP NO VALEN PARA PURA VERGA SON PINCHES CHAVOS QUE NO LE SALEN PARA NI MADRES NOMAS SIRVEN PARA ANDAR DE FANFARRONES SOLO PARA ESO AY ANDAN CON LOS MAMADAS QUE SOMOS COMO 150 SI ALOMEJOR SI SOMOS UN PUTERO PERO NO TODOS LE SALEN SON CONTADOS LOS QUE LE SALEN LA NETA LOS DEMAS NOMAS ASEN BOLA LO QUE DEVEN DE ASER ES QUE SI UNO QUIERE SER JARUDO QUE DEVERAS TENGO WEVOS Y SI ANDA DE CULO Y NO SE SALE PUES A PUTEARLO POR CULO ASI DE VE SER UN BARRIO AGARRAR GENTE CON WEVOS Y QUE LE SALGAN NO AGARRAR A LO WEY Y PUROS BATOS QUE NOMAS ASERN BOLA POR ESO MI JARUDO NO VALE VERGA COMO LO SIGO DICIENDO ME AGUITAN MACHIN PERO PUES NI PEDO

( e-mail: )
Martes 02.02.2010 / 09:48
PARA EMPASAR NO SOY DE LOS JARUDO LONGOS SOY DE LOS CHAVOS OTRO EJEMPLO NO QUE EL SNAF TU SNAF ANDABS DE ABLADOR QUE IVA A VALER VERGA Y QUE LOS DEL 7 IVAN A PAGAR CON SANGRE ESO QUE ISIERON Y PUES AVER DIME WEY QUE AS ECHO Y ESO QUE ERA TU AMIGOTE ASI QUE QUEDE CLARO SOY UN CHAVO NO SOY DE LOS LONGOS

JARUDOSCHICOS ( e-mail: )
Martes 02.02.2010 / 09:09
chinngeenn atodaaa sssuu puttaaa madreee pinncchisss cagadooss nettaa weiies. ssii el jaruddoo eraa verghass anntes lo bbbaa a serrr OY ii siemmmprreee puuttoosss ABER ABER i usteddes q berghas isiseron por la muertee del pelonsillo ijoss de la verghaa aaiiTA siigeenn sienndo loss pinnchis tecatoss KE no valen BERGA ni balieron berghaa puutooss rpsslbp.QONTROLANDO puutooss somos los unikos ke le salimoss IJOS de la berga asii qqq no no salggaannn QON mamadddass PINCHIS pendejoss.

( e-mail: )
Martes 02.02.2010 / 06:20
soy el ysto de los pancon leche mejor conocido como el andy en el roma pura gente de los pcl crew 725

( e-mail: )
Martes 02.02.2010 / 02:38
simon si es cierto donde esta la venganza del pelon? ustedes nunka isieron ni madre, y yo no soy de los longos ni les tengo miedo si no pongo mi nombre es porke no se me da mi pinchi gana, y la neta antes si era un barrio H... on aora no vale madre ni pork son un putero el otro dia supe ke los del 7 isieron de agua a los jarudos no mamen k verguensa neta k me awitan gente

viejas renciyas ( e-mail: BIP )
Martes 02.02.2010 / 02:24
hola danny!! k t as esho pense k ya estabas muerto. komo eras un ijo de tu P... madre vale V... tu y tu barrio jarudo..donde t fui a encontrar....toda via me la debes P... al rato m sako la espina cuidese culero..atte B.I.P

( e-mail: )
Lunes 01.02.2010 / 14:34
GUACHEN MIS JARUDOS PUES NOMAS CON UN EJEMPLO LOS VOY A CALLAR A TODOS DONDE ESTA LA DISQUE VENGANSA DEL PELON AVER DIGANME QUIEN SE HA AGARRADO LOS WEVOS Y HA VENGADO AL PELON NADIE LA VDD PUES COMO LO SIGO DICIENDO QUE LASTIMA PERO PUES ESPERO Y MI JARUDOO DEVERAS SEA CHINGON

( e-mail: jarudo locos )
Lunes 01.02.2010 / 09:41
otra cosa sqee stan bien cagados ii noles cuentan las riñas qe asemos ii ai les encargo qe jarudo no nomas son los lbp stamos los rps cangri tapias 13 dark side pitekos 13 green side ii cada qien ase su desmadre aparte ii para esos culos q nos ponen cosas aver como no disen qienes son por algo nos tienen miedo cagados jarudo todabia lo segimos levantando ii asiendo riñas por el no nomas ablamos por aqi ia an visto eshos para q no digan q no nomas ablamos

( e-mail: jarudo locos )
Lunes 01.02.2010 / 09:37
vallanse ala V... putos ustedes los pinches longos ni saven cuando asemos las riñas no saven lo q asemos por el pinshe barrio lo levantamos por todas partes asta por compu nosotros si tenemos amor por el barrio ..

( e-mail: )
Lunes 01.02.2010 / 08:57
simon ise wey tiene rason los jarudos de orita ya son bien culotes no se conparan con los de antes si e cierto k se la pasan drogendose pero porke a eyos ya les bale madre, pero antes si asian desmadre chidote en cambio los de ahora nomas tiran su royo y nunk asen nada, nomas wachen al klen k se la pasa tirando su royo por internet en ves d andar afuera aciendo riña pinchis chabos colos tira royo me awitan pff

BJL ( e-mail: )
Lunes 01.02.2010 / 07:08
hahaha NOSS deciaann de acholee II QORRIAANN puutooss hahahaha sonn deee aguaa putooss i essoo qq nommass eramosss 2 nommasss 2 hahahahah i ustdddes qomo 10 no digas qq NO puutto hahahahaha.-ssonn de AGUA-

HeLiO!pB7! ( e-mail: )
Lunes 01.02.2010 / 05:39
jajaja 15 no mames de primero eramOs 2 i ustedes qomo 8 i los isimOs de agua! despues los dejaron morir eramos 2 pa 2 i se qulearon de a shole! i siguieron de aferradas sta q me desqonte al stiq jajaja BARRIO SIETE!

losJARUDOTELOKOS.- ( e-mail: )
Lunes 01.02.2010 / 04:41
hahahahah SIMON puraaa pinnccchii ABLA eraa para kee noss ubieran eccho para atrasss i all CONTRARIO no losss QOMIMOS qomoo sieemmmprreeee hahaahahahahaha PINNCCHI ELION VOZ DE PITTOOTTEE Q tiiennnes weii pinncchi MARICON DE mierddddaa.

JARUDO LOKOS ( e-mail: )
Lunes 01.02.2010 / 04:07
jajaja NO MAMES .. PINCHIS 7 JAJAJ ESOS WEYES SI ME DAN RISA KE DISKE .. NOS ISIERON DE AGUA KE KIERES hellio .. NI PIEDRAS SABES ABENTA NO MAMES NOMAS ME BISTES KE ME METI .. WE SALISTES COMO SIEMPRE CORRIENDO NO SE KE KIEREN KE SE KRESKAN ,.. WEYES ERAN COMO 15 WEYES ... PARA NOSOTROS KE ERAMOS . 5 WEYES Y ASY NOS COMIMOS PUTOS NO SE KE CHINGADOS KIEREN ASER CON ESO .. Y YO SOY UN CHABO NO SOY LONGO Y ASY LOS TREMO BARIENDO MI CANTON JAJAJA BOEN SABE KE JARUDO LOKOS ATTE E. KLEN BIEN SABE DONDE VIVO ALA BARBA EN FRENTE DE LAS CANCHAS OK

( e-mail: JARUDO CHICOS )
Lunes 01.02.2010 / 01:16
ii ala vergaa todos los putoos entradoos sigo esperando por años a un pinche barrio qee tengo los webos de meterse a jarudo a aser la riña pero nadiee son cULOOS ia con eso los caLLoo putos vamos a ver qee barrio tiene de meterse al barrio a piee como nosotros lo asemoos nosotros ni asus mamas respetamos ii no es bla bla simplemente son eshos qee ustedes an vistoo

hahaha ( e-mail: JARUDO CHICOS )
Lunes 01.02.2010 / 01:10
no nomas le sali por la compu cagado los shicos somos los qee estamos levantando el jarudo pinshes longos ia son bien culones nomas se la mantienen drogandose nosotros somos los qe traemos el desmadre putos por algo todabia stamos en zona roja ii eres culon weei por algo no pones tu apodo POR CULOOO hahahahha ponga el apodo cULON para qee vea q los shicos tambieen nos abrimos si ia emos de eshoo DE AGUA ALOS LONGOS

HeLiO!pb7! ( e-mail: )
Domingo 31.01.2010 / 16:10
jaja oii los isismOs de agua putOs barrio siete qosha pinshis jaroshas!

( e-mail: )
Domingo 31.01.2010 / 14:42
la lbp del jarudo son bien culos yo cantoneo en el jarudo nomas ablan y ablan que lastima pues los cholos de antes que cantoneaban aqui en el jarudo esos weyes si que mis respetos no como los de aora son bn culos nomas ablan y ablan pobres espero y algun dia mi gente del jarudo si agarre los huevos y de nuevo agarre fama no nomas por computadora que sea por echos no con bla bla bla

el de abajo!!! ( e-mail: mil diskulpas!!!! )
Domingo 31.01.2010 / 10:54
mis diskulpas a todos lo ke entren en esta pagina lo ke esta eskrito abajo es algo de mal gusto ke eskribio mi hermanita de 5 años eske es muy imperactiva, y agarro la kompu kuando yo estaba en el baño me tarde por eso tuvo bastante tiempo de hecho no es la unika pagina ke insulto si no otras en otro idiomas el habla 8 idiomas me kae mal... neserio pido una diskulpa es mas una diskulpa en nombre de todos los meseros del mundo a no vrd??? jejejejeje, el nombre de mi hermana es mela y se apellida pelas si kieren deskitense kon ella la odio me kito todo lo ke tenia en la vida jajajaja matenla ya"!!!!!!

ke te importa wei!!! ( e-mail: ser_van_89@hotmail.com )
Domingo 31.01.2010 / 10:47
ke pedo pendejets!!! todos los ke stan leyendo estos msn son unos idiotas sin ke hacer. babosos, jajajajajajajaja yo no porke soy el creador de sta pagina stupidos y gracias a animales komo ustedes gano mucho dinero en la komodidad de mi apartamento jejejejejejeje jente idiota solo en mexico klaro yo no soy d aki jajajajajaja graxias a dios!!! a y sigan escribiendo porke mire una tv plasma ke me kiero komprar aber si se ponen las pilas ke akabo en la eskuela valen madre no hagan las tareas,,, asnos!!!!

BJL. ( e-mail: )
Domingo 31.01.2010 / 06:20
esperate esperatee weii TUKE asi de peladdass weii ATI nadiieee te conocee weiii jajajaajaja pinncchi chavala cagaddaa jajajaja-WACHA AL pinncchi dosill preguntale qomo lo kuliamoss al KULERO eenn prebiass weii hahahaa qq llaa ni durmioo en toddaa la nochee porr ell miedoo hahahahahaa.. PINCHIS CULONNES.hahah tambieenn cuannddoo calleron aa la iglesiiiaa qonn el estupidoo maricon del navi hahahaha no weiies llaa tiren alionnn asii desiann vdd QULONES hahahahahaha BBAARIOOOJARUDOTELOKOS! isomoss chabilloos perooo MMMMM.. noss pelann laa verghaa puttoosss jajajajajajaja. PENDEJOS.

EL DRAW DE LOS MSF ( e-mail: LA WELCOM RIFA YA SE LA SABEN SIN DETALLE )
Domingo 31.01.2010 / 06:03
JAJAJAJAJA TODAVIA ME DAN RIZA LOS PENDEJOS DE LOS BJL Y TODO SU PINCHE KINDER JAJAJAJAJAJA SABEN BN K NO SON NADA PUEDEN CAER CUANDO QUIERAN NO HAY HORA PUTOS PERO CAIGANLE HAORA SI AL BARRIO NO DAMOS DE ACHOLE Y TODO LO K QUIERAN PENDEJOS Y AMI ME CAI K SI DISEN K SON COMO 150 VAN A KEDAR COMO 1 O 2 Y SI MUCHO JAJAJAJAJAJA SABEN BN K NO LA PELAN PUTOS .........AQUI REPRESENTANDO ALOS MSF LA CUESTA RIFA FOR EVER EL DRAW DE LOS MSF YA SE LA SABEN SIN DETALLE ACG LOKOS MSF LA WELCOM RIFA VIRRELLES ,SENDEROS DE SAN ISIDRO SENDEROS DEL SOL Y VARIOS POR HAY ,OASIS REVO SOUTH SIDE LOKOS ,Y SEGUIMOS PERO SI SIGO CONTANDO ATODA MI RAZA SE KEDAN BOCA ABIERTOS JAJAJAJA EL DRAW EL SARK DE LOS SOUTH SIDE EL WIKERONER EL DIE EL DRASE EL DOSIL EL ALOKADO EL NAS EL ROCKERO EL WARER EL FAKE EL BOUK EL DATER EL ASEK EL SIWER EL CHOLO EL KORBAN EL DERS EL TAREK EL SLIK EL WINTEK EL ARCHY EL JEST EL PATHO EL TOKI Y SIGE Y SIGE HASTA K LOS PINCHES bjl SE KEDAN ABAJO JAJAJAJAJAJAJAJAJAJA EL DRAW DE LOS M

EL DRAW DE LOS MSF ( e-mail: LA WELCOM RIFA FOR EVER )
Domingo 31.01.2010 / 05:49
JAJAJAJAJAJA K PINCHE RIZA ME DAN LOS PINCHES JARUDILLOS DE MIERDA JAJAJA TAMBIEN EL MI PINCHE ROCKA K TIRO CADA VEZ K VOY AL BAÑO JAJAJAJA SI SABEN BN K NO LA PELAN PENDEJOS PURO MSF ANDA CONTROLANDO POR TODO JUAREZ Y SOBRE TODO EN LA CUESTA YPINCHES JARUDOS DE MIERDA DISEN K CALLERON A NUESTRO BARRIO Y NADA SON CULONES AMORIR CALLERON PURO PINCHE MORIILLO DE MIERDA Y NI SI QUIERA CALLERON AL BARRIO ENTREN ALOS CONDOMINIOS PENDEJOS HAY ES EL BARRIO ESTUPIDOS NO AFUERA AFUERA A QUIEN VAN A ENCONTRAR SI MUCHO ENCUENTRAN AL DRAW ASIENDO DE LAS SUYAS Y EL DAFY ESE WEY ME LA PELA ASI DE SIMPLE COMO LA VEN PENDEJOS ESE PUTO ERA MARICON JAJAJAJAJA

SCOR BJL HPL14 ( e-mail: )
Domingo 31.01.2010 / 03:31
JOJOJO.. NOMAMEN UNIDOS SI SU CHAVITO HASTA SE RETORSIO COMO UN PESACADO AKABADO DE SACAR DEL AGUA NETA QUE NOMAS PUJO I SI NO SE MURIO LE DEESMADREE EL RIÑON O LOS PULMONES NETA WEYES Y ESO NADAMAS FUE UNA ADVERTNCIA POR QUE YA BAN LAS BALAS DE GRUESO CALIBRE YA SE ACABO SU BARRIO DE MIERDAS Y SIMON SI FUY YO EL QUE CHINGO AL PINCHE MOCOSO CAGADO ESE Y OJALA SE MUERA EL CULERO....SCOR BJL HACIENDAS Y CUESTA TENEMOS EL POWER

HeLiO!pB7! ( e-mail: B7 )
Sábado 30.01.2010 / 15:55
BARRIO SIETE LOQOS!

JARUDOTE-1 ( e-mail: BJL )
Sábado 30.01.2010 / 14:43
hahahahahhahahahahahahhahahahaa.pinncchiiss unidoosss qomo tirann ssuu puutttoo roiooo porrr internet weiies hhahaahahahahah BAMOSS ABBER QUIEENN ESS MMASS BERGHASSS PUTOS BBARRIOJARUDOTELKOSLA CUESTA!JARUDOTEHACIENDAS!UNOS.hahahahahaa pinncchiss quiernnn qq mmee mettaa asuu puuttoo barrriiooo otraavves A AGARRARLOS A TUBASOOS HAHAHAHAHA pobrres roñossoos hahahahahaa.

BJL ( e-mail: )
Sábado 30.01.2010 / 09:37
hahahahah PURAA PINNCCHI ABLA PUUTTOOSS AQUIII ESTAMOS LOSS JARUDOTTEE RECARGADOS PUUTOOSS ABBER ABBERR SI ESS VD QQ MUIII BERGHAS IJOS DE SU REPUTA MADREE AII SORPRESASS IJOSS DE LA PUUTTAA VERGHAA

MuUk!14 ( e-mail: unidotes 14 )
Sábado 30.01.2010 / 08:29
para el esckor del jarudo ya valistes V... P... neta P... enffierraz a chavitos que no la deven ni la temen como no me enfierrastes a ami o al difo neta wey se me va amarrar por cke ya valistes V... P... este chaviyo tenia una madre que se avia echo unidos y tu le caistes a el pero el papa de el es mexicles y te va a matar pinche perro lambe bolas pinche flaco C... ijo de P... y na no le paso nada ni para enfierrar sirves wey neta

adrian_hiphop ( e-mail: )
Viernes 29.01.2010 / 14:13
el mc manhy kanta bien feoote.. nole da verguenza al wei no eres apto igual q los raperillos de aqui d juarez no la cuajan

( e-mail: )
Viernes 29.01.2010 / 12:26
pinche elio como tiras tu P... royo we sabiendo ke me pelas la V... tu i tus pinches terrosos puto JARUDOTE LOKOS EL STYK HIJOS DE SU PUTA MADRE

( e-mail: )
Jueves 28.01.2010 / 13:37
mmee TIEENNES asttaa laa berghaa IJO DE TU PUTA MADRE ttee voiii a seerraarr el puutto osiiccoo KE tiennnes weii quannddoo veasss alasss calaccasss kkee mee voiii a AVAENTAR IJO DE TODAA TU PUTA MADRE . DEL jarudoTELOKOS!

HeLio!pB7! ( e-mail: )
Jueves 28.01.2010 / 12:31
mushO pinshi bLa bLa weies i no hacen ni madres pinshis jarOshas! B SIETE!

( e-mail: )
Jueves 28.01.2010 / 10:01
JARUDOTE LOKOS STYK SLAT PUTOS

( e-mail: )
Jueves 28.01.2010 / 07:38
HAHHA KE KIEREN TIBURONES NO SE PROKE TIRAN TANTA PINCHI MIERDA Y SUTEDES SABEN BIEN KE SON UNOS CULOS NO DYGO BOLA PORKE NO SON MAS DE DOS ES LA NETA Y NOSOTROS NO MAMOS A NADIEN PINCHI LOMEROS CULOS YA ME CANSE DE PELIAR POR AKI ES N PINCHI PERDIDO DE TIEMPO NO MAMES BUENO PONGASE TRUCHA NETA AY BOY POR USTDE PINCHI MIERDAS EL JARUDO ESUN PINCHI BARRIO CHINGO AORA YA ME ARTE BENGAN ABER SI SE KREN LA GRAN BERGAS .. Y UN SALUDO AMI TIO DE BILLAUMADA AL CHOLO KE EESE WE SY ES UNA BERGA .. JAJA KLARO EL JARUDO .. LOKO

FReAck ( e-mail: freak15ns_15@yahoo.com )
Jueves 28.01.2010 / 05:45
aii les ban estas cuntas letras a los pinches cholos k kieren ser komo yo ustedes son culos ....mmm puro b.TENERS 15 nortenos el freak los cocha

( e-mail: jarudos locos uno )
Jueves 28.01.2010 / 04:51
estan pero si rebien P... tibursios culoos nosotros los mandamos ala V... cuando callo el netin no los desmadramos por caernos a mamar las bolas a jarudo para qee qeremos mas terrosos nunca se les ara tener el acople con nosotroos

( e-mail: )
Miércoles 27.01.2010 / 12:08
jajajajaja aki los tiburones rifando y controlando las calles de juaritos jarudos y sieteros no valen verga ya se la saben putos

( e-mail: )
Miércoles 27.01.2010 / 11:59
jajajaja pinches jarudos culos ustedes desian hamos a unirnos para darle en la madre a los sieteros jajajajaja pinches batos lambe bolas jajajaja

( e-mail: )
Miércoles 27.01.2010 / 11:52
k pinche chato me la pelas jajajajajaja mamando tu tambien a otros barrios no k solos pueden jajajajaja pinches chavalas

( e-mail: )
Miércoles 27.01.2010 / 10:53
jajajaja pinches sieteros C... eses pinche barrio cagado siempre los asemos garras putos saben bien a puros escopetasos acuerdense putos les da miedo acordarse jajajaja miedo es entrar al barrio de los tiburones jajajaja

( e-mail: )
Miércoles 27.01.2010 / 06:48
PINCHES LOMEROS KAGADOS COMO TIRAN SUROLLO HIJOS DE SU PUTA APESTODA MADRE BARRIO JARUDO LOKOS EL STYK PUTOS RPS

( e-mail: )
Miércoles 27.01.2010 / 06:27
aiiPINCCHII roñosooo jajajaja:) qomo esttass CAGADOTEE pinncchii elio nettaa weiiiHAHAHA. tmbb pinncchis tiburoness qomo NOS DECIAN no jarudoss porfaboorr arrree a UNIRNOSS asttaa caian al barriooo NOSEACUERDAN puttooss hahahahan BARRRIOOJARUDOTELOKOS CONTROLANDO LA CUESTA!

( e-mail: )
Miércoles 27.01.2010 / 05:18
el gobierno y los poli son rameras!! y aun asi con su respeto... por venderse!!!

dick ( e-mail: )
Miércoles 27.01.2010 / 00:33
que rollo putos aqui el dick desde el bachi saludos a todos los adn del roma y de la 8 cuidense atte. el dick

HeLio!pB7! ( e-mail: )
Martes 26.01.2010 / 14:17
jaja mamando barrios iguaL q los jarudos no mamen aprendan a nosotros weies no mamamos a nadie nosotros solitos podemOs BARRIO SIETE SEGUIRA QOSHANDO!

HeLio!pB7! ( e-mail: )
Martes 26.01.2010 / 14:12
jaja a qien le dicen roñonos pinshis tiburones estan mas pinshis jodidos q todos weies ii ai andan qreiendose los vergas jaja BARRIO SIETE QOSHA!

( e-mail: )
Martes 26.01.2010 / 10:51
saludote para los unidos 14 al muk de los tiburones 13

( e-mail: )
Martes 26.01.2010 / 10:46
para los roñosos del siete bajo 13 y para los jarudos culos k siempre nos an pelado la V... C... saben bien tiburones13 rifando y controlando las calles de juaritos pocos pero locos matamos y enterramos y si nos buscan en la andres figuroa estamos jajajaj barrio tiburones rifando y controlando

( e-mail: )
Martes 26.01.2010 / 07:58
KE DESCANSE EN PAZ MI CBORNES MAS CHINGONES DE JARUDO TOTO WORT DAFY SLICK SPECK USTEDES ASTA EN EL SIELO LA SYGUEN RIFANDO PUTOS JARUDO LOKOS ASTA LA PINCHI ENTIEERO KE MME LLEBE EL KLEN DE JARUDO PUTOS PARA CALLARLEES EL PINCHI PUTO OSIKO ,,,,,,,,,,,RIFA LA BJL Y UN SALUDO AL JARUDO ACIENDA ..CASA GRANDES OASIS VIRRELLES Y ASTA MAS PERO YA NI ME ACUERDO PERO EL JARUDO CUESTA ES EL KE RIFA CABRONES EL KLEN LOKO

( e-mail: )
Martes 26.01.2010 / 07:33
B:batos J:jodidos y L:lomeros pinshisss jotorudoss

skiw ( e-mail: )
Martes 26.01.2010 / 06:44
k rrollo culos

jarudo hacciendas ( e-mail: )
Martes 26.01.2010 / 04:22
orasy ya valio V... abra torturas y abra el infierno palos entrados neta ya valieron verga!!! ijos de su pinche madre!@!!!!

( e-mail: )
Lunes 25.01.2010 / 07:51
JARUDO LOOKOOS HIJOOS DE SU PINCHE MADRREEE STYK

Pamela Gonzàlez ( e-mail: pamelagonzalez@minaeditores.com )
Lunes 25.01.2010 / 04:29
Hola!! Soy de la revista Graffiti de Mina Editores, estamos en busca de organizaciones y marcas que estèn relacionadas con la cultura del Graffiti para intercambiar informaciòn sobre nuestros espacios publicitarios. Dejo mi correo para q se comuniquen. Saludos pamelagonzalez@minaeditores.com

( e-mail: )
Domingo 24.01.2010 / 13:45
ADN 38,AHORA DOMINAMOS NOSOTROS 38, SALUDOS A LOS ADN AL LOW,SNEY,ARES,GARY,D'LOOCK,DICK,DREAM,Y ALOS DE LA ESCUELA DOSER,FOSTER,LOSNY,TRANE,SOMBY,FLEX,SOCK,SLOCKER,A TAMBIEN A LAS MORRAS KAREN,MOYO,FOSTERSIYA,A Y A MI AMORSOTE AURORILLA=CHOLITA. DE SU COMPOTA EL CHOLITO PARA SU JENTE.AHORA DOMINAMOS NOSOTRO 38, DEL FRACC.ROMA

@cme ( e-mail: )
Domingo 24.01.2010 / 08:59
IN MEMEORY OF SEK MSK GALEANA BY 3L @CME MSK DESCANSA EN PAZ CARNAL TU GENTE MEX SIDE KINGS 4 EVER AND 4 LIFE ATT MSK GALEANA KINGS

( e-mail: )
Domingo 24.01.2010 / 01:16
JAAARUDOTELOKOTES! SON LOSSS PURITITOSS REIIES!

el s@iko reportandose junto k ( e-mail: )
Sábado 23.01.2010 / 14:20
pinches vatitos de M... lo q quieran decir diganselo en su kara P... q es eso q dejando rekaditos neta q parecen P... eskribiendose H... adera y media pinches barriesillos de M... puros pachukos 30 rifa y kontrolan todo juaritozzzz

pitonisio ( e-mail: )
Sábado 23.01.2010 / 10:23
verga grande al 6-69-69-69 llama aoraa!!!!1

( e-mail: )
Sábado 23.01.2010 / 04:05
PBS 13 SON CUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUULOTES AICALDES Y ROMA RIFAN PUTOS EEEEE A LA VERGA LOS POBRETONES

BJL.UNOS ( e-mail: )
Sábado 23.01.2010 / 01:45
haiii poorrrDIOSS quienn tiennnee miedoo PINNCHI LOMERO esmmass weiii!! tuuuKEweii esperatee esperattee NADIEN te CONOCE weiii jajajajajaj MIEDOO HAHAHAHA NOMMMASS ESPERATEE POKITOO PINNCCHIII ROÑOSO MEQO!!

HeLio!pB7 ( e-mail: )
Viernes 22.01.2010 / 15:55
uii q miedo jaja no mamen jaroshillas tienen dicendo eso desde q me aquerdo i mira es ora q nomas no, tienen MIEDO de tronar un quete jaja BARRIO SIETE QOSHA!

( e-mail: )
Viernes 22.01.2010 / 12:20
JARUDO LOKOS EL STIK RPS

shiinaa Onee ( e-mail: vanessa_oo@hotmail.com )
Viernes 22.01.2010 / 07:35
Paaraa tii amoorr

catorce wet side family ( e-mail: )
Viernes 22.01.2010 / 06:04
HOLA SOY EL LUCKY¢À,QUIERO MANDAR UNA SALUDO AL VIRUS DE LA 14WS FAMILY QUE EL BARRIO MAS SHINGON DE TODO JUAREZ Y RECURDE EL LUCKY¢À DE LA 14 WEST SIDE FAMILY RIFA Y CONTROLA9830

( e-mail: bjl la cuesta bjl haciendas )
Viernes 22.01.2010 / 04:18
y un saludo para los otros jarudos de haciendas saben bien en distintos lados stamos pero somos lo mismo les asen algo a ustedes nos los asen a nosotros shida family..

( e-mail: jarudos locos )
Viernes 22.01.2010 / 04:13
deja tu messenger keem para agregarte los del barrio si por aca todavia eres leyenda save bien q se le recuerda por piraton

bjL ( e-mail: wesk del jarudo )
Viernes 22.01.2010 / 04:10
como tiras roio axer neta weei no se por qe tiras tanta caca si saves bien que mi pinshe barrio te dejo cojo ii aparte te enfierraron ai stabas llorando cuando te atropellamoos lastima das shavo nomas puro bla bla con tigo ii los del siete ia ni train nada ia son como 10 weies ii nosotros entramos ii salimos ii a PIE caminandola por su pinshe barrio jediondo no la caliente P... q se le cai al canton junto con su carnala pinshe barrio jediondillo entro ii nomas miro las placas de jarudo por tu pinshe colonia asqerosa ustedes ia murieron ia ni existeen

danieloko ( e-mail: jarudone )
Viernes 22.01.2010 / 03:37
ese mi gun chida x las liricas de tus rolas.sigale asi kabron. ya se la saben con JARUDO no se entren putos!!!!!!!!!!!!!!BJL

danieloko ( e-mail: jarudone )
Viernes 22.01.2010 / 02:27
ay les va un saludo pal tatus,mayelo,los cuates,el conejo,pancho,chikles,rojo,gus,maiko,gory,cholo,pulga,cheko,el chino,mostro,mata,emilo,jimy,spek RIP,lyos,chuky,y a todos los veteranotes deay de las canchas del BARRIO JARUDO LOKOS!!!!!!!!!!!!!!!!!!!!!!!

danieloko ( e-mail: jarudone )
Viernes 22.01.2010 / 02:07
k tranza jarudos! k le paso al gordo.tirenme el royo.kiero torikiar kon el duke o el nomi eyos ya saben kien soy....desde la frontera kabrones BJL controlando!!! REST IN PEACE EL AYEM#1

( e-mail: )
Jueves 21.01.2010 / 15:37
el draw delos msf eres un pendejooo pinchhe mokoso stupido no saves ni lo qe dises tu i tu pinche barrio cagado me la pelan ,, P... son una M... para el dafy... rip dafy!.. elrockaone! cuando qieran putos...

( e-mail: )
Jueves 21.01.2010 / 09:07
HAHAHAHHA pero no loss esperaremoss perrraa asta su putoo canntonn para q se me cagenn IJOS de la bergggaa HAHAHAHA BJL

axerone ( e-mail: )
Jueves 21.01.2010 / 08:37
jajajajaj ke miedo wey sabes bien ke a ustedes asta les da miedo tronar n cuete pinchis nogaleros cagados caiganle pero si les matamos otro nomas no pongan demanda chavalitas y con ke ban a venir a matar a algien con sus piestolas de tubo de gas natural jajajajajj no mamen weyes ustedes matan a algiien y se trauman toda su vida el axer y el sego ya llebamos como 4 y nos vale V... no tiramos con pinchis echisas cagadas caiganle aki los esperamos para ke avisaban P... jajajaja ete el axerone

( e-mail: )
Jueves 21.01.2010 / 07:41
HAHAHAH NO MAMES LOMERITOS de los de 7 HAHA SY LE KITAMOS EL KUETE PARA KE SE ASEN HUEYES IJOS DE PERRA JAJA Y POR CIERTO CUANDO LES TACHE SUS BOMBAS KAGADAS ...ANDABA APIE WE SI NO PREGUNTALE EL RUKO .. DE LA ESKINA SY SABEN KE NO BALEN BERGA KE EL JARUDO NUNCA PODRAN .. OK EL KLEN DE JARUDO LOKOS .PUTOS

BJL. ( e-mail: )
Jueves 21.01.2010 / 06:44
HAHAHAHA SIMON SIMON HAHA SOMOSSS PUROO CHAVILLOO IJOSS DE PERRAA PEROO MMMMM SE ME SIENTANN WEIESS HAHAHA NOMMMASS EL 28 AMARRENSENN QON LAS CALACCAS IJOSS DE LA BERGHAAA SE LOSS JUROO PUTOSSS NOSS LLEBAREMOOSS SI NO UNO DOSS SE LOS JURO PUTOSS ripSLIK.

ivan ( e-mail: )
Jueves 21.01.2010 / 03:50
que rollo putos aqui el dick de la adn saludos a los adn pcl culos

EL SPOON PCS1 ( e-mail: espoonjaz@hotmail.com )
Jueves 21.01.2010 / 01:28
LOS PRYNCIPALES UNO. DE TIERRA NUEVAAAA LOKOSSS... PCS1 PCS1 PCS1 PCS1 PCS1 PCS1 PCS1 AITAAAMMOOOOOSSSSSS SPOOON SPOON SPOON SPOON ESPUUN ESPON SPUN GRAFITEROS AL SIEEEN WWW.MYSPACE.COM/MCMANHY AI LES DEJOO UNA PAGINA DE RAP LOKAL PARA KEE HUACHEEN LA MERAA KALIDAD.

spoon ( e-mail: espoonjaz@hotmail.com )
Jueves 21.01.2010 / 01:21
keee transaaaaaa... eL spoon de tierra nuevaaa.. espoonjaz@hotmail.com pcs1 pcs1 pcs1 pcs1 pcs1 pcs1 pcs1 pcs1 pcs1 pcs1 pcs1 pcs1 pcs1 pcs1 pcs1 pcs1pcs1 pcs1 pcs1 pcs1 pcs1 pcs1 pcs1 pcs1 pcs1 pcs1 pcs1 pcs1 pcs1 pcs1 pcs1 pcs1 pcs1 pcs1 pcs1 pcs1 pcs1 pcs1 pcs1 pcs1 pcs1 pcs1 pcs1 pcs1 pcs1 pcs1 pcs1 pcs1pcs1 pcs1 pcs1 pcs1 pcs1 pcs1 pcs1 pcs1 pcs1 pcs1 pcs1 pcs1 pcs1 pcs1 pcs1 pcs1 pcs1 pcs1 pcs1 pcs1 pcs1 pcs1 pcs1 pcs1 pcs1 pcs1 pcs1 pcs1 pcs1 pcs1 pcs1 pcs1pcs1 pcs1 pcs1 pcs1 pcs1 pcs1 pcs1 pcs1 pcs1 pcs1 pcs1 pcs1 pcs1 pcs1 pcs1 pcs1 pcs1 pcs1 pcs1 pcs1 pcs1 pcs1 pcs1 pcs1 pcs1 pcs1 pcs1 pcs1 pcs1 pcs1 pcs1 pcs1 pcs1 pcs1 pcs1 pcs1 pcs1 pcs1 pcs1 pcs1 pcs1 pcs1 pcs1 pcs1 pcs1 pcs1 pcs1 pcs1 pcs1 pcs1 pcs1 pcs1 pcs1 pcs1 pcs1 pcs1 pcs1 pcs1 pcs1 pcs1 pcs1 pcs1 pcs1 pcs1 pcs1 pcs1 pcs1 pcs1 pcs1 pcs1 pcs1 pcs1 pcs1 pcs1 pcs1 pcs1 pcs1 pcs1 pcs1 pcs1

el danny ( e-mail: BJL )
Jueves 21.01.2010 / 01:14
1 saludo para paro todos mis homies del BJL! el duke.zona.pancho.oso.nomy.kef.june.skat.free.smurf.al mandis.wort.maiko.gringo.zeke.impla.fuor.AYEM.. y pa todos los lokos del dark side del JARUDO

danny ( e-mail: jarudolkts )
Jueves 21.01.2010 / 01:03
hey WTF! bitches.jaja. BJL rifa putos

AXERONE ( e-mail: )
Miércoles 20.01.2010 / 16:50
KE ROYO PARA TODOS ESOS BARRIOS ENTRADO YA LLEGO EL AXERONE DEJANDOLES ESTAS LETRAS PARA KE SE KEDEN PIKAS PUTOS SSABBEN KE KON EL BARRIO SIETE NADIE PUEDE Y NUNCA AN PODIDO Y ESTO PARA LOS JARUDOS NOSOTROS NO TENEMOS KE ANDAR MAMANDO BARRIOS PARA PODER CON OTROS UN SALUDO PARA LOS SUR PARK DE HACIENDAS AL FLEK AHI TAMOS LOS DEL BARRIO SIETE PARA LO KE KIERAN PUTOS ATE EL AXERONE 727 RIFANDO Y CONTROLANDO EL LA CUESTA SOMOS POKOS PERO LOKOS THE AXERONE 727 SIDE STRET

LOW ( e-mail: )
Miércoles 20.01.2010 / 15:13
ADN rifando un saludo para la adn de parte del low

el axerone siete lokos ( e-mail: axerone72hotmail.com7 )
Miércoles 20.01.2010 / 09:40
jajajaj aki riendome de los pinchis mocosos del jarudo ke dicen ke nos kitaron un cuete jajajay une bici esos weyes ni eran del siete P... y dicen ke nos tacharon la placa no mamen entren a pie chavalas nadamas en carro entran al 7 kulotes y no mamen weyes son puros chavillos x eso nadie de mi gente del 7 les hace caso ya neta weyes se les deja ir mi gente y los pinchis jarudos salen corriendo ni las energias gastadas neta x eso mejor ya los tiramos al leon y luego los matan y lo primero ke hacen es poner demanda pinchis shavalas no se amarran debolada se peinan mejor ponganse a hacer otra cosa y dejon de calentarla xke no valen V... nadamas ke no saben aceptar neta el siete los cocha saben bien entren a pie si se cren tan vergas chapetones ke shingados son re culos puros pinchis shavillos de 10 anos neta ke acepten su barrio no vale V... si los del siete kisieranos ivanos asta asus canchas a pistear pinchis placas no las tacho xk me dan lastima se gastan el dinero de l

K-torce west side ( e-mail: )
Miércoles 20.01.2010 / 09:23
hola aqui saludando el lucky de la catorce west side para recordarles que el lado oeste rifa y mandandole una saludo al sid,boss,skiper,zoner y el ecko west side killer

kinterotes surenotes ( e-mail: )
Miércoles 20.01.2010 / 05:39
ala V... todos los putos entrados puro b5ta sur rifa y controla putos somos pocos pero lokos pinches chavalas ya se la saben putos kiinteerootess lookootess (in memori) (of)(el) (kosi)-(devock)kiinteerootess sur (el)(negro)

( e-mail: )
Miércoles 20.01.2010 / 05:28
hahahaahah ABUEVOO pinnchiss mfs no balen para pura berghaa CULONES QUIERN UN DESMADRE QOMO ALOS DE LA JOYAA oke hahahaa SSII AQUERDENNSEE PUTITTAS NOSS METEMOSS A CUETIROLOSS ASTAA SUU PINNNCCHI BARRIESILLO CAGADOO I SALEN AMADRESSS HAHAHAHAHA JARUDOTEELOKOTES!! qontrolandoo LACUESTA!

( e-mail: jarudoo lokoos mas de 150 )
Martes 19.01.2010 / 20:44
ay nomas ago mension de pocos del JARUDO sona duke fath loker wero kako skat mank gringo pancho kuko maico wosk oker free slek smike duda yesk sode phat dial slak soke capi dosil koala duet dies evil wofe gary sonk souk fowe fase poker pulpo pooh shapas piolo omak mink drak cuba klen mago maton fhuor koke impla kef slat skit seck rocka resko shore nomy since stik sholo dikey disa seick wike tomate gun nox june adek kiro harry balak wear moss homi shuky speck snaf skor tek iguana etcetera ya me dio weba pero somos un vergero QUIEN SE QUIERE CALAR ??????

Jarudo mas de 150 cabrones ( e-mail: msfculones )
Martes 19.01.2010 / 20:39
ay nomas ago mension de pocos del JARUDO sona duke.fath.loker.wero.kako.skat.mank.gringo.pancho.kuko.maico.oker.free.slek.smike.duda.yesk.sode.phat.dial.slak.soke.capi.dosil.koala.duet.dies.evil.wofe.gary.sonk.souk.fowe.fase.poker.pulpo.pooh.shapas.piolo.omak.mink.drak.cuba.klen.mago.maton.fhuor.koke.impla.kef.slat.skit.seck.shore.nomy.since.sholo.dikey.disa.seick.wike.tomate.gun.nox.june.adek.kiro.harry.balak.wear.moss.homi.shuky.speck.snaf.skor.tek.iguana.etcetera ya me dio weba pero somos un vergero QUIEN SE QUIERE CALAR ??????

EL DRAW ( e-mail: MSF FOR EVER HASTA LA MUERTE )
Martes 19.01.2010 / 15:14
SOLAMENTE DEJO MI PLACASO AQUI EL DRAW DE LOS MSF LA CUESTA RIFA EL DRAW DRAW DRAW DRAW DRAW DRAW DRAW DRAW DRAW DRAW DRAW DRAW DE LOS MSF.........K PINCHES ENTRADILLOS DE MIERDA SON UNA MIERDA COMPARADOS ANOSOTROS COMO LOS PINCHES bjl JAJAJAJAJAJAJA K PINCHE RIZA ME DAN LOS PENDEJOS PINCHES MOCOSILLOS ESTAN PERO BN FEOS LOS PENDEJOS Y ADEMAS DE FEOS ESTAN NEGROS JAJAJAJA Y SON JAROCHOS LOS WEYES JAJAJAJAJAJA PINCHES PENDEJOS IGUAL PARA LOS ENTRADOS......AQUI EL DRAW DE LOS MSF LA CUESTA RIFA MSF RIFA MSF RIFA MSF RIFA EN TODA LA CUESTA Y SOBRE TODO NUESTRO JUARITOS MSF MSF MSF MSF MSF MSF MSF MSF MSF MSF MSF MSF MSF MSF MSF MSF MSF GRABENSELO EN SU PINCHE CABEZA LOS MSF CONTROLAN EL DRAW K LES KEDE CLARO WEYES MSF RIFAAAAA!!!!

DRAW ( e-mail: ACG MSF )
Martes 19.01.2010 / 15:06
MSF RIFA!!!!! MSF RIFA!!!!! MSF MSF MSF MSF MSF MSF MSF MSF MSF MSF MSF MSF MSF MSF MSF MSF MSF MSF MSF MSF MSF MSF MSF MSF MSF MSF MSF MSF MSF MSF MSF MSF MSF MSF MSF MSF MSF MSF MSF MSF MSF MSF MSF MSF MSF MSF MSF MSF MSF MSF MSF MSF MSF MSF MSF MSF MSF MSF MSF MSF MSF MSF MSF MSF MSF MSF MSF MSF MSF MSF MSF MSF MSF RIFANDO EN TODA LA CUESTA Y SOBRE TODO JUARITOS MSF MSF MSF CONTROLANDO TODO ASU PASO COMO LA VEN PUTOS EL DRAW DE LOS MSF DRAW DRAW DRAW DRAW DRAW DRAW DRAW DRAW MSF MSF MSF RIFAAAA!!!!MMMMMSSSSSFFFFF!!!!!

EL MRS DRAW ONE ( e-mail: MSF LA CUESTA RIFA )
Martes 19.01.2010 / 15:01
YA LLEGO SU PADRE EL DRAW DE LOS MSF LA CUESTA RIFA......... ESTO ES PARA TODOS LOS PINCHES ENTRADOS DE MIERDA VALLANSE MUCHO ALA VERGA ASI DE SIMPLE ME LA PELAN DONDE SEA CUANDO ME TOPEN AVER SI PUEDEN CON MIGO PENDEJOS BJL ME LA PELAN JUNTO CON SU PINCHE MUERTITO EL DAFY JAJAJAJAJAJAJA K PINCHE RIZA ME DAN PENDEJOOOOOSSSSSSSSSSSSSSS Y ESTO VA PARA TODOS LOS ENTRADOS NO MAS NO LOS TOPAMOS EN EL CAMINO Y LOS DESMADRAMOS EL DAFY JAJAJAJAJAJAJAJAJAJA DESEGURO ESTA HAORITA AYA ABAJITO EN EL INFIERNO JAJAJAJAJAJAJAJA CUANDO QUIERAN CAERNOS ADELANTE PUTOS LOS VAMOZ A ESPERAR A CUALQUIER HORA TAMBIEN ALOS BJL PINCHES MOCOSILLOS DE MIERDA NO SON NADA SIEMPRE ME LOS TOPO EN EL CAMINO Y LOS AGO DE AGUA JAJAJA K RIZAN ME DAN Y UNOS HASTA ME DAN DINERO CON TAL DE K NO LOS DESMADRE JAJAJAJA .....AQUI EL DRAW DE LOS MSF LA CUESTA RIFA LA WELCOM PUTOS ACG MSF RIFANDO EN TODA LA CUESTA Y SOBRE TODO NUESTRO JUARITOS COMO LA VEN .....EL MR DRAW ONE DE LOS MSF YA SE LA SABEN SIN DETALLE

SNEI ( e-mail: )
Martes 19.01.2010 / 11:51
UN ZALUDO PARA TODOZ LOZ ADN D LA FEDERAL 8 D PARTE DL ARES SNEI GARY Y DREAM KULOTEZ LOZ PCL ....AHORA DOMINAMOS NOSOTROS....

( e-mail: )
Martes 19.01.2010 / 06:41
ayo me kiero meter al certel de juarez tengo mucho huebitos SOY MALILLA PERO YA ME ARTE DE ASER Y MATAR KIERO MAAS DE ESO KIERO SER PODEROSO

el danieloko ( e-mail: salas_daniel84@yahoo.com )
Martes 19.01.2010 / 03:55
k tranza putos puro jarudo lokos no more! al rato les kaigo x aya gente , no c aguiten. el dani saludando desde u.s

SPHAR CEZ WZ EAC ( e-mail: )
Martes 19.01.2010 / 03:20
HOLA SOY EL SPHAR DE PACHUCA HIDALGO KORRAN UN CREW Y AK LO APLICO

( e-mail: )
Lunes 18.01.2010 / 10:01
AII disculpennn ermosooss no eraa esee aii qq tonttaaa ERA elklen-bjl8@hotmail.com losss mamo puedoo chuparr penes tmb

( e-mail: )
Lunes 18.01.2010 / 09:56
AILES bbaa el mioo pappasottes klenbjl8qhotm. loss amo

fabiola ( e-mail: rapera_fabiola@hotmail.com )
Domingo 17.01.2010 / 10:13
holaa ps soi de chihuahua agreguenme a su msn el mio es:rapera_fabiola@hotmail.com se cuidan

( e-mail: )
Sábado 16.01.2010 / 10:21
QUALESS PINNCHISS HUEVOOSS IJOOSS DE PUUTTAAA I NIO MMEE CALLO EL SAKO LOKO PERO LE SALLGOO PORR MI PINNCCHI BARRIOO MUNNCHOOSS PINNCHISS HUEVITOOSS PUUTTASSSS AMMARRENSE ALL DEMADREE´PUUTTITTASS HAHAHAHA

el comandante jr ( e-mail: )
Viernes 15.01.2010 / 15:55
H... uen a su P... madre pinches cholos P... si tienen muchos huevos porque no se disen todo de frente muy H... ones se enconden detras de una pinche computadora jajaja eso no es tener huevos eso se llama ser culos pinche bola de jarochos nacos tierrosos se nota que no son de juarez la gente de juarez nos desimos las cosas de frente no detras pinche bola de culos jajaja me dan risa pinches cholos culos P... att cartel de juarez nosotros si tenemos mas que huevos y lo emos demostrado a nivel mundial cartel de juarez.

( e-mail: )
Jueves 14.01.2010 / 14:25
me la estoy jalando

( e-mail: )
Jueves 14.01.2010 / 14:19
tengo comezon en los huevos kien me rasca

( e-mail: )
Jueves 14.01.2010 / 14:15
kiero saber cosas sobre el graffiti kn me ensea

el pancho ( e-mail: )
Jueves 14.01.2010 / 14:11
puro barrio minerotes 13

el viruela ( e-mail: no tengo )
Jueves 14.01.2010 / 14:03
un saludo para todo el barrio funakisotes 13 el creiko, ramstein,makana, azul,sekia, asep y el milton puro vato pesado

el viruela ( e-mail: no tengo )
Jueves 14.01.2010 / 14:00
y se los va a cargar la V... pinches tatos 13 ya los traemos en la mira amarrence para los plomazos

el viruela ( e-mail: no tengo )
Jueves 14.01.2010 / 13:55
k tranza pinchis chavalotas aki el viruela rifando y controlando.. el viruelota de los funakis 16 putos sembrando terror por todo juaritos

( e-mail: )
Jueves 14.01.2010 / 10:21
H... en asumadre todos

( e-mail: )
Jueves 14.01.2010 / 09:46
PURO TATOOS 13 A WEBO DE LA COLONIA AZTEKA Y PRADERAS CONTROLANDO POR TODOS LADOS

b5ta sur ( e-mail: )
Jueves 14.01.2010 / 09:24
puro b5ta sur rifa putos rip kosi-devocker kiinteerotess suurr riifaandoo puutoos (el)(kiikee)

spanky ( e-mail: )
Jueves 14.01.2010 / 01:35
atodos los soldados y municipales se los ba a kargar la V... y sus familiares tambien ya dejen trabajar agusto atentamente mi patron los poluicias q estan demi lado ya la isieron los q no ya mamaron mexicles forever

acto otk ( e-mail: )
Jueves 14.01.2010 / 01:29
H... en sumadre todos los barrios entrados

( e-mail: )
Miércoles 13.01.2010 / 14:21
alosssJARUDOSS.loossmamo laa nettaaaa.

joma ( e-mail: )
Miércoles 13.01.2010 / 10:55
puro ns 14 rifa . el joma y la yaira rifan. norteños 14

( e-mail: )
Miércoles 13.01.2010 / 05:30
ADN rifa LOW,angel

pavis ( e-mail: )
Martes 12.01.2010 / 02:16
soy surreno tirando valas portodos pinchis l

( e-mail: )
Lunes 11.01.2010 / 11:48
ThE sOfErOnE!!!!

gato 14 ( e-mail: )
Lunes 11.01.2010 / 11:40
cccccchhhhhhhooooolllllleeeeee 111111111111111444444444444444 ttttttthhhhhhheeeeeee gggggaaaaaaaattttttttooooooooooo

collas ( e-mail: alex_elyogie@hotmail.com )
Lunes 11.01.2010 / 09:27
barrio santanas 18 cocha onde kiera

weroner ( e-mail: )
Lunes 11.01.2010 / 07:46
segundo barrio central rifa el weroner .chinoker .demo .kone .papy . miguel.lalo. pepe.dower. doker. luis .teto. ivan. liker .junior. pelon. alonzo. bebe. julio. sate. 0nersotezs

weroner ( e-mail: weronersbc@hotmail.com )
Lunes 11.01.2010 / 07:40
soy de el barrio mas H... on de cd juarez segundo barrio central mas conocido como la fe2chika central in memori of ronko tito cholo pesuñas descansen en paz

( e-mail: )
Domingo 10.01.2010 / 07:58
ia wossk ia wosssK HAHA

bjl ( e-mail: )
Domingo 10.01.2010 / 02:35
jjaaarrruuuudddooo lokos

@cmer ( e-mail: @me675@hotmail.com )
Sábado 09.01.2010 / 12:10
un saludo para todos mis compas los msk galeana para el host,kope,seko,oner,unick,fame,gasp,diablo,hamt,saico,smock,grifo,eroek,smash,kiko,soul,drack, serio,loco,mask,noe,y para todos los 19velarde del @cme de msk galeana mex side kings 4 ever and 4 life by @cme 675.

bjl ( e-mail: )
Sábado 09.01.2010 / 09:39
jajajajajaja pinchis ronosos cagados con cuete o sin cuete jarudo la rifa putos cagados

kimmy ( e-mail: kimmy_bell@hotmail.com )
Sábado 09.01.2010 / 06:17
este barrio es el mas fregon ps kien se meta con un cabron despertaras en un cajon lleno de balazos por mandilon kien te manda a dar catorrazos este barrio no es bromas vete con tu mami P... lloron

BJL- ( e-mail: )
Viernes 08.01.2010 / 15:08
hahahaKUALESS pinnchiss meniadoosss puuroo pinncchiii ROÑOOSSSOO NO CARNALL hahaha nommbrree CARNAL si usteddess estann lebanntadooss nosotroosss esttamooss LEVANTADOTTESS CABRONESS hahaa PUUALL pinnchi bajoo 21 BBAARIOOJARUDOTELKOSS!! qontrolanndoo laa quuestttass & TOODOO JUARITOOSS hahahahah PIINNCHISS ROÑOSSOSS hahahaha

( e-mail: )
Viernes 08.01.2010 / 14:54
ya ya no muchopinchi rollo pinchis jarudos no ammen tanto la V... los bajo 21 cochamos putas y si no pregunten por dodne kieran culones barrio bajo 21 controlando puro pinchi meniado

rps ( e-mail: )
Viernes 08.01.2010 / 13:20
ps que royo jarudo lokos rifandola como la ven

kiko ( e-mail: hnsfdhdhn )
Viernes 08.01.2010 / 08:44
que royo

( e-mail: )
Viernes 08.01.2010 / 05:31
AQUIIISIMPLE&SENCILLAMENTTEEE RIIFFA ELLLL. BBBBBAAARRIOOO JARUDOTTTEEE.LOKOOSSS

LOW ( e-mail: )
Viernes 08.01.2010 / 05:17
SALUDOS ATODOS LOS ANGELES 30 SSL DEL LOW Y EL DOSER

doser ( e-mail: )
Viernes 08.01.2010 / 05:11
AHORA DOMINAMOS NOSOTROS DOSER SNEY LOW FLEX DRIVE ASTER SLOKER FOSTER TRANE SOWER SOCK DILOCK SCRIP DREAM BOW WOW DUKER ARES LOSNI... ALEJATE DE NOSOTROS CHINGUEN SU MADRE LOS PCL EL ADN SE LOS COCHA

low ( e-mail: gabriel.oli@live.com )
Viernes 08.01.2010 / 05:08
Saludos a todos los de la ADN de la federal 8 para el doser,aster,sney,drive,foster,sloker,flex,traner,sock,dilook,dream,ares,losni,diore,duker,gari,bow wow,sower,scrip,caliya ,del su compa el low se cocha a los pcl cuando quieran.

( e-mail: )
Jueves 07.01.2010 / 08:49
a huevo tosos lo yevamos en mente y corazon rip pelonsito

( e-mail: )
Jueves 07.01.2010 / 08:40
*

bjL ( e-mail: )
Jueves 07.01.2010 / 07:54
RIPP:SLIKKyyoosiittee carrgoo enn mi menntteeWEII: BJL.UNOS

BJL ( e-mail: )
Miércoles 06.01.2010 / 11:58
AY TAMOS MI DREX JARUDO LOKOS EL WOSK RIFANDOLA DE RIPIES BJL

drex ( e-mail: julio_drex_bjl@hot.... )
Miércoles 06.01.2010 / 08:47
bjl lks cosha pts el drex lbp saludando a mi compa el stop y al wosk jarudote lks rifando como dise mi carnal el gun ... con jarudo no t entres ...q despues se me arepienten jajajaja y nomode q no si es la pura neta jaja ai tamos pa lo q gusten drex duda gun balak yesk wosk klen

drexxity ( e-mail: bjldrex12@hot.. )
Miércoles 06.01.2010 / 08:43
jaja q mi pinshes lomeranller estan bien cagadotes nadie los conose jaja pues el drex onert se los cosha ya se la sabes de el lado bajo peligroso crew del jarudote lks ai tamos mi jente pa lo q gusten .. jarudo lks jarudo haciendas riffando pts un saludo pa mis compillas los prs ai tamos mi gun klen stop

b jl ( e-mail: )
Miércoles 06.01.2010 / 05:42
un saludo a mis jarudos.... snaf slat skyt wosk yesk efyk diser spek daser duda sonik klen seck gun cuba kiro fiber side sode phat gary evil resko styk mago yosek homye yeison sow duke sona nomy nox free jajajarudo rifando putos JARUDOTE CONTROLANDO PUTOS

jarudote ( e-mail: )
Martes 05.01.2010 / 13:22
el woskersote one se los cocha lomeros de mierda

( e-mail: )
Martes 05.01.2010 / 13:12
a quien H... ados les disen culos primeru levanten su barrio chapetotes jarudo lokos bjl rps putos

( e-mail: )
Martes 05.01.2010 / 10:39
puro bla bla bla pinchis jaruchas de M... no mucho royo y mas accion pinchis culos

( e-mail: )
Martes 05.01.2010 / 10:30
LOSSS.RPS SINN DUDDA SONN LOSS Q MASS LE SALENN PORR ELL JARUDOOO.TMBLBP- JARUDOTEELOKOS!

Wosk ( e-mail: )
Martes 05.01.2010 / 10:06
Jarudotote lokos el wooskersote.one jarudotote rifando donde qieran y a la V... Los ronosos del siete de la NHL

( e-mail: )
Martes 05.01.2010 / 06:07
ADN RIFAN,EL CHOLITO

slaT1 ( e-mail: )
Lunes 04.01.2010 / 14:00
elll SLATTT BAARIO JARUDOTTEE .

eL PiStoLa ( e-mail: )
Domingo 03.01.2010 / 09:24
aki el pinche gun pa k wachen kana jarudote rifando y controlando a pura pinche chapete k no la kuaja JAJAJAJAJA lado bajo aki representa BJL

stop ( e-mail: )
Domingo 03.01.2010 / 09:00
pues q cholos jarudo asta la muerte cagados yasabe aytamos los dela unolos jarudo compa chida lbp

el canibal ( e-mail: )
Domingo 03.01.2010 / 08:57
la 18ta vatos de calfas yase la sabenputos la long beach de la heroes putos

BJL JARUDO ( e-mail: )
Domingo 03.01.2010 / 08:55
JARUDO LOKOS PUTO ARRIVA DE TODOS BJL BJL JARUDO ELSTOP

el juano ( e-mail: )
Domingo 03.01.2010 / 08:53
la playota 18 vatos la long beach xv3 putos

bjl ( e-mail: bjlstop )
Domingo 03.01.2010 / 08:46
el stop barrio JARUDO lks aytamos los dela lbp lado vajo peligroso pinches del siete y todos los entrados yo soy elstop y me la pelan cana el stop y el klens del jarudo lks con stilo men pinches raperos del siete estan vien cajados miados asi q ballanse ala V... hijosde P... pinches terrenosos miados y tanvien pa los ak47 cagados rmz cagados bgl cagados elstop bjl cabron

stop ( e-mail: mc.stop@hotmail.com )
Domingo 03.01.2010 / 08:40
sisi el stop bjl desde luego jarudo lokos men asi q vallanse al carajo el nox el kiro klens stop drex los rps lbop cochan sttop uno.,

sl?- ( e-mail: bjL. )
Domingo 03.01.2010 / 04:52
aquii ESTANN LOSS VERDADEROOSSS LOKOSS & PESADOSSS!! JARUDTTELOKOSS.!! AHUEVOO.

EL ALIVIANE ( e-mail: DRECKFLOUWNET@H.ES )
Domingo 03.01.2010 / 04:01
PURA JENTE PESADA DEL LADO DE LOS POBRES 13 DEL ALIVIANE JENTE NUEVA

pobres13 el ALIVIANE ( e-mail: dreckflouwnet@h.es )
Domingo 03.01.2010 / 03:54
un saludo para my carnal el daly y el parka DE LOS POBRES13 DEL ALIVIANE QUE ESTAN EN EL CERESO PURA JENTE DEL LADO SUR DE JUAREZ

JARUDO LOKOS.. ( e-mail: ESTO FUE LOS LADOS BAJO EL KL.. )
Domingo 03.01.2010 / 02:38
JAJAJ NO MAMES ESTO BA para el hellio.. NO MAMES PINCHI MOKOSO IDIOTA.. MEJOR TU BOKA SIERRA NETA YO ME METY TU DIRAS KE ESTAN KULERA PERO LO K KUENTA ..NO KRES ESO .. PINCHI MEKOS KIERO BER KE USTEDES LO AGAN ABER SY MUY BERGUITA Y ... NO KIERO KE SE METAN ALAS 5 DE LA MAÑANA .. NETA KE SON UNA BOLA DE KULOS.. Y UNOS PENDEJOS PORKE LES KITAMOS SU PINCHI KUETE Y SU BISIKLETA.. Y SE FUERON PUTIADOS KE MAS KIEREN IJOS DE PEERRA.. YA SABEN LOS KE SE METEN CON NOSOTROS.. LES BAJAMOS LOS DE BERGUITAS SI NO KRES INTENTELO .. OK SIEMPLMENTE LOS JARUDO LOKOS ..

( e-mail: )
Sábado 02.01.2010 / 04:06
esaaa esss MII PINNCHI GENTEE DELL JARUDOLOKOS! PINCHISS ROÑOSOSPENDEJOSS..

bjL ( e-mail: jarudotee lokotees )
Sábado 02.01.2010 / 02:41
para los lomeros del 7 si weei i luego la bici q les tumbamos el otro dia ii asta nos trajimos un cuete calibre 45 para qee no anden tirando su rollo pinches sieteros terrosos nomas para qee washen ni con cuete nos asen nada ii el otro meco con la cabeza abierta se la abrimos shida hahahahahaha de okis train cuete shavalas ni lo truenan ps awebo por eso se los qitamos por culones

( e-mail: )
Viernes 01.01.2010 / 07:07
jarudotote putos los pinchis tierrosos del siete no valen pa pora verga

( e-mail: )
Viernes 01.01.2010 / 05:11
ell DAVIDII PUTOOSS SE LOSS COCHHAA A TODOSS DEL CAMPANARIO.

kabeka ( e-mail: )
Jueves 31.12.2009 / 11:48
primero matemos a todos estos cholos sarnosos hijos de su perra madre

( e-mail: )
Jueves 31.12.2009 / 11:43
bbaarrioo JARUDOTTEE.

rocker ( e-mail: )
Jueves 31.12.2009 / 11:32
que se mueran todos los politicos hijos de la vertebra muertos de hambre,,matemos a todos esos perros del mal

HeLio!pB7 ( e-mail: )
Jueves 31.12.2009 / 07:28
BARRIO SIETE!

HeLio!pB7 ( e-mail: )
Jueves 31.12.2009 / 07:24
jaja no mamen nomas andaba un wei ese dia i salierOn a madres en quanto lo vierOn ii a eso le llamas bombitas jaja pinshis letras quLeras pero alos 5 min ia estaban tashadOs jaja no sigan tirando su roio de q son vergas el SIETE los seguira qoshando pinshis nOgaLeros!

SECTA ( e-mail: JONA23485@HOTMAIL.COM )
Jueves 31.12.2009 / 01:17
SEEEEEEEEEEEEEEEEEEEEEECCKKTAAAAAAAAAAA

EL JOSE BAL ( e-mail: LA JUANA BAL )
Miércoles 30.12.2009 / 01:16
CHINGA TU MADRE PINCHE CABEZON CARA DE JAROCHO ABARROTES LA JUANIS TE COCHA LUNA UNO COCHA EN TODAS LAS TIENDAS DEL BARRIO DE LA BAL BARRIO ABARROTES LUNA

SUENOKER ( e-mail: SUENOkerone )
Martes 29.12.2009 / 14:08
todos H... en a su P... madre puro swk south side loco de la clonia obrera de parte del sueñokerone

( e-mail: )
Martes 29.12.2009 / 07:28
puuro pinchee ABARROOTES SANDY

kiikee b5terotes ( e-mail: )
Martes 29.12.2009 / 06:39
k tranza cha[etones b5ta sur los cocha putos representando kinterotes rifan pokos pero lokos

( e-mail: )
Martes 29.12.2009 / 03:33
HAHAH NO MAMES sieteros .JAJA LES TACHE SU BOMBAS JAJAJ Y USTEDES AUN LADO JAJA.. ASTA YSE UNAS BOBITAS Y TODO .. CANA ASTA ME TUBO TIEMPO ME MTEY ALAS 8:30 AY TAYYBA Y TRES WEYES HAHA NO LES DYGO ASY O MAS DE AGUA PINCHI LOMEROS CULOS NUNCA BAN A PODER CON NOSOTROS BIEN SABE KE EL JARUDO CONTROLA SU PINCHI BARRIO CAGADO ..

BJL. ( e-mail: )
Martes 29.12.2009 / 02:12
USTEDDD QQ PIINCHII ROÑOSOO CAGADOO. NADIENN LOO KONOCEE WEIII NOMASS TIRAA SUU PINNCHII ROIOOO POORR INTERNETT.PINNCHI LOMERRILLOO. CAGADOO BN SABBENN JARUDOO CONTROLANDOO TODAA LA CUESTAA PUTOOSS.

( e-mail: )
Lunes 28.12.2009 / 09:53
jarudote lokos bjl potos controlando

( e-mail: )
Lunes 28.12.2009 / 09:49
pinchis chapetes jarudote lokos los del siete no valen verrga jarudote lokototes

resio ( e-mail: resioner )
Lunes 28.12.2009 / 09:16
no mucho pinche rollo pinches tatoos de M... ps si saben bien ke no valen V... jajaja

HeLio!pB7 ( e-mail: )
Lunes 28.12.2009 / 06:22
jajajajaja bla bla bla pura pinshi habLadera ustedes bn sabes eL siete lOs qOsha B7!

( e-mail: )
Domingo 27.12.2009 / 06:14
LOOSSS JARUDOTE LOKOSS

skoR! BJL HACIENDAS 14 ( e-mail: )
Sábado 26.12.2009 / 08:07
jaja ke i los del siete ke segun eyos nos kochan i no se ke jaja mira pinches lepes!! kuando oien del jarudo salen corriendo asta por el metro noss tienen miedo korren los kuleroos!! ajjaja i el bleess de los unidos ke i el denek me la pela el crowe lo barro kn una sola manoo!!

tAtOoS 13 ( e-mail: tAtOoS13 sUrEñoSs lOkOs sUt )
Sábado 26.12.2009 / 06:32
ofa ese pinci barrio pedorro que ni quien los coche y ahi andan todos empinados pidiendo dverga de los tatoos jajajjajajajajaja a webo siganos mamando pinchis ofa cagados asi nos levantan mas weyes y si kieren calarse nomas caiganle son bienvenidos putos pa ke wachen comos alen pero de neta no pura pinchi habladera C... de todos modos ya savemso ke ni van a caer culones tatoos 13 los cochan putas rameras

BJL.- ( e-mail: )
Sábado 26.12.2009 / 06:32
calmaccee pinnchi ROÑOSOO BN SABESS CARNALL Q SONN UNAA VOLA DE CULOSS HAHA PINNCHISS ROÑOSOS.

gabo r.m ( e-mail: gabo_r@yahoo.com )
Sábado 26.12.2009 / 04:39
saludossssss aotdo juarez felis año 2010 que selapasen chidotaaaaaaaa jajajajajajajajajajajajajajajajaja

gabo r.m ( e-mail: gabriel_r64yahoo.com )
Sábado 26.12.2009 / 04:27
q pedo putillos

727 ( e-mail: )
Sábado 26.12.2009 / 04:09
NO MUCHO PINCHE ROLLO JARUDILLOS KULOS EL SIETE SE LOS COCHA

( e-mail: )
Viernes 25.12.2009 / 15:33
JARUDOO COCHAA A TODOSSSSSS -ES LAA NETAA.

b hacienda ( e-mail: bb..hhh...aaaaaaaa. )
Viernes 25.12.2009 / 09:22
pinches tatoos de M... si me acuerdo de esa vez q vendieron los 2 carros al fierro para comprarc su mezcalito putos jajajajajajajajajaja eso ya paso ahora ya es otro royo putos cuando qieran putos la ofa 18 los cocha chavalas

nsl 18 putos ( e-mail: )
Viernes 25.12.2009 / 09:14
puro 18 pinchis msh de M... nos pelan la verga

( e-mail: )
Jueves 24.12.2009 / 09:51
JJJJJAAAAAAAAAAARRRUUUUUUUUUDDDDOTTTTTTTTTEEEEE.

SUENOKER ( e-mail: SUENOkerone )
Miércoles 23.12.2009 / 13:13
el barrio mas H... on es swk south side locos de la obrera k siempresta y estara para meterle la berga a todos los norcacas

fresh..cnk..ph's ( e-mail: )
Miércoles 23.12.2009 / 10:44
arre me keep io le avismo ami crew.. de esto siruela contactame..phost_hh@hotmail.com// zhida alos graffiteros d juaritoz.. cnk crew phss

( e-mail: )
Miércoles 23.12.2009 / 08:57
JAJAJA NOSOTROSS SII CONTROLAMOSS TODO JUARITOSSS NO DOS Q TRESS COLINIASS HAHA JARUDOTEELOKS-

sTiLO unICo tAtOoS 13 ( e-mail: tAtOoS 13 cONrtRolAnDo tRvEz dE loS aÑOs )
Miércoles 23.12.2009 / 07:22
TAtOoS 13 kE nUNcA hEmOs cAiDo CoNtRolAnDo ToDo pRaDerAs y TaMbieN La CoLOniA aZTeKa NOmAs pA kE WaChEn lOs EnTRaDoS puRo pInCHi CHaViLLo JaJa No Se mEtAN cOn lOs BaRrIoS dfe La ViEjA eScUeLa PuRo RuCo De 30 aÑoS y hAsTa pOLiS kE sOn tAtOoS NOmAs pA kE wAcHeN tAtOoS 13 geNeRaCiON trAS gEnERaCioN

( e-mail: )
Miércoles 23.12.2009 / 07:22
k transa putos aki el shagy sote ç conectando con el topito y el ruso de los world five de tierra nueva y para la jen te de los wf1 de donde mismo

cholito ( e-mail: cholito64@hotmail.com )
Miércoles 23.12.2009 / 06:41
'ADN'CHOLITO,ARES,BURRO,SNEY,DREAM,DILOCK,BOW WOW,DEL FRCC.ROMA Y LA JENTE DEL B.CVS 38 LOCOS

( e-mail: )
Miércoles 23.12.2009 / 04:19
eeh jente ay que realizar una mega pinta aki en la citty ttodos los qe tengan aerosol en la sangre ay qe rayar el puente de la panamericana endonde pasan autos para el paso o para chihuahua los pinshis guashos kreen ke poeden kon los delinkuentes del aerosol pero nos la pelan el keep de los kms shida raza

cholito ( e-mail: cholito64@hotmail.com )
Miércoles 23.12.2009 / 04:08
SALUDOS A LOA ADN DE LA ESCUELA FED.NO 8,AL FOSTER,SLOCKER,FLEX,LOSNY,DOSER,TRANE,SOCK,DIORE, AHORA DOMINAMOS NOSOTROS,DEL CHOLITO PARA SU GENTE,Y TAMBIEN SALUDO A LOS CVS 38 DEL ROMA LOCOS,SLEP,DAXE,COHA LA JENTE UNIDA ATTE.EL CHOLITO

cholito ( e-mail: cholito64@hotmail.com )
Miércoles 23.12.2009 / 03:57
ahora dominamos nosotros ADN EL CHOLITO saludos a la jente de los CVS 38 LOCOS,EL BURRO,SNEY,DILOCK,DREAM

SUENOKER ( e-mail: SUENOkerone )
Miércoles 23.12.2009 / 03:39
el BARRI0 MAS CHINGON ES SWK SOUTH SIDE LOCOS DE LA OBRERA DE CENTRO Y UN SALUDO PARA SWK DE `LA MONTERRI

( e-mail: )
Miércoles 23.12.2009 / 02:22
MAMMO ALOSS JARUDOS.AHUEVO.ATTE.PBU.14

g A t Y C k e R ! ( e-mail: k i N t A s u R ! )
Martes 22.12.2009 / 13:26
cke trnz puthos aki la ckinta sur representando torres del sur y sus colonias aledañas packe wachen aun seguimos con un pocko d power puthoss..!..un saludo pa mis carnalithos el fresh . cixen . clear . blin . kike .fresa .. arre puthoss..!

( e-mail: )
Lunes 21.12.2009 / 14:26
a la V... pinchis culos jarudo lokos se los cocha pinchis chapetes colos y te apoyo mi cklen el wosker

SUENOKER ( e-mail: SUENO )
Lunes 21.12.2009 / 13:05
CUAL PINCHI GORUDOS ESE PINCHI BARRIO NACO DE DONDE SALIO TENGAN RESPETO ALA BIEGA ESCUELA DE SWK SOUTH SIDE LOCOS DE LA OBRERA PUTOS SUENOKER SE LOS COCHA

( e-mail: )
Lunes 21.12.2009 / 03:01
es todo MI FREE AKI ESTAMOS LOS JARUDO LOKOS EL KLEN PARA LO KE GUSTA Y USTEDES BIEN SABE KE EL JARUDO TENEMOS EL RESPETOS

free ( e-mail: )
Domingo 20.12.2009 / 17:34
al V... putos aki el jarudo controla el free se los cocha chavalas

carlitos ( e-mail: rsueno )
Domingo 20.12.2009 / 14:12
todos esos pinchis barrios de M... el mas H... on es SWK SOUTH SIDE DE LA OBRERA DE JUAREZ AUNK LE ARDA EL CULO

wosq ( e-mail: )
Domingo 20.12.2009 / 14:05
aqi estoy en el barrio jarudo lokos de la rps el woskersoteone saliendole por el barrio bjl

( e-mail: )
Domingo 20.12.2009 / 13:52
levantando jarudo lokos pinci popo cagado ye pinch violado del cuva qeeeeeeeeeeeeeeee

KINETROS KIIKEE ( e-mail: )
Domingo 20.12.2009 / 09:31
Q TRANZA PUROS QUINTEROTES LOKOTES GFOTES RIFAN Y CONTROLAN

IGuAnA bArRiO JArUdOtE LokOs! ( e-mail: hAcIeNDAsS!14 nOrTH ! )
Domingo 20.12.2009 / 04:45
k TraNzA Aki eL iGUAnnA Y eL sCkoR RiFaNdO en HaCiEnDa uNIvErsIdAd pOkoS PeRo LoKOS BjL NoRth Ay esTamOs mi JeNtE uyUn SaLuDo pArA El choRe De loS 38c Ay eStamOs CaRnAl i paRa eL kRoW De LoS fKn DeLa chAveÑA I Al MiKE De LoS BaRrIo AlTo wEsTh SiDE aY tAmOs KaRnAleSI pArA lOs jArUdO cUesTa!!!! eL iGuaNaOnE DE bArRiO aLtO jArUdOS LokOS!!!

pb7 ( e-mail: )
Domingo 20.12.2009 / 03:40
el siete los qOsha HeliO el wisO eL fatH

efra ( e-mail: ondk )
Domingo 20.12.2009 / 03:33
mi mejor amigo es jhon i tiene una chamarra de cuero de ganso lo amo

( e-mail: )
Sábado 19.12.2009 / 13:02
los de la 18 son culototes los putos no valen V... putos y el bawer ke H... ue su madre puro msh kana1!!

josee lalo ( e-mail: jose_lalo03@hotmail.com )
Sábado 19.12.2009 / 09:05
pinzhes puthos io soe de los 30 i nosotros rifamos i controlamos puthos i no nos agan nada x qe nosotros somos qulos jajajajajajaja baes

( e-mail: )
Sábado 19.12.2009 / 07:54
ey bola de chabalas ya bajenle de huevooos, ya llego el negro de la xv3 rifando y controlando. y al wey ke no le paresca aki lo voy a estar esperando

( e-mail: .. )
Jueves 17.12.2009 / 13:43
. . o n e k o n e . . ! ! Ds.

slata- ( e-mail: RPS, )
Jueves 17.12.2009 / 09:44
JARUDOTEE LOKOSS.EL SLAT. RPS.

chole XVI ( e-mail: )
Jueves 17.12.2009 / 08:56
Saludos a todos los chole XVI por que xten los hombres si valen V... pero quero qe sepan qe los chole son lo maximo ok

KINTEROS ( e-mail: )
Jueves 17.12.2009 / 07:05
Q TRANZA A QUI LOS QUINTEROS DEJANDO LA LINEA DE ADIARIO PUTOS (KINTEROS SUR) (RIFAN) *(RIP)**(KOSI-DEVOCK)*

el BUGGY EL SNAKE ( e-mail: )
Jueves 17.12.2009 / 05:49
EL BUGGY Y EL SNAKE RIFANDO TODO CD, JUAREZ SALUDOS A MI COMPITA EL FOSE K SE ALIVIANE EL CULO CHINGUE A SU MADRE EL SALADO PERRO MANTENIDO MUERDE MANOS CULOTE HPS3 DUKES3O COCHAN

( e-mail: )
Jueves 17.12.2009 / 05:20
elslat jarudolokoss rpss.putoss.

( e-mail: )
Miércoles 16.12.2009 / 12:43
ermanos x q se pelean amense unos a otros jajaaja yo los amo a todos vengan por mi y les dare amor a todos jajajaa estoi bien buena

( e-mail: )
Miércoles 16.12.2009 / 10:38
J A R U D O T E DOMINANNDO.LOKOS

( e-mail: B'JL- )
Miércoles 16.12.2009 / 10:35
AQUI ESTAMOSS TODOSS PARA LOS Q AMENASANN AHUEVOO B''JARUDOTELOKOS.

bJl! skoR! ( e-mail: b j l )
Miércoles 16.12.2009 / 09:47
sckor oner! cocha! y ala V... con los ke amenasan por internet al yesk jaja arre ay tamos barrio jarudo haciendas uno cuatro lokos!! pokos pero lokos!!!! bJl!

( e-mail: yesk )
Miércoles 16.12.2009 / 09:28
JaaRudoo el yeesk la neta no tengo miedo a nadie venganme ii matenme aqi los esperoo

tAtOoS 13 LOCKOS ( e-mail: TaToOs 13 lockos )
Miércoles 16.12.2009 / 06:43
jajjja se las pelamos oke jajjaaj maman mis chavillos si no la arman no valen V... niikiera pa gastar balas con ustedes no valen V... C... no les da verguenza levantar su barrio pedorro de 5 weyes jajajajajja maman chavillos jajaja tatoos 13 se los cochan saven bien pa ke se andan con M... noma ponganse a recordar cuando su barrio cagado le cayo para aca se fueron sin dos carros y con un P... todo fileriado de la cabeza P... tatoos 13 controla todo praderas y todo hacienda

*♫ô♫*mr Dreck ( e-mail: )
Miércoles 16.12.2009 / 06:29
puro cartel de juarez

kinteros ( e-mail: )
Miércoles 16.12.2009 / 05:34
kiintteroooteessss puuto0oss riiffaann

( e-mail: los # 1 )
Miércoles 16.12.2009 / 04:03
LOSSSSSS BJL.LOKOS

rp.s- ( e-mail: )
Miércoles 16.12.2009 / 03:18
ALAA BERGHAA JENNTEE AQUI LA NETAA LLA SAABEEN EL JARUDOO ES EL Q LA RIIFAAA.WEIIES I PUUESS LA RPS SON LOS Q MUEBBBEN AL BARRIO I LOS LBP.AHUEVO.

bhacienda ( e-mail: el flow i el recio putos )
Miércoles 16.12.2009 / 02:42
mira C... para empesar aunq seamos 5 nos pelan la V... putos.......bbbbbbbb.hhhhhhh.aaaaaaaa aunq les cueste pinches tatoos de mierda.un saludo alos ondk de parajes del sol i a los ofak del 18 i alos cuatro 20

jarudolokos ( e-mail: draksillo )
Martes 15.12.2009 / 19:49
eso ke kulero por ke no pones kien eres as de ser un pinche lepe culon, no sabes a mlo ke le tiras B.JARUDO.LOKOS ELDRAKONERSOTE DEL LADO BAJO PELIGROSOTE CONTROLANDO UNSALUDO PALM KLEN AYTAMOS YA SABES BJLFOREVER

( e-mail: )
Martes 15.12.2009 / 18:57
RIP YESK BJL NO PASAS dE 2 DIAS ASII Q AMARRATE Y SI NO CRES VIVES EN UNA CASA BLANKA CON UNA CANASTA EN EL PORCHE

( e-mail: )
Martes 15.12.2009 / 18:31
el snaaf esta de regresoooo hoooms jajaj BjL de vuelta lokoos ahoraa si viene lo bueno hahaha

tatoos 13 lockotes ( e-mail: tatoos13 )
Martes 15.12.2009 / 16:01
e neta me emperra esos pinchis rollos putos tiran much amierda pinchis bha( ke por cierto son como 5 jajaj si es ke kedan) neta P... no hablen y kaiganle pues pa ke wachen tatoos 13

drexxiti ( e-mail: )
Martes 15.12.2009 / 10:55
q tranas pinshes culos el dresxxiti de los jarudo nocturnos jaja un salido a mis compiyas los rps de el jarudo lks el drex bjl lbp ai estamos pa lo q gusten nenas

( e-mail: )
Lunes 14.12.2009 / 09:10
tHE SoFeRoNeR

bhaciendota ( e-mail: el recio i el flowuoner )
Lunes 14.12.2009 / 08:35
vallance ala V... los sut los meniados jajajaja mas bien los miados putos nos pelan la V... putos jajaja uyuyui al tiro con los miadoz jajajaja

ttHee ssNiiCkQ! ( e-mail: CkiiNtteeRoossuuR! )
Domingo 13.12.2009 / 13:37
uuN ssaaLuuddoossCkY paaL CkiiCkee ' iiaa see Laa saaVee mee ccHaaVoo Ckee paa ssiieeMppRee Laa CkiiNttHaa ssuuR pooCkooss peeRoo LooCkooss eeN Laa meemooRiiaa ddeeL CkoozzY aaNdd deeVooCk Ckee eeN paazz ddeessCaaNsseeN ii aaH Laa VeeRgaa Looss Ckee nooss aaN ccHaapeettiiaaddoO dee RaattHoo see ttHoppaaRaaN bieeN ssaaveenn ' soomooss ffaamiiLiiaa suuReeÑaa..!

kinteros ( e-mail: )
Domingo 13.12.2009 / 06:11
k tranza chabalas aki los kinterotes surenotes rifando putos y controlando pocos pero lokos (b5ta)(sur) (forever) (rip) (koosii-deevoock)

THE KLEN ( e-mail: JARUDO LOKOS )
Domingo 13.12.2009 / 03:54
EL KLEN DE JARUDO .. LOKO .. AKI ESTAMOS JENTE PARA TODOS LOS UNIDOS PURA CUESTA OK .. EL KLEN PARA LO KE GUSTE AY TAMOS Y LOS ENTRADOS JAJA ME DAN RISA INCHIS BOLA DE PENDEJOS JAJA ..

EL DAFe ( e-mail: )
Sábado 12.12.2009 / 14:58
SOY EL DAFE DE LOS WEST SIDE KILLER 77 DEL ROMA AA Y UN SALUDO A MI PRIMO EL YSTO DE LOS PAN CON LECHE 725 Y AMI COMPOTA EL PLAC

n0r ( e-mail: )
Sábado 12.12.2009 / 05:32
k ranza pinchez chabalaz ya sabemn k l0z nskgaliana l0s c0chan sanben k k0nr0lam0s de n0rte a n0rte

kinteros ( e-mail: )
Jueves 10.12.2009 / 16:36
no tiren mucho pinche royo putoss aqui los kinterotes sur rifando y ya culos b5ta sur {rip} {kosi-devock}

TaTooS 13 ( e-mail: sUtAtToS 13 )
Jueves 10.12.2009 / 12:36
JAJAJJJA KE BARRIO HACIENDA JAJAJAJ NO MAMEN ESO YAN I EXISTE YA LOS DESAFANAMOS CULEROTE VALLANSE AL AVERGA APOCO KIEREN CALARSE D ENEUVO SI SAVEN BIEN KE SON CHAVALAS TATOOS 13 CONTROLAN PUTOS AUNKE LES ARDA Y PINCHIS BDR Y LOS LUNEROS YA NOS BAJARON BANDERA JAJAJJAJAJAJAJJAJAJAJAJAJAJAJJAJAJAJA CULOTES NO PUEDEN CON LOS MENEADOS JAJAJA CHAVALASS

el flow de la ofak del 18 ( e-mail: b.h.a )
Miércoles 09.12.2009 / 10:39
qe tranza de new el flower y el exa del barrio haciendota i de la ofak 420 del 18 putos jajajaa

( e-mail: bJL el yeskaaa )
Martes 08.12.2009 / 17:05
el yeesk wofe ii el duda de los cangri crews del jarudo coshan ii un saludo para mi carnalito skor de las haciendaas amarranese para q sientan el poder de todo ejercito jarudo los entradoos

jajajajajaja ( e-mail: exaktonersote )
Martes 08.12.2009 / 13:35
ke tranza pinche bola de chavalas esto va pra los pinches nenas de los bdr y tatoos 13 pra ke tiran tanto pinche roio si saben bien ke no valen V... ninguno de los dos barriesillos cagados si cuando c topan c tiran besos pinches nenas atte el exaktote barrio haciendas y el flow ofa 18 jajaja

bJl! skoR! ( e-mail: BJL )
Martes 08.12.2009 / 07:12
bJl . ScKoOrr! oNe ciTy Em!

BJL! HACIENDAS 14 ( e-mail: SKOR! IGUANA! )
Martes 08.12.2009 / 07:08
ALA VERGA CON LOS 613 SON CULOTES Y ESO QUE YA SOMOS REPOKIYOS PERO EN MARZO SE DEJA VENIR EL FREDY AFAN LOKO SMIK TEK! PERO PS ESTAMOS SOLOS YO I LA IGUANA Y EL GUERO Y NI ASI LA KUAJAN PINCHES TERROZOS COMO DISE EL GUN CON UNO SOLO TIENEN! YO EL SKORSOTE!! SOLO CONTRA USTEDES!!!PINCHES BATITOS MIERDAS ...! STILE NORTH 14 Y BARRIO JARUDO HACIENDA!KONTROL!4EVER UN SALUDO PA LOS RPS Y PA LOS LBP DE RRATO AI ESTAMOS!

( e-mail: )
Martes 08.12.2009 / 05:47
pinchis choliyos cagaos

( e-mail: )
Lunes 07.12.2009 / 23:19
pff'' jeje lo encontre x error

el flow de la bha ( e-mail: puro haciendota )
Lunes 07.12.2009 / 18:07
que rrollo mi deack de los south park soi el flow de la bha

el flow de la bha ( e-mail: puro haciendota )
Lunes 07.12.2009 / 18:02
el denso de donde carnal

anonimo ( e-mail: anonim0o )
Lunes 07.12.2009 / 07:49
in memory of denso 1990-2009 qui con la gente

el deack ( e-mail: )
Domingo 06.12.2009 / 17:40
vallancen ala V... todos los sut i los luneros el deackeroner de los south parck de hacienda las torres

( e-mail: )
Sábado 05.12.2009 / 09:39
K ROLLO MI DRAK AKI ESTAMOS LOS LADOS BAJO CREW .. NO POES YA SABE Y SIMON PSC 1 AKI ESTAMOS OK EL KLEN PARA LO KE GUSTEN LOS ENTRADO Y CHINGUEN ASU MADRE LOS KE SE PASARON DE BERGAS AY BAMOS POR USTES OK ..

alex ( e-mail: alex_elyogie@hotmail.com )
Sábado 05.12.2009 / 05:43
18 rifa

alex ( e-mail: alex_elyogie@hotmail.com )
Sábado 05.12.2009 / 05:31
www.metroflog.com/el_collas

alex ( e-mail: alex_elyogie@hotmail.com )
Sábado 05.12.2009 / 05:21
ei k roio pos aki el grafitero d los santanas 18 ok ora

spoon ( e-mail: www.myspace.com/pryncipales1 )
Viernes 04.12.2009 / 15:21
pii cii eess unooo.. TIERRAA NUEVAAA, KONTROLANDOO KOMOO SIEMPREE GENTEEEEE... EL SPOON SHIDOO ALOS GRAFITEROOS DE LA CIUDAD... PCS1 PCS1 PCS1 PCS1

jarudolokos ( e-mail: drak )
Viernes 04.12.2009 / 14:35
ke tranza P... H... en su madre los entrados B.JARUDOLOKOS. EL DRAK UN SALUDO PARA EL LADO BAJO PELIGROSOTE , BJL DRAK

joma ( e-mail: )
Jueves 03.12.2009 / 09:35
le joma y yaira kartel cronicos 312 la krocitos rifa kc

by joma ( e-mail: )
Jueves 03.12.2009 / 09:31
kartel cronicos 312 rifa el joma

kike ( e-mail: )
Jueves 03.12.2009 / 06:49
llo soy el mas H... on putos elkike kocha pinhes jpotos

( e-mail: bjL pcs 1 )
Miércoles 02.12.2009 / 20:26
principaleeeeeeees 1 jarudoooooooo locooooooos

jose ! ( e-mail: )
Miércoles 02.12.2009 / 05:17
eh puto0os ya dejense de P... y no anden de pinchisz ablado0res pende... si la ban a armar kaiganle pt0os pcs1!! ya se la saben put0os !!

La pp ( e-mail: )
Miércoles 02.12.2009 / 05:12
k roio0 AKI PAZANDO0 A ZALUDAR A LO0 k rifan y ko0ntro0la la cho0le 14 bueno0 zo0lo0 para k zepan kienz zon lo0 v. kuidence byeeee!!! in memo0ry o0f jjo0na te vamo0z a xtrañar________________________

erick ( e-mail: )
Martes 01.12.2009 / 11:27
soy el erick de aca de las cruces puros pan con leche crew pcl 725 crew fuck you all

exo0r nsg ( e-mail: )
Domingo 29.11.2009 / 15:01
q tranza puto0s el exo0r co0ntrolando0 la galeanota puro0 no0rth sidee 18 lo0ko0tes el exo0r i el so0re pts

( e-mail: )
Domingo 29.11.2009 / 12:18
COMO TIRAN ROYO PENDEJJOS LO MAS SE GURO ES QE SEAN UNA BOLA DE CULOOOSSSSSS DETRAS DE UNA COMPUTADORA....ENBES BES DE ANDAR PRECUPANDOSE DISKE POR EL BARRIO SE DEBERIAN DE DEJAR DE MAMMMADAS Y PENSAR EN ASER DINERO DE CUALQIER MANERA...PUROO JUAREZ ______________________ ..

eeL gaattHiiCk ooNee ( e-mail: b kiiNttHeeRooss ssuuR )
Domingo 29.11.2009 / 06:21
a la V... los ctwt ya ni existhen jaja.. i pz los hps1 caeganle pa ver ckienes son mas ckulos arres puthass..!K I N T E R O T E S !

( e-mail: )
Viernes 27.11.2009 / 07:18
JAJA NO POES MM ESKE NO TIRAMOS ROLLO WE MM SI LO TENEMOS SE KIEREN KALAR MM COMO KIERAN WE MM NO POES YA SABE KE AKI ESTA EL KLEN .. DE JARUDO LOKOS CONTRALANDO ALOS KE SE PASAN DE BERGA OK JARUDO LOKOS ....

( e-mail: )
Viernes 27.11.2009 / 07:01
in memory of denso te vamos a extrañar un H... o nunca olvides que te queremos muxo descansa en paz

el kikeonersote ( e-mail: )
Viernes 27.11.2009 / 05:58
los kinteros rifan pinches harpis culos b5terotes sur putos rip kosi devock

SPOON PCS1 ( e-mail: espoonjaz@hotmail.com )
Viernes 27.11.2009 / 01:18
SPOONE SPOONE SPOONE SPOONE SPOONE SPOONE SPOONE ONEEEEEEE... PCS1 TIERRA NUEVAA RIFAAA LA PRIMERA ETAPOTAAA..... TAGGER Y BOMEADOR DE KORASON ESEEE WASHEN ESTOOO... EL BUEN RAP DE JUARITOS PARA TODOOS LOS KE KIERAN SHIDOOO.. WWW.MYSPACE.COM/PRYNCIPALES1 WWW.MYSPACE.COM/MCMANHY

spoon ( e-mail: espoonjaz@hotmail.com )
Viernes 27.11.2009 / 01:11
QUEE TRANZAA.. PURAAA PCS1 LOKOTEES. WARASHES LOKOS KON EL TORY AMI LADOO FABRIKANDOO LOS DE TRES PUNTOS ESEEEEE... EL SPOON UN SALUDOO ALOS TAGGERS DE VERDAD.. TIERRA NUEVA REPRESENTAMOS

Slow ( e-mail: )
Jueves 26.11.2009 / 10:13
PURO BARRIO AZULOTE DE AKA DE ZARAGOZA JUARITOS RIFA PUTOS!!!!!!!!!1

clow ( e-mail: )
Jueves 26.11.2009 / 04:26
puros terrenotes 13 el clow puros terrenotes 13 el clow puros terrenotes 13 el clow puros terrenotes 13 el clow puros terrenotes 13 el clow puros terrenotes 13 el clow puros terrenotes 13 el clow puros terrenotes 13 el clow puros terrenotes 13 el clow puros terrenotes 13 el clow puros terrenotes 13 el clow puros terrenotes 13 el clow puros terrenotes 13 el clow el clow.macho.cholo.beloz.baner.tanja cochan putos

soniK! IGUANA! BJL 14 ( e-mail: )
Miércoles 25.11.2009 / 15:31
AMARRESE PINCHES SEIS 13 QUE YA VALIERON VERGA JAJA PINCHE OKLEER CULON NO PUDISTES ASER DE AGUA A SKOR SE DIERON UN TRENSE I ASTA SE KAIO SKOR I NI ASI LO ISISTES DE AGUA WEY TE VERGIO GACHOTE PERO YA MAMASTES AMARRENSE KE AI LES VAN LOS ENCOBIJADOS!

cartelonsote 23 ( e-mail: harpisotes 1 )
Miércoles 25.11.2009 / 02:50
culos los kta bmt rmz tfk ssp bkl psk brl ylc usk bsp bdr sutatos pfk entre otras chavalas que no valen mas que pa pura verga

( e-mail: )
Martes 24.11.2009 / 16:50
barrio0 n0orth side diciocho0ta de la galeano0ta putho0s el exo0r so0re neto0 niclo0 dan axer so0uk so0ne flex mago0 fo0ke so0wy pens co0sm0o ro0yer so0l cro0w flo0mer ia pinches jarudo0s c0omo0 tiran ro0i0o puto0s el exo0r de la nsl 18 los cocha barrio no0rte puto0s

( e-mail: )
Martes 24.11.2009 / 13:42
fucking cobras of ep suck my dick like old the fuckin pouser in cd juarez like the gang pnl

DiiAaNiiThAa ( e-mail: .... )
Martes 24.11.2009 / 12:59
amorr virthuaal,,,, soloo speroo nuu bolbermee aa eqkiivooqkarr qkoontiwoo nethaa qkee speroo qkee noo me defraudess ii qkee noo stess usandoo todoo esoo nadamas paraa ndar qkonmiwo,,i dspoess mandarme alaa DIQK qkomo toodooss nethaa porfiiss iaa nu mee aghan mas dañoo..! PCS1

( e-mail: )
Martes 24.11.2009 / 11:35
POBRES 13 POBRES 13 POBRES 13

( e-mail: http://www.losmx.com/chihuahua/chat/juarez.html )
Martes 24.11.2009 / 07:07
arres entrenle al chat de juarez pa ke se armen las riñas chidas

ENTREN AL CHAT DE JUAREZ ( e-mail: http://www.losmx.com/chihuahua/chat/juarez.html )
Martes 24.11.2009 / 06:58
KE ROLLO MALILLAS INVITANDOLOS A KE ENTREN A STA SALA PARA CHATEAR PA KE SE DIGAN TODO LO KE KIERAN WEYES NOMAS PONGAN SU NOMBRE DE USUARIO SIN CONTRASEÑA Y ARRES MIENTENSE LA MADRE TODO JAJAJAJ

OSMOTE COCHON ( e-mail: BYG.TRSTE13 AZTECAS )
Martes 24.11.2009 / 04:54
PURO KARTEL DE JUAREZ..CONTROLANDO A LA GENTE DE EL CHAPIYO

( e-mail: )
Martes 24.11.2009 / 02:58
IN MEMORY OF MASUKA MOCO CEBOLLAS EL DIEGO DALILA GOGOÑO CUI EL SANTOS Y MIGUEL GALVAN LA TARTAMUDA

snake baby dks 30 bsm 13 ( e-mail: )
Martes 24.11.2009 / 02:52
k transa cabrones el baby delos bsm y el snake 30 son H... ones H... uen a su madre el chino y el scrapy de la mb y todos sus punchis compas culos los hps3 los mochos 13 y los fta son chapetes culos mama pitos el baby bsm locotes northside ya saben donde estoy putos de M... pa cuando quieran culos

( e-mail: )
Lunes 23.11.2009 / 10:25
pobres 13 la jente del aliviane

el yoyitos ( e-mail: )
Lunes 23.11.2009 / 10:21
in memory of el yoyitos pobres 13

el aliviane ( e-mail: )
Lunes 23.11.2009 / 10:18
pobres 13 no ay pedo si andan los bck o4d cvs38 de roma ya les matamos 2 y al denso. el aliviane

para los cole14 ( e-mail: )
Lunes 23.11.2009 / 10:10
pobres 13 les dijimos q ivamos por los chole falta el cosilla fabian y el negrito los del aliviane ala V... el denso

DiiAaNiitHhAa ( e-mail: dianitha is very very happy.. )
Lunes 23.11.2009 / 03:36
jojo nuu tniiaa naada qkee aserr ii pss me pusee aa sqkriibirr qkashithoss deee qkancioneess qkee me gusthan mushooo .....aeaeaeaee dee laas mamiiss teeaam sholithaa dee laa PCS 1

DiiAaNiiThHaA ( e-mail: dianitaa iss very very happy )
Lunes 23.11.2009 / 03:30
ASI FUE (playa limbo) qkoomo lee dighoo kqee tee amoo ,,,,sii mee aa preegunthaadoo ioo lee dijee qkee nooo....¡Û ADIOS..(jesse & joy) duelee no teneerthee cerqkaa dueele noo senthirr thuu vooozz..! ESTAR EN THU MUNDO (reik n sin bandera) necesiithoo qke me loo digas ,,io qkieroo qke me lo digass qke mi amor segiraq kreciendoo mas & mass..! qkieroo qkee siempree seaas miaaa ...qkieroo saber si lo qke sienthes es profundooo..! PUTA DESAGRADESIDA (enriqke bunbury) NOO,,qkonoosqko aa naadiee qke mienthaa qkomoo thuu qkee qkoon tanta disiplinaa presisioon ii sinceridaadd,,te ganasthe thuu lugarr ..jjojo UN BUEN PERDEDOR..(sin bandera) naraanaaraa,,,see qkee piensaas marsharthe iaa lo see i no te detendree,,as lo qke tuu qkieraas sim embargo reqkuerdaa qke ioo staree akqee en el mismoo lugarr ii si solo tienes ganas dee ablarr qkon gusth te sqkusharee,-! ii sii el supo darthe mas amor supo ienarthe mas qke io,,qlaro ¢®qkee se perder qklaro qke se perder! pss nuu tngoo

dianitaa ( e-mail: qkeniita_onerziita@hotmail.com )
Domingo 22.11.2009 / 13:55
auun tee amoww gathithoo ...,,,

eeL gaattiiCkeeR! ( e-mail: kiNtAsUr.cOntROLandO tOrreS deL suR )
Domingo 22.11.2009 / 13:41
•BARRIO QUINTEROS SUR LOCKOTHES•IN MEMORY OF CKOZY DEVOK SNART•

skoR! BJL HACIENDAS 14 ( e-mail: )
Sábado 21.11.2009 / 13:42
ALA VERGA HELIO AMARRATE LOMERO KE YA ME CAISTES EN LA MERA VERGA! NETA WEY MEJOR AMARRATE KE VAS A KEDAR SOBRE EL PAIMENTO HIJO DE TU RREPUTA MADRE PINCHE VATO CAGADO NETA !VAS A SENTIR EL COLOR PUTO EL PINCHE SKOR TE COCHA I BIEN SABES KE IO SOLO AGO KE ME LA MAMAES HIJO DE TU PERRA MADRE ASI KE AMARRATE PENDEJO EL SKOR TE COCHA Y TE COCHARA!

elkikeonersote ( e-mail: )
Sábado 21.11.2009 / 10:47
puro kinterotes surenotes putos b5ta torres del sur rifan in memori of kosi devock

( e-mail: )
Sábado 21.11.2009 / 05:58
BARRIO JARUDO LOKOS

( e-mail: oneQkeroner...Ds )
Viernes 20.11.2009 / 17:09
el ooneeek del Ds.....!!

kinteros sur ( e-mail: )
Viernes 20.11.2009 / 08:08
kiintterrottess lookoottess reepresentando puutoss

el nerocker {kike} ( e-mail: )
Viernes 20.11.2009 / 08:05
aqui los kinterotes dejando linea putos desde torres de sur b kinta sur rifa putos in memori of:kosi/devock

( e-mail: )
Viernes 20.11.2009 / 08:03
in memory of my love densen boy cvs 38 bck 14 by betty boop

( e-mail: )
Viernes 20.11.2009 / 07:58
y un saludo para todos los chole 14 y alos cvs 38 chidooo

( e-mail: )
Viernes 20.11.2009 / 07:54
na pz aqi deseandole a mi amor el denso de los cvs 38 qe descance en paz y qe siempre lo voy a amar como no se imagina descansa en paz mi amor by tu chata

el kike ( e-mail: )
Jueves 19.11.2009 / 07:55
el enrike putos

la paupau ( e-mail: )
Jueves 19.11.2009 / 05:55
esst es la paupau de aki de las cruces new mexico la mas H... ona del barrio!!!!!!!!!!!!!!!!!!!!!!!!!!

ACK))KREW ( e-mail: )
Jueves 19.11.2009 / 04:32
BARRIOOO AZULOTEEE WS DE LA ZARAGOZA JUARITOZ ACK SBA ATC KONTROLANDO Y RIFANDO EN LA CALLES DE JUARITOS!!!!!!!!!!!!!!!!!!

el pavis ( e-mail: )
Jueves 19.11.2009 / 04:13
el pavis el mas H... on puro barrio azulote de aka de zaragoza juaritos!!!!!!!!

HeLiO! ( e-mail: )
Miércoles 18.11.2009 / 15:53
BARRIO SIETE!

SPAIK ( e-mail: )
Miércoles 18.11.2009 / 07:56
PAN CON LECHE SPAIK

KEKO ( e-mail: )
Miércoles 18.11.2009 / 07:39
UN SALUDO PARA EL KEKO Y DAISY QUE SE AMAN A Y PUROS PAN CON LECHE Y CHIQUITOS TEAM RIFAN

KIKE ( e-mail: )
Miércoles 18.11.2009 / 07:35
EL KIKE ES EL MAS CHINGON DE LOS QUE ESCRIBEN A KI

ARIANA ( e-mail: )
Miércoles 18.11.2009 / 07:27
SOY ARIANA LA MAS CHINGONA DE LOS PANCON LECHE

SPAIK ( e-mail: )
Miércoles 18.11.2009 / 07:16
SOY EL SPAIK DE LOS PANCONLECHE CREW DE ACA DE LAS CRUCES

GRATE ( e-mail: )
Miércoles 18.11.2009 / 06:51
EL GRATE DELOS PANCON LECHE

ysto ( e-mail: )
Miércoles 18.11.2009 / 06:36
YSTO YSTO YSTO YSTO YSTO YSTO YSTO YSTO YSTO YSTO YSTO PAN CON LECHE GRAFFITEROS CREW CHINGONSOTES

SLOW ( e-mail: )
Miércoles 18.11.2009 / 06:18
SLOW SLOW SLOW SLOW SLOW SLOW SLOW SLOW SLOW SLOW SLOW SLOW DE ACA DEL BARRIO AZULOTE

ysto ( e-mail: )
Miércoles 18.11.2009 / 06:15
PAN CON LECHE CREW 725 ONES GRAFFITEROS

chikitos team ( e-mail: ar1anna575@hotmail.com )
Miércoles 18.11.2009 / 06:08
en paz deskanse un gran compa ke lo keriamos y keremos muncho R.I.P oscar calderon herandez te vamos a extranar muncho!!!!!!!!!!!!!!!!!!!!! :( :(

pavis ( e-mail: el_ysto@hotmail.com )
Miércoles 18.11.2009 / 06:05
soy el slow de aca del barrio azulototote el mas H... onsote

mk ( e-mail: )
Miércoles 18.11.2009 / 05:54
el enrike

SNAKE30 ( e-mail: )
Miércoles 18.11.2009 / 01:56
EL KLEN COMO QUIERAS PINCHI PENDEJO DE MIERDA TU Y TU PINCHI GENTESITA ROÑOSA DONDE QUIERAAPUTO LOS JAROCHOS O COMO ES TU PINCHE BARRIO CAGAADO CHINGA TU PUTA MAdre cojida saludos para el axer y el mega del barrio alto el snake fose cause grove gogoño cui y el sopas H... ue su madre la golla

Foxy ( e-mail: francisco_00011@hotmail.com )
Martes 17.11.2009 / 03:39
foxy

( e-mail: )
Domingo 15.11.2009 / 13:10
te vaas a morir pinche acme

jorge ( e-mail: acmer.lopez@hotmail.com )
Domingo 15.11.2009 / 09:26
Que onda my gente de los msk galeanota soy el acme saludos para todos mis compas tambien para los de la 19 velarde espero q se acuerden de my toda my gente H... ona saludos para el host,sek,oner,saico,mask,diablo,loco,unick,gasp,fame,kope,el noe,drack,hamt,eroek,smash,soul,kiko,spoke,saludos para todos ustds y los q me faltaron msk rifa alwais and forever *3l @cm3 msk*

dobladote amuete ( e-mail: )
Sábado 14.11.2009 / 12:57
q transa putos somos los vergotas de juarez controlando las calles para lospcs q vergera les quedo su rola doncellas m de marrenos puro pa delante jente

nOox ( e-mail: nox )
Sábado 14.11.2009 / 12:22
que rrollo putos jarudo lokos un saludo para el drak el nox controlando lbp

andy ( e-mail: el_ysto@hotmail )
Sábado 14.11.2009 / 09:39
los graffiteros mas H... ones de todo cd. juarez los pan con leche crew el ysto el esmo grate 725 crew se la rifan H... on para el arte graffitero

andy ( e-mail: el_ysto@hotmail )
Sábado 14.11.2009 / 09:22
soe el ysto de loz pan con leche crew 725

norte forever ( e-mail: norte loko el ARES )
Sábado 14.11.2009 / 07:23
que un saludo a toda mi jente norteñota alos del 72 alos sc de todo juaritoz y un saludito alos jarudillo ay estamos lokos

La pp ( e-mail: )
Sábado 14.11.2009 / 06:00
zaludo0s a lo0z de la cho0le 14 echenle ganazz... c sabe k ustedez rifan y ko0ntro0lan. en especial al fro0s

kike ( e-mail: )
Sábado 14.11.2009 / 02:55
pobres 13 rifa kul...

FrEDY!BaCkEr! BjL! ( e-mail: jArUdOtE HaCiEnDAS )
Sábado 14.11.2009 / 02:22
mire crowe ya mejor desafanete ke esta escopeta 12 no respeta a perros lambe huevos como tu P... tu ami no me sacas pero yo aty si asi que cuidate las espaldas que un dia de estos te quedas sobre el paimento P... i es de neta no es M... hom i para los msf el draw igual ia desafanese mijo ke tambien ya trampamo una eskopeta 6tiros expansivos asi que amarrense i para los msh ya ni quien loss aga en la vida ya superenos! jaja de ustedes ya ni nos akordamos jajja pero si quieren pedos de nuevo pues arre traigo muchos tiros para defende ami jente o pa cubrir al backersiyo BJL HACIENDAS FREDY LOKOTE BACKER Y EL SKOR! ARRE!

skoR! BJL HACIENDAS 14 ( e-mail: )
Sábado 14.11.2009 / 02:17
JAAJJA NO MAMES DRAW MEJOR DESAFANATE WE PINCHE CHOLO DE A MENTIRITAS KE ERES TODO PINCHE GACHO ESTAS WE ASTA GUELE A KAKA KUANDO VEO EL MURAL WE IA MEJOR DESAFANESE KULERITO I LOS MSF VIEN SABEN QUE SON CULONES ACG I WF TAMBIEN PURO MIERDA! Y LOS UNIDOS JAJA NO ME AGAN REIR E CROWE PONGASE VERGAS KE JARUDO HACIENDAS VA CON TODO Y